ID: 1167213062

View in Genome Browser
Species Human (GRCh38)
Location 19:48145653-48145675
Sequence ATGAGGCAGCAGAGTGTGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 534
Summary {0: 1, 1: 0, 2: 2, 3: 41, 4: 490}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167213054_1167213062 23 Left 1167213054 19:48145607-48145629 CCTTTGGTATGAACTTGGGGTTT 0: 1
1: 0
2: 1
3: 16
4: 128
Right 1167213062 19:48145653-48145675 ATGAGGCAGCAGAGTGTGGTGGG 0: 1
1: 0
2: 2
3: 41
4: 490

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167213062 Original CRISPR ATGAGGCAGCAGAGTGTGGT GGG Intronic
900087188 1:904284-904306 AGGACGCAGCAGAGGGTGGGGGG + Intergenic
900209048 1:1444526-1444548 ATGAGGCTGCAGAGTGATGTGGG + Intergenic
900218883 1:1496444-1496466 ATGAGGCTGCAGAGTGATGTGGG + Intronic
900925621 1:5704373-5704395 AGGAGGCTGCAGAGGGAGGTGGG + Intergenic
901270437 1:7949033-7949055 ATGTGGCAGTATGGTGTGGTGGG - Intergenic
901687148 1:10949329-10949351 AGGAGGCAGCAGAGGGTGGGGGG - Intronic
901740987 1:11341773-11341795 CTGAGGCAGGTGAGTGTGGTTGG + Intergenic
902050592 1:13561110-13561132 AGGAGTCAGCAAAGGGTGGTGGG - Intergenic
902385852 1:16075371-16075393 TTGAGGCAGCAGCGTGGGATAGG + Intergenic
903294571 1:22335600-22335622 CAGAGCCAGCGGAGTGTGGTGGG + Intergenic
903632742 1:24788832-24788854 AAGAGGCAGCAGGATTTGGTTGG - Intronic
904170189 1:28586322-28586344 GAGAGTCAGCAAAGTGTGGTGGG - Intergenic
904394422 1:30208995-30209017 AGGAGTCAGCAAAGGGTGGTGGG - Intergenic
904873663 1:33636989-33637011 AGGAGGCTGCTGAGTGTGGGGGG - Intronic
905227808 1:36491305-36491327 ATGAGGCTGCAGGGTGAGGAAGG - Intergenic
905817045 1:40959542-40959564 AAGAGTCAGCAAAGAGTGGTGGG - Intergenic
906072163 1:43024966-43024988 ATGAGGAAGAAGAGGGTGATGGG + Intergenic
906518249 1:46452244-46452266 AAGAGGAAGCAGAGTGGGGCTGG + Intergenic
906560917 1:46756222-46756244 CAGAGGCAGGAGAGTGGGGTAGG - Intergenic
906849131 1:49229018-49229040 ATGAGACAGCATGGTGTGTTTGG - Intronic
907396138 1:54191238-54191260 AGGAGGCAGCAGGGTGTTCTTGG - Intronic
907457642 1:54585699-54585721 TGGTGGCAGCAGGGTGTGGTGGG + Intronic
908903013 1:68977948-68977970 ATGAGGCAGTACAGTGTTATAGG - Intergenic
909366880 1:74835116-74835138 GGGAGGCAGCAGAGTCTGATGGG - Intergenic
909729132 1:78872500-78872522 AGGAGTCAGCAAAGTGTGATGGG - Intergenic
910462722 1:87466138-87466160 ATGACGGAGCAGAGTATGGAAGG + Intergenic
911271974 1:95812875-95812897 ATGAGGCAAGAGAGTGTGAGGGG + Intergenic
912937420 1:114015735-114015757 ATGAGGAAGCAGATTCTGGGAGG + Intergenic
912962169 1:114206017-114206039 ATAAAGCAGGAGAGTGTGGAGGG + Intergenic
913317165 1:117563076-117563098 ATGAGGAAGCTGTGTGTGGGAGG - Intergenic
914453387 1:147813028-147813050 ATGAGTCAGAATAGTGGGGTGGG + Intergenic
914710197 1:150206123-150206145 AGGAGTCAGCAAAGGGTGGTGGG - Intergenic
916839989 1:168590156-168590178 ATGTGCCAGCAGAGTGTACTGGG - Intergenic
916853349 1:168726143-168726165 AGGAGGCAACAGAGGGTGGAAGG + Intronic
918331453 1:183464856-183464878 ATGTGGCAGGAGAGGGTGCTAGG - Intergenic
918516412 1:185368739-185368761 AGGAGGCAAAAGAGTGTGTTGGG + Intergenic
918771608 1:188567898-188567920 AGGAGTCAGCAAAGGGTGGTGGG - Intergenic
919511176 1:198466543-198466565 ATGATACTGCACAGTGTGGTTGG - Intergenic
920026506 1:203002042-203002064 AGGAGTCAGCGAAGTGTGGTGGG + Intergenic
920759052 1:208763927-208763949 GTGAGGCAGCAGAGAGAGGGAGG - Intergenic
921053721 1:211528560-211528582 AGGAGGCAGCAAAGGGTTGTGGG + Intergenic
921320527 1:213934200-213934222 AAGAGGCAGCAGGGTGCAGTGGG - Intergenic
922369318 1:224893433-224893455 AGGAGTCAGCAAAGGGTGGTGGG - Intergenic
922784681 1:228277054-228277076 AGGAGGCAACCGAGTGGGGTCGG - Intronic
923446089 1:234072756-234072778 ATGAGTCAGCAAAGAGTGGCAGG + Intronic
923978277 1:239289686-239289708 ATGAAGCAATAGAGTGTGGCTGG - Intergenic
1063457376 10:6193658-6193680 AGGAGTCAGCAAAGGGTGGTGGG + Intronic
1063958040 10:11283844-11283866 ATGAGGGATGAGTGTGTGGTGGG + Intronic
1063958063 10:11283945-11283967 ATGAGGGATGAGTGTGTGGTGGG + Intronic
1063958072 10:11283997-11284019 ATGAGGGATGAGTGTGTGGTGGG + Intronic
1063958081 10:11284049-11284071 ATGAGGGATGAGTGTGTGGTGGG + Intronic
1063958148 10:11284357-11284379 ATGAGGGATGAGTGTGTGGTGGG + Intronic
1063958170 10:11284454-11284476 ATGAGGGATGAGTGTGTGGTGGG + Intronic
1063958176 10:11284480-11284502 ATGAGGGATGAGTGTGTGGTGGG + Intronic
1063958183 10:11284505-11284527 ATGAGGGATGAGTGTGTGGTGGG + Intronic
1065539357 10:26745473-26745495 ATGAGGCGGCACATTGTGGGTGG + Intronic
1066041202 10:31549468-31549490 ATGAGGCAACACAGTGAGGCAGG + Intergenic
1066102924 10:32133797-32133819 AGGAGTCAGCAAAGGGTGGTGGG + Intergenic
1066103635 10:32138562-32138584 AGGAGTCAGCAAAGGGTGGTGGG + Intergenic
1066350938 10:34636327-34636349 AGGAGGCAGCAGTGTGGGTTTGG - Intronic
1066436591 10:35401689-35401711 CTGAGTCAGCAAAGTGTGGTGGG + Intronic
1067098947 10:43320908-43320930 AAGAGTCAGCAAAGGGTGGTGGG - Intergenic
1067684008 10:48456595-48456617 AGGAGGCAGGGAAGTGTGGTTGG + Intronic
1069926280 10:71852755-71852777 GTGAGGCAGCTGAGTGAGTTGGG + Intergenic
1070242735 10:74699206-74699228 CTCAGGCCCCAGAGTGTGGTTGG - Intronic
1070307143 10:75246334-75246356 GTGAGGCAGCAGGGAGTGGTGGG - Intergenic
1071782070 10:88856887-88856909 CTGAGGGAACAGAGTGAGGTTGG - Intergenic
1073018365 10:100420188-100420210 AGGAGGCAGCAGAGTGCTCTAGG + Intergenic
1073457402 10:103645910-103645932 AAGAGGCAGCAGAGTGTACAGGG + Intronic
1074103437 10:110371835-110371857 AGGAGTCAGCAAAGGGTGGTGGG + Intergenic
1074776301 10:116770557-116770579 ATGAGGCAGCAAGGTGGGGTGGG + Intergenic
1075022771 10:118963695-118963717 AGGAGTCAGCAAAGGGTGGTGGG + Intergenic
1075170246 10:120106698-120106720 GAGAGTCAGCAAAGTGTGGTGGG + Intergenic
1075388821 10:122077548-122077570 ATGAGGCAGGAGAGGGAGGTTGG + Intronic
1076375147 10:129978782-129978804 ATGGTTCAGAAGAGTGTGGTTGG - Intergenic
1076742554 10:132494005-132494027 ACGAGGAAGCAGAGTGGGGAGGG - Intergenic
1077075731 11:701098-701120 AAAAGGCAGCAGAGTCTGGAGGG + Intronic
1077807247 11:5602601-5602623 CTGAGGCAGCAGTGTGTTTTAGG + Intronic
1078411168 11:11120069-11120091 AGGAGGGAGGAGAGTGAGGTTGG - Intergenic
1078858010 11:15222081-15222103 TTCAGGCAGCAGGTTGTGGTGGG - Intronic
1080574995 11:33590361-33590383 TTGAGGCAGGACAGTGTGGTGGG - Intronic
1081751794 11:45516519-45516541 ATCAGGCATAAGAGAGTGGTGGG - Intergenic
1083701752 11:64483938-64483960 AGGAGTCAGCAAAGGGTGGTGGG + Intergenic
1083832854 11:65243996-65244018 ATGGGGCAGCAGGCTGGGGTGGG - Intergenic
1084020208 11:66412813-66412835 CTGAGGCAGGAGAGGGTGGCGGG - Intergenic
1084067655 11:66714584-66714606 TTGAGGCAGCAGATTAGGGTAGG + Intronic
1084334062 11:68446680-68446702 GGGAGGCAGCCTAGTGTGGTTGG - Intronic
1084682163 11:70672789-70672811 CCAAGGCTGCAGAGTGTGGTGGG - Intronic
1084694631 11:70746240-70746262 GAGAGGCGGGAGAGTGTGGTGGG - Intronic
1084694663 11:70746339-70746361 GAGAGGCGGGAGAGTGTGGTGGG - Intronic
1084694694 11:70746438-70746460 GAGAGGCGGGAGAGTGTGGTGGG - Intronic
1085262229 11:75213271-75213293 GGGAGACAGCAGAGTGTGGATGG - Intergenic
1085449851 11:76625215-76625237 GGGAGGCTGCAGAGTGTGGCTGG - Intergenic
1085505001 11:77053382-77053404 ATGTGGCTGCTAAGTGTGGTGGG - Intergenic
1087050270 11:93879696-93879718 AGGAGTCAGCAAAGGGTGGTGGG - Intergenic
1088554519 11:111048314-111048336 ATGAGACAATAGAGAGTGGTAGG + Intergenic
1089201728 11:116728710-116728732 CTGAGGCAGCAAAGGGTGATGGG - Intergenic
1089356279 11:117855932-117855954 AGGAGGCAGCAACGTGTGATTGG - Intronic
1089640727 11:119845575-119845597 AGGTGGCAGCAGAGTGTGCCGGG + Intergenic
1089856098 11:121546126-121546148 TAGAGGCAGCAGGGTGTGGTTGG + Intronic
1089898328 11:121955063-121955085 ATGATGAAGGAGACTGTGGTTGG + Intergenic
1091243048 11:134067334-134067356 GGGATGCAGCAGAGTGGGGTAGG - Intergenic
1091687081 12:2570736-2570758 ATGAGCTGGCAAAGTGTGGTGGG + Intronic
1092982361 12:13809275-13809297 ATGAGACAACAAGGTGTGGTAGG + Intronic
1093016287 12:14157762-14157784 ATGAGACAACAGAATGTTGTAGG + Intergenic
1094445620 12:30526666-30526688 ATGGGGCAGCAGAGAGTTCTAGG - Intergenic
1094479385 12:30869664-30869686 AGGAGGCACCAGAGGGAGGTTGG - Intergenic
1095778834 12:46036922-46036944 AGGAGTCAGCAAAGGGTGGTGGG - Intergenic
1096248875 12:50013911-50013933 AAGATGGATCAGAGTGTGGTGGG - Intronic
1096769289 12:53923908-53923930 AGGAGGCAGAAGAGTGTCGGAGG + Intergenic
1097067611 12:56332683-56332705 ATGAGACAGCTGGGTCTGGTTGG - Intronic
1097987335 12:65797790-65797812 TTAAGGCAGCAGTGTGTGGTGGG + Intergenic
1098025455 12:66195987-66196009 AAGAGGCATAAGAGAGTGGTGGG - Intronic
1099553944 12:84085557-84085579 ATGTGCCAGCCAAGTGTGGTTGG + Intergenic
1100792582 12:98146899-98146921 ATGAGACAGTAGTGAGTGGTGGG - Intergenic
1101269887 12:103132390-103132412 AAGATGCAGTAGTGTGTGGTGGG - Intergenic
1101821205 12:108185499-108185521 AGGAGGAAGCTGTGTGTGGTAGG - Intronic
1101835210 12:108290242-108290264 ATGAGGCTGCAGAGTTGGGAAGG - Exonic
1102926339 12:116829133-116829155 ATGGGGCAGCTGAGGGTGGGTGG + Intronic
1103517268 12:121515481-121515503 AGGGGGTGGCAGAGTGTGGTTGG - Intronic
1104156909 12:126142283-126142305 AGAAGGCAGCAGAGACTGGTGGG + Intergenic
1104170473 12:126275624-126275646 ATGAGGATGCAGAGAGTGGGAGG + Intergenic
1104548010 12:129730027-129730049 AGGAGTCAGCAAAGTGTGGTGGG - Intronic
1104677511 12:130723030-130723052 ATGTGGCTTCAGAGTGTGTTTGG - Intergenic
1105040455 12:132956851-132956873 AGGAGTCAGCGGAGGGTGGTGGG + Intergenic
1105251620 13:18703871-18703893 AGGAGTCAGCAAAGGGTGGTGGG - Intergenic
1105306957 13:19175673-19175695 ATCCGACAGCAGAGTGGGGTAGG + Intronic
1106334129 13:28767112-28767134 ATGAGGTAGAAGAATGTAGTAGG + Intergenic
1107668029 13:42713124-42713146 GTGTGGCAACAGAGAGTGGTTGG + Intergenic
1108292062 13:48971902-48971924 ATGGGACAGCAGATTGAGGTGGG - Intergenic
1108360783 13:49666333-49666355 ATGTGGAAGCAGAGTGGGGAGGG + Intronic
1111914974 13:94351300-94351322 ATTAGGCAGGAGAGTGTAGAGGG - Intronic
1112524704 13:100133826-100133848 AGCAGGCAGAAGAGTGTGGAAGG + Intronic
1113034806 13:106037289-106037311 AGAAGGTAGCAGAGTCTGGTTGG - Intergenic
1114963046 14:27919239-27919261 GGGAGTCAGCAGAGGGTGGTGGG + Intergenic
1115569717 14:34655081-34655103 AAGAGTCAGCAAAGGGTGGTGGG - Intergenic
1115648347 14:35385431-35385453 ATGAGGCTGCAGGGTGAGGGAGG - Intergenic
1115770997 14:36663716-36663738 ATGAGGCAGAAGACTGTGTGTGG - Intronic
1116641357 14:47467564-47467586 AAGAGACAGCAGAATGTAGTGGG + Intronic
1116655742 14:47651449-47651471 ATGAGGCAGCAGAGTGGGCAGGG + Intronic
1116959250 14:50953063-50953085 AGGAGTCAGCAAAGGGTGGTGGG - Intergenic
1117145148 14:52829961-52829983 CTGATGCAGGAGGGTGTGGTGGG + Intergenic
1117173902 14:53129054-53129076 AGGAGTCAGCAAATTGTGGTGGG - Intronic
1117428174 14:55622882-55622904 ATGAGGCTGCAGAGAGAGGCAGG - Intronic
1117531015 14:56660911-56660933 TTGAGGCAGGAGACTGTGTTTGG - Intronic
1117623773 14:57614726-57614748 ATGGGGCAACAGGGAGTGGTGGG + Intronic
1118006378 14:61567805-61567827 ATAAGGCAGCAGCGTGGGGGTGG + Intronic
1118072234 14:62257702-62257724 ATGATGCAGCAGAGGGAGGCAGG + Intergenic
1118615625 14:67572780-67572802 ATGGGGCAGCAGAGAGGTGTGGG - Intronic
1118714571 14:68549812-68549834 ATCAGTCAGCAGAGAGTGGCAGG - Intronic
1119380238 14:74223883-74223905 ATGAGGCAGCAGCATATGGAAGG + Intergenic
1119438715 14:74613801-74613823 CCAAGGCAGCACAGTGTGGTGGG - Intergenic
1119671070 14:76518682-76518704 CTCAGACAGCAAAGTGTGGTGGG + Intergenic
1119767178 14:77197643-77197665 ATCAGGCAGCAGACTATGGCTGG - Intronic
1120251761 14:82067335-82067357 ATAAGGCAGCAGAGGGAGGGAGG + Intergenic
1122879142 14:104682222-104682244 AGGAGGCAGCAGTGTGGGGAGGG + Intergenic
1123068334 14:105629121-105629143 AGGAGGCAGCAGAGCGAGGGAGG - Intergenic
1123092353 14:105747445-105747467 AGGAGGCAGCAGAGCGAGGGAGG - Intergenic
1123097929 14:105775146-105775168 AGGAGGCAGCAGAGAGAGGGAGG - Intergenic
1125063402 15:35452160-35452182 AGCAGGCAGCAGTGAGTGGTAGG - Intronic
1126462401 15:48927655-48927677 ATGTGGCAGCAAAGTGTGTAAGG - Intronic
1127574701 15:60279594-60279616 CTGAGGAAGCAGAGAGTGCTAGG - Intergenic
1127969747 15:63949072-63949094 ATGAGGCACCAGAGCTAGGTTGG - Intronic
1128338167 15:66801919-66801941 AAGAGGCAGCAGAGGGTTGAGGG + Intergenic
1128906825 15:71474733-71474755 AGGAGGGAGGAGAGTGAGGTTGG + Intronic
1129172018 15:73813823-73813845 ATGAGGCAGAATAGTGAGTTTGG - Intergenic
1130376190 15:83331143-83331165 AGGAGTCAGCAAAGGGTGGTGGG - Intergenic
1131329676 15:91485412-91485434 ATGAGGAAGCAGAGTGAGAAAGG + Intergenic
1132758082 16:1495679-1495701 GTGAGGCACCAGAGGGTGGCAGG - Intronic
1133231766 16:4370324-4370346 AGGAGGCAGCAGGGAGTGGTGGG + Intronic
1134830960 16:17322514-17322536 TAGAGGCAGGAGAGTATGGTGGG - Intronic
1135024782 16:18990619-18990641 AGGAGTCAGCAAAGGGTGGTGGG + Intronic
1135419518 16:22296515-22296537 ATGTGGCAGTATTGTGTGGTGGG - Intergenic
1135955599 16:26954063-26954085 GTGAGGCTCCAGGGTGTGGTTGG - Intergenic
1136059900 16:27719206-27719228 ATGAAGCAGTAGGGAGTGGTGGG + Intronic
1136096467 16:27960621-27960643 ATGGAGAAGCTGAGTGTGGTGGG + Intronic
1136369724 16:29828728-29828750 GTAAGGCAGCAGGGGGTGGTGGG + Intronic
1136530509 16:30865271-30865293 AGGAGTCAGCAAAGGGTGGTAGG - Intronic
1137579222 16:49623158-49623180 AGCAGGCAGCAGGGAGTGGTTGG - Intronic
1137695075 16:50456111-50456133 ATGTGGCTGCAGATTCTGGTTGG - Intergenic
1139483164 16:67241854-67241876 AGGAGGCAGGACAGCGTGGTGGG - Intronic
1139694834 16:68666520-68666542 ATAGGGCAGCAAAGTGGGGTGGG - Intronic
1139697919 16:68688265-68688287 ATAACGCAGCCGGGTGTGGTGGG - Intronic
1140307026 16:73812554-73812576 ATGAGGCAATAGGGAGTGGTGGG - Intergenic
1141868507 16:86768151-86768173 ATTAGACAACAGAGAGTGGTAGG + Intergenic
1141945921 16:87310305-87310327 AGGAGGCAGCAGAGTTTGAAAGG - Exonic
1142019987 16:87776153-87776175 AGGAGTCAGCAAAGGGTGGTGGG + Intergenic
1143008203 17:3850913-3850935 ATGAGGCAGCTGACCCTGGTGGG + Intergenic
1143035125 17:3990697-3990719 ATGAGAAAGCTGAGTGTGGGCGG - Intergenic
1143116139 17:4582795-4582817 CTGAGGCTGGAGAGTGTGGATGG + Intergenic
1143130902 17:4676352-4676374 ACGAGGGAGCAGAGACTGGTAGG - Exonic
1143408062 17:6691086-6691108 AGGAGACAGCAGAGTGAGGACGG - Intronic
1144589966 17:16515476-16515498 AGGAAGCAGCACAGTGTGGTAGG - Intergenic
1145113915 17:20190568-20190590 ATGAGGAGGCTGAGTGTGTTTGG - Intronic
1145751257 17:27356624-27356646 GTGAGGCAGTAGGGAGTGGTGGG - Intergenic
1145854444 17:28139812-28139834 AAGAGGCAGCAGAGCATGGTGGG - Intronic
1146293783 17:31632339-31632361 AGGAGTCAGCAAAGGGTGGTGGG - Intergenic
1146545745 17:33736527-33736549 GTGAGGCAGAAGATTGTAGTTGG + Intronic
1147447628 17:40484426-40484448 CTGAGGCAGCGGGGTGTGGTAGG - Intronic
1149040011 17:52176798-52176820 ATAAGGTAACAGAGAGTGGTGGG + Intergenic
1149274589 17:55018628-55018650 AGGAGTCAGCAAAGGGTGGTGGG + Intronic
1149548587 17:57522787-57522809 GGGAGGCAGCTGGGTGTGGTGGG - Intronic
1150299690 17:64037762-64037784 CTGAGGCAGGAGAGTAGGGTCGG + Intergenic
1151079477 17:71312143-71312165 AGGTGGCAGCAAAGTGTGCTGGG - Intergenic
1151134158 17:71929356-71929378 ATCAGATAGCAGAGTGTGGGTGG - Intergenic
1151503248 17:74506301-74506323 ATGAGTCAGCAAAGGGTGGTGGG - Intergenic
1151746776 17:76015711-76015733 TGGAGGCAGTAGAGTGTGGTGGG + Intronic
1151780825 17:76244055-76244077 CTGAGGCAGCAGGGTTTGGGAGG + Intergenic
1152043382 17:77919675-77919697 AGGAGTCAGCAAAGGGTGGTGGG - Intergenic
1152048542 17:77955212-77955234 TTCAGGCACCAGTGTGTGGTAGG + Intergenic
1152453634 17:80400112-80400134 GAGAGTCAGCAAAGTGTGGTGGG - Intergenic
1153525666 18:5992421-5992443 ATGAGGCTGGAGAGTGAGGTGGG + Intronic
1155217034 18:23652391-23652413 AGGAGGCAGAACAGTGTGATGGG - Intronic
1155871057 18:31028859-31028881 ATGAGGCTGAAGAGGGAGGTAGG - Intronic
1156915564 18:42462108-42462130 AAGAGTCAGCAAAGGGTGGTGGG - Intergenic
1157577072 18:48750554-48750576 AGGAACCAGCAGACTGTGGTGGG + Intronic
1158307056 18:56117391-56117413 GGGAGGCAGCAGAGAGTAGTGGG - Intergenic
1159129271 18:64261335-64261357 GTGAGGCGGGAGAGTGGGGTGGG + Intergenic
1159281668 18:66293610-66293632 ATGAGCCAGAAGAGAGTGGGGGG + Intergenic
1159365101 18:67455620-67455642 AAGAGTCAGCAAAGGGTGGTGGG + Intergenic
1160412466 18:78684236-78684258 TTGAGGTCCCAGAGTGTGGTGGG - Intergenic
1161616255 19:5272158-5272180 AGAAGGCAGCACAGAGTGGTTGG + Intronic
1161817112 19:6506123-6506145 AGGAGTCAGCAAAGGGTGGTGGG - Intergenic
1162567545 19:11452763-11452785 ATGGGGCCGCTGAGTGGGGTGGG + Exonic
1163394445 19:17051080-17051102 ATGTGGCAGCAGCGAGAGGTGGG + Intronic
1163655388 19:18542749-18542771 AAGAGGCTGTAGAATGTGGTGGG - Intronic
1164087709 19:21918889-21918911 AGGAGTCAGCAAAGCGTGGTGGG - Intergenic
1165405432 19:35628186-35628208 AGGAGTCAGCAAAGGGTGGTGGG - Intergenic
1165466600 19:35978559-35978581 TTGGGGCAGGAGAGAGTGGTGGG - Intergenic
1165645799 19:37434897-37434919 AAGAGTCAGCAAAGGGTGGTGGG - Intronic
1166652420 19:44584489-44584511 ATGAGGCAACAGAAGGTGGTTGG - Intergenic
1167000202 19:46741324-46741346 ATGAGGCAGCAGAGGGATGAAGG - Intronic
1167213062 19:48145653-48145675 ATGAGGCAGCAGAGTGTGGTGGG + Intronic
1167217470 19:48174073-48174095 ATGAGGCAGCAGAGAGTGGCAGG - Intronic
1167285535 19:48596857-48596879 GGGAGGCAGCAGCGTGTAGTTGG - Exonic
1167455535 19:49595429-49595451 CTGAGGCAGCAGGGGGCGGTGGG + Exonic
1167910671 19:52699412-52699434 GAGAGTCAGCAAAGTGTGGTGGG + Intergenic
1167918319 19:52760634-52760656 GAGAGTCAGCAAAGTGTGGTGGG + Intergenic
925729547 2:6908665-6908687 ATAAGACAGCACAGGGTGGTGGG + Intergenic
926038758 2:9655892-9655914 CTGGGGCTGCAGACTGTGGTGGG - Intergenic
926305555 2:11635352-11635374 ATGAAGAAGCAGATCGTGGTGGG + Exonic
927020301 2:19009822-19009844 ATGAAGGAGAAAAGTGTGGTTGG + Intergenic
927574354 2:24189284-24189306 ATGAGGCCGGAAAGGGTGGTAGG - Intronic
928245368 2:29621991-29622013 ATCTGGCAGCATAGTGAGGTGGG - Intronic
928774011 2:34737040-34737062 AGGAGTCAGCAAAGGGTGGTGGG - Intergenic
929332836 2:40704706-40704728 ATGAGGCAGTACAGTGGGGACGG + Intergenic
929960661 2:46493935-46493957 ATGAGGCGGGAGAGGGTGGCGGG + Intronic
930706140 2:54506961-54506983 AGGAGTCAGCAAAGGGTGGTGGG + Intronic
931104406 2:59039363-59039385 ATCAGGCAGCTGGGTGTGGTGGG + Intergenic
931830492 2:66045916-66045938 ATCCGGCAGCAGGGTGTGGATGG + Intergenic
932466614 2:71928228-71928250 CTGAGGCATCAGTGTGTAGTTGG - Intergenic
932767597 2:74481379-74481401 ATGAGAGAGTATAGTGTGGTGGG + Intronic
932849862 2:75174027-75174049 GTGAGGCAGGAGAGTGTGTGAGG - Intronic
933074249 2:77903462-77903484 ATGAGGTAGAAGAATGCGGTAGG - Intergenic
933207809 2:79529197-79529219 ATGAGGCATGAGAAGGTGGTAGG + Intronic
933758289 2:85657735-85657757 AAGAGTCAGCAAAGGGTGGTGGG + Intronic
934153522 2:89172957-89172979 ATGAGGGAGGAGAATGGGGTGGG - Intergenic
934153949 2:89177042-89177064 ATGAGGGAGGAGAATGGGGTGGG - Intergenic
934155567 2:89196742-89196764 ATGAGGGAGGAGAATGGGGTGGG - Intergenic
934156195 2:89203291-89203313 AGGAGTCAGCAAAGGGTGGTGGG + Intergenic
934211123 2:89979472-89979494 AGGAGTCAGCAAAGGGTGGTGGG - Intergenic
934211757 2:89986017-89986039 ATGAGGGAGGAGAATGGGGTGGG + Intergenic
934213285 2:90004893-90004915 ATGAGGGAGGAGAATGGGGTGGG + Intergenic
934213714 2:90008975-90008997 ATGAGGGAGGAGAATGGGGTGGG + Intergenic
934562466 2:95320410-95320432 AGGAGGAGGCAGGGTGTGGTGGG + Intronic
934761281 2:96858321-96858343 ATGAGGCAGCTGGGTCCGGTCGG + Intergenic
934789439 2:97046217-97046239 ATGAGGGAGGAGAATGGGGTGGG + Intergenic
934817033 2:97336323-97336345 ATGAGGGAGGAGAATGGGGTGGG - Intergenic
934820663 2:97372161-97372183 ATGAGGGAGGAGAATGGGGTGGG + Intergenic
935544549 2:104387003-104387025 GTGAGGCAGCAGTGTGTAGTAGG - Intergenic
935793669 2:106618415-106618437 GAGAGTCAGCAAAGTGTGGTGGG + Intergenic
935828741 2:106977195-106977217 CTGTGGCATCAGAGTGTGGATGG + Intergenic
935854977 2:107263944-107263966 ATGAGGAAGCAGAGACTGGAGGG - Intergenic
935888365 2:107648866-107648888 ATGAGCCAGCAAAGTGATGTGGG - Intergenic
936349088 2:111699024-111699046 ATGAGTCAGCAGGGTTTGGTTGG + Intergenic
936714366 2:115168049-115168071 ATGTAGCAGGAGAGTGTGCTTGG + Intronic
937467547 2:122147903-122147925 ATGAGACAGAAGAGTGTGGGTGG + Intergenic
938122762 2:128645264-128645286 ATGAGGCTGGGGAGTGTGGCAGG + Intergenic
940973852 2:159922066-159922088 AAGAGGCAACCGAGTGTGGCAGG - Intergenic
942626089 2:177902331-177902353 AGGAGTCAGCAAAGGGTGGTGGG - Intronic
942667948 2:178342024-178342046 ATGAGGTAGGAGAAAGTGGTGGG - Intronic
943466034 2:188230480-188230502 AGGAGTCAGCAAAGGGTGGTGGG + Intergenic
943554257 2:189382687-189382709 AAGAGTCAGCAAAGGGTGGTGGG + Intergenic
944586976 2:201181141-201181163 ATGCTGCAGCAGAGTGAGGAGGG - Intergenic
945186928 2:207148766-207148788 ATAAGGCACTAGAGAGTGGTGGG - Intronic
945852998 2:215032457-215032479 ATGAGGGTGCATAGTGTGGAAGG + Intronic
947397066 2:229696740-229696762 TTGAGCCAGCAGAGTGTCCTGGG + Intronic
947598665 2:231430765-231430787 AGGAGTCAGCAAAGGGTGGTGGG - Intergenic
947830192 2:233134157-233134179 AGGAGGAAGGAGAGGGTGGTGGG + Intronic
947842173 2:233214878-233214900 AGGAGTCAGCAAAGGGTGGTAGG + Intronic
1169081704 20:2801198-2801220 ACGAGGCAGCAGAGCGCAGTAGG - Intergenic
1169210692 20:3764845-3764867 GTGAGGCAAAAGAGTGGGGTGGG - Intronic
1169551459 20:6705691-6705713 ATGAGGAAGCAGATACTGGTTGG - Intergenic
1169756709 20:9050643-9050665 ATGATGAAGCTGAGTGAGGTAGG - Intergenic
1170245052 20:14211673-14211695 GTGAGGCAGCAGAGTGAGAGAGG + Intronic
1170572514 20:17640559-17640581 CTTAGGGAGCAGAGTGTGGGTGG + Intronic
1170605558 20:17873006-17873028 AGGATGCAGCAGAGTGTCCTGGG - Intergenic
1171326488 20:24298123-24298145 AAGTGGCAGCAGACTGTGGCAGG - Intergenic
1171457487 20:25280300-25280322 CTCAGGCAGCACAGTGTGGTTGG - Exonic
1174373650 20:50111635-50111657 AAAAGGCAGCAGCTTGTGGTGGG + Intronic
1174483927 20:50849594-50849616 ATGAGACAGGAGGGAGTGGTGGG + Intronic
1176244882 20:64092800-64092822 CGGGGGCAGCAGACTGTGGTTGG - Exonic
1176837147 21:13803758-13803780 AGGAGTCAGCAAAGGGTGGTGGG - Intergenic
1177175346 21:17696484-17696506 AGGAGTCAGCAAAGGGTGGTGGG + Intergenic
1178039273 21:28621566-28621588 AGGAGTCAGCAAAGGGTGGTGGG + Intergenic
1179174883 21:39001080-39001102 CTGAGGCAGTAGAGGGTGGGTGG - Intergenic
1179766547 21:43578016-43578038 AGGAGTCAGCAAAGGGTGGTGGG - Intronic
1180163001 21:46006436-46006458 ATGAGGCAGCTGAGAGAGGCTGG - Intergenic
1180247770 21:46559798-46559820 AGGAGGCAGCAGAGTGAGACAGG - Intronic
1180837611 22:18938216-18938238 AGGAGTCAGCAAAGGGTGGTGGG + Intergenic
1180914186 22:19473918-19473940 GTGAGGCAGGAGACTGGGGTTGG - Intronic
1181863015 22:25834009-25834031 GTGAGGAAGCACAGTGTGGAAGG - Intronic
1182503300 22:30764264-30764286 AGCAGGCAGTAGAGTGGGGTGGG + Intronic
1182550414 22:31097960-31097982 ACCAGGCAGCTCAGTGTGGTAGG - Intronic
1182924083 22:34106462-34106484 GGGAGGAAGAAGAGTGTGGTGGG - Intergenic
1183286117 22:36965318-36965340 AGGAGAAAGCAGAGTGTGGTGGG - Intergenic
1183428960 22:37754433-37754455 AAAAGGCAGCAGATTGTGGCTGG + Intronic
1183635013 22:39056358-39056380 AGGAGTCAGCAAAGGGTGGTGGG + Intronic
1184100020 22:42337137-42337159 ATGAGGCAGCAGCATCTGGAGGG - Intronic
1203287704 22_KI270734v1_random:163515-163537 AGGAGTCAGCAAAGGGTGGTGGG + Intergenic
949184641 3:1175503-1175525 ATGAGGCAGCAGGGAGAGGCAGG + Intronic
949803870 3:7933474-7933496 AGGAGTCAGCAAAGGGTGGTGGG + Intergenic
950155042 3:10715690-10715712 ATGCTGGAGCTGAGTGTGGTGGG + Intergenic
950523084 3:13507876-13507898 CTGAGGCAGCAGAGTGGGGATGG - Intergenic
952088098 3:29850988-29851010 ATGAGGAAGAAAAGTGTTGTAGG - Intronic
952454858 3:33463582-33463604 AGGAGTCAGCAAAGGGTGGTGGG + Intergenic
952791706 3:37205722-37205744 AGGAGTCAGCAAAGGGTGGTGGG - Intergenic
953077814 3:39586585-39586607 AGGAGTCAGCAAAGGGTGGTGGG + Intergenic
953538005 3:43790465-43790487 GTGGGGAAGAAGAGTGTGGTGGG - Intergenic
953657579 3:44865743-44865765 AGGAGGCAGGAGAGTGAGGCAGG + Intronic
953858779 3:46524169-46524191 ATGAGACAGCAGAATTTGGCTGG + Intronic
957299315 3:78370790-78370812 ATAAGGCAGGAAAGTGAGGTTGG + Intergenic
958528823 3:95297191-95297213 GTGGGGCAGTAGAGTATGGTTGG + Intergenic
958876988 3:99627701-99627723 AAGAGACAGGACAGTGTGGTGGG - Intergenic
961265794 3:125641582-125641604 AGGAGTCAGCAAAGGGTGGTGGG + Intergenic
962021732 3:131509322-131509344 AGGAGTCAGCAAAGGGTGGTGGG + Intergenic
962886639 3:139633774-139633796 ATGAAGCTGCAGAGAGTGGAAGG + Intronic
963821331 3:149897954-149897976 AGGAGACAGCAGAAAGTGGTAGG + Intronic
964277217 3:155021402-155021424 AGGAGTCAGCAAAGGGTGGTGGG + Intergenic
966118282 3:176491224-176491246 ATGATGCAGCAGAGGCTGCTAGG - Intergenic
966167300 3:177035091-177035113 ATGAAGCATCAGAGTGTTTTTGG + Intronic
966331406 3:178818883-178818905 TAGAGGTAGTAGAGTGTGGTTGG - Intronic
966999526 3:185319851-185319873 ATGTGACAGCAGAGAGTTGTAGG + Intronic
967004768 3:185373902-185373924 AGGAGTCAGCAAAGGGTGGTGGG + Intronic
967383008 3:188881382-188881404 AAGAAGCAGCAGAGAGTGATAGG - Exonic
967584261 3:191192470-191192492 ATGAGTCAGCAGGATGTGGGTGG + Intergenic
967843407 3:194025583-194025605 ATGAGGCTGCAGAGTTGGGGAGG - Intergenic
967870279 3:194223965-194223987 ATGAGGGAGAAAAGAGTGGTGGG - Intergenic
968412162 4:399710-399732 AGGAGTCAGCAAAGGGTGGTGGG + Intergenic
968413570 4:409007-409029 AGGAGTCAGCAAAGGGTGGTGGG + Intergenic
968427840 4:535006-535028 ATGAGGAAGCAGAGAGTGTGCGG - Intronic
969248771 4:5953740-5953762 CTGAGTCAGCAGCCTGTGGTGGG - Intronic
969342405 4:6550362-6550384 CTGAGGCTGCAGAGGGTAGTGGG - Intronic
970538988 4:17058718-17058740 ATGGGGCAGAAGGGTGTGGGTGG - Intergenic
970819889 4:20199150-20199172 AAGAGTCAGCAAAGGGTGGTGGG - Intergenic
970873715 4:20845491-20845513 GGGAGTCAGCAGAGGGTGGTGGG - Intronic
971722563 4:30264815-30264837 AGGAGTCAGCGAAGTGTGGTGGG + Intergenic
972806385 4:42532972-42532994 AGGAGTCAGCAAAGGGTGGTGGG - Intronic
973807768 4:54541866-54541888 GTGAGACAGCAGGGAGTGGTAGG + Intergenic
974154099 4:58047977-58047999 ATGGGAGAGCAGAGTGTGGGAGG - Intergenic
974756591 4:66217128-66217150 AGCATGCAGCAGAGTGTGGAGGG - Intergenic
974816786 4:67015016-67015038 AGGAGTCAGCAAAGAGTGGTGGG - Intergenic
975581483 4:75910903-75910925 AGGAGTCAGCAAAGGGTGGTAGG + Intergenic
976198703 4:82559140-82559162 AGGAGTCAGCAAAGGGTGGTGGG - Intronic
976404256 4:84644079-84644101 ATGAGACCGCAGAGTTTGGTGGG + Intronic
976502336 4:85806049-85806071 ATGAAGCAGCTGAATGGGGTAGG - Intronic
977035551 4:91947675-91947697 TTGAGGCAGGAGTGTGTGGGTGG - Intergenic
977139379 4:93348611-93348633 ATGAGGCCCCAGACTGTGCTGGG + Intronic
978801020 4:112755441-112755463 AGGAGTCAGCAAAGGGTGGTGGG + Intergenic
980097011 4:128501695-128501717 TTCAGGATGCAGAGTGTGGTGGG - Intergenic
981482974 4:145256661-145256683 AGGAGTCAGCAAAGGGTGGTGGG + Intergenic
981854452 4:149271468-149271490 GTGAGGCAGCAGAGAGTATTGGG + Intergenic
983491018 4:168389029-168389051 CCCAGGCAGCAGACTGTGGTAGG + Intronic
983547162 4:168976459-168976481 AGGAGTCAGCAAAGGGTGGTGGG + Intronic
983608920 4:169620665-169620687 ATGAGCAAGGAGGGTGTGGTGGG + Exonic
984163015 4:176276933-176276955 ATAAGTCAGCAGAAAGTGGTAGG + Intronic
986564794 5:9101257-9101279 ATGAGGCCACACAGTGTAGTGGG + Intronic
987328967 5:16838188-16838210 ATGACGCAGCTGAGTGAGGAAGG + Intronic
987936268 5:24469219-24469241 AGGAGGCATAAGTGTGTGGTTGG + Intergenic
989108965 5:37889003-37889025 AGGAGGCAGAAGAGAGTGGAAGG + Intergenic
990329040 5:54707242-54707264 AAGAGGCAGCACAGGATGGTAGG + Intergenic
990564578 5:57016550-57016572 AGGAGTCAGCAAAGGGTGGTGGG + Intergenic
990565393 5:57022164-57022186 AGGAGTCAGCAAAGGGTGGTGGG + Intergenic
991441799 5:66658594-66658616 ATGAGCTTGCAGGGTGTGGTGGG + Intronic
992492082 5:77255209-77255231 GTCAGGCAGCAGAGCCTGGTTGG - Intronic
992774473 5:80077512-80077534 ATGAGACAGCAGGGAGTGTTGGG + Intronic
993662331 5:90653388-90653410 TTGAGGCAGCAGGGTGTGTTTGG + Exonic
994174168 5:96692715-96692737 ATGAGGTAACAGAGAGTGATTGG - Intronic
995769768 5:115655291-115655313 AGGAGTCAGCAAAGGGTGGTGGG - Intergenic
997593433 5:135090232-135090254 ATGAGCCAGCAGAGTGTTGAAGG + Intronic
997716094 5:136044195-136044217 AAAAGGCAGCAGAGTGTGAATGG + Intronic
998830492 5:146152586-146152608 ATGGACCAGCAGGGTGTGGTAGG - Intronic
999172544 5:149607612-149607634 AGGAGTCAGCAAAGGGTGGTGGG + Intronic
1001491873 5:172161794-172161816 ATGAGGCGGCAGAGTGGGCTTGG + Intronic
1002101209 5:176858569-176858591 GTGAGGCAACAGGGAGTGGTGGG + Intronic
1003494096 6:6648873-6648895 GAGAGGCAGGAGGGTGTGGTGGG - Intronic
1004806967 6:19212890-19212912 CAGAGTCAGCAAAGTGTGGTGGG - Intergenic
1005107185 6:22236375-22236397 ATGAGGAGGCTGAGTGTGCTAGG - Intergenic
1005508366 6:26490133-26490155 ATGAGTCAGCAAAGGGTGGTGGG - Intergenic
1006729481 6:36225431-36225453 TTAAGCCAGCAGAGTGTGGTGGG + Intronic
1007083114 6:39122807-39122829 AGGAGTCAGCAAAGGGTGGTGGG - Intergenic
1007112687 6:39322202-39322224 ATTTGGAAGAAGAGTGTGGTGGG - Intronic
1007492029 6:42230658-42230680 ATGGTGCACCAGTGTGTGGTGGG + Intronic
1007689143 6:43687500-43687522 ATAAGGCACCAGGGTGTGGAAGG + Intronic
1010866445 6:80981569-80981591 AGGAGTCAGCAAAGGGTGGTGGG - Intergenic
1011211517 6:84960490-84960512 ATGAGGTAGCAGAGTGGGCAAGG + Intergenic
1011215056 6:84996729-84996751 CTGAGCCAGGAGAGTGTGGTAGG + Intergenic
1011412153 6:87076987-87077009 ATGAGGCTGCAGAGATAGGTTGG + Intergenic
1012465784 6:99515253-99515275 ATCAGGAAGCCGAGTGGGGTGGG + Exonic
1013140515 6:107329314-107329336 AAGAGGCAGCAGAGTGGACTTGG - Intronic
1013710508 6:112891901-112891923 AGGAGGCAGGAGAGTGAGGAAGG - Intergenic
1013807521 6:114011870-114011892 AAGAGTCAGCAAAGGGTGGTGGG + Intergenic
1013837845 6:114353806-114353828 ATGAGGAAGCAGAATGTAGAGGG + Intergenic
1014114732 6:117658894-117658916 AGGAGTCAGCAAAGGGTGGTGGG + Intergenic
1014115608 6:117664870-117664892 AGGAGTCAGCAAAGGGTGGTGGG + Intergenic
1014900646 6:126959892-126959914 ATGAGGTGGTAGAGAGTGGTGGG + Intergenic
1015519124 6:134114122-134114144 ATGCTGCAGCAGAGTGAGGAGGG - Intergenic
1015890830 6:137968086-137968108 CTGGGACATCAGAGTGTGGTGGG - Intergenic
1016201576 6:141416673-141416695 ATGAGGACATAGAGTGTGGTAGG + Intergenic
1016393076 6:143594340-143594362 CTGAGACATCATAGTGTGGTGGG - Intronic
1016489717 6:144584573-144584595 ATATGGCAGCAGATTGAGGTGGG + Intronic
1016558787 6:145370710-145370732 GGGAGGCAGCAGAGGGTGTTGGG - Intergenic
1016765361 6:147786884-147786906 ATGTGACTGCAGAGTGTGGCTGG - Intergenic
1017011462 6:150066457-150066479 AAGAGGCGGGAGAGTGTGGGAGG + Intronic
1017057212 6:150448377-150448399 ATGAGTCATCAGAGAGAGGTTGG - Intergenic
1017700985 6:157071266-157071288 ATCAGTCTGCAGAGTGTGATGGG - Intronic
1018290856 6:162291452-162291474 ACGTGGCACCAGAGGGTGGTGGG - Intronic
1018597501 6:165498309-165498331 CTGAGGCAGTAGACTGTGGCAGG + Intronic
1018829556 6:167432932-167432954 ATGGGGTGGCAGAGTGTGGATGG + Intergenic
1019152605 6:170018937-170018959 AGGAGGCAGGAGGGTGTGGGTGG + Intergenic
1021484877 7:21156908-21156930 GTGAGGCAGCAGGGAGAGGTGGG + Intergenic
1022087095 7:27078801-27078823 ATGAGTCAGGAGTGAGTGGTGGG - Intergenic
1022150008 7:27592885-27592907 ATGAGGCTGAAGAGAGAGGTTGG - Intronic
1022388673 7:29924954-29924976 ATGAGGCTGCTGAGGCTGGTGGG - Intronic
1022478494 7:30727624-30727646 ATGAGGCAGCAGTCAGGGGTGGG - Intronic
1022479706 7:30734738-30734760 TTGAGGCAGCAGAGGGAGCTAGG - Intronic
1023089139 7:36601401-36601423 ATCAGGCACCAGACTGTGCTGGG + Intronic
1023233297 7:38056817-38056839 ATAAGGCAATAGAGAGTGGTGGG + Intergenic
1024512256 7:50213275-50213297 TTGAGGCAGCAGTGTGATGTGGG + Intergenic
1024516618 7:50264800-50264822 ACCAGGCAGCAGAGTGGGGAGGG + Intergenic
1026447751 7:70500324-70500346 ATGAACCAGCAGCTTGTGGTGGG + Intronic
1028032395 7:85932762-85932784 CTGAGGCAGCACAGAGTGGGGGG - Intergenic
1028232370 7:88320562-88320584 AGGAGTCAGCAAAGGGTGGTGGG - Intergenic
1028327833 7:89549004-89549026 ATGAGGCAGGAGTCTCTGGTGGG - Intergenic
1028359777 7:89953787-89953809 TTGAGGCAGCAGAGAGTTGGGGG - Intergenic
1029574540 7:101394721-101394743 ATGAGAGAAAAGAGTGTGGTTGG - Intronic
1030167260 7:106567720-106567742 AGGAGTCAGCAAAGGGTGGTGGG - Intergenic
1031620012 7:123924458-123924480 ATGAGGCAGGAGAATAGGGTTGG - Intergenic
1032197960 7:129800043-129800065 ATGAGGGAGAGGAGTGTGGGTGG + Intergenic
1032430934 7:131860900-131860922 ATGAGGCAACTGAGGGTTGTAGG + Intergenic
1033602097 7:142895884-142895906 ATGAGAGAGAAGAGTGTGGGAGG + Intergenic
1033625320 7:143105387-143105409 AGGAGTCAGCAAAGGGTGGTGGG - Intergenic
1033626040 7:143110392-143110414 AGGAGTCAGCAAAGGGTGGTGGG - Intergenic
1034101954 7:148457841-148457863 ATGGGGGAGAAGGGTGTGGTTGG - Intergenic
1034357333 7:150461956-150461978 AGGAGTCAGCAAAGGGTGGTGGG + Intronic
1034497996 7:151433466-151433488 TTGAGGCAGCAGACTGTGCCAGG - Intronic
1035682081 8:1495496-1495518 ATGAGGGGTCAGAATGTGGTGGG + Intergenic
1036943209 8:13070720-13070742 ATGAGGAAGCAGAGATTGGAAGG - Intergenic
1038288554 8:26227814-26227836 ATGAGGCAGCGGAGTTAAGTTGG - Intergenic
1040286418 8:46102802-46102824 ATGGGGCCGCAGAGTGGCGTGGG - Intergenic
1040293654 8:46138234-46138256 ATGGGGCAGCAGGGTGGCGTTGG - Intergenic
1040299236 8:46179428-46179450 ATGGTGCAGCAGGGTGTCGTGGG - Intergenic
1040307409 8:46219327-46219349 ATGAGGCCGCAGGGTGGCGTGGG - Intergenic
1040312107 8:46242105-46242127 ATGGGGCCGCAGGGTGGGGTGGG + Intergenic
1040315464 8:46258575-46258597 ATGGGGCAGCAGTGTGGCGTGGG + Intergenic
1040318057 8:46275414-46275436 ACGGGGCAGCAGGGTGGGGTGGG + Intergenic
1040329779 8:46379930-46379952 ATGGGGCTGCAGGGTGTTGTGGG + Intergenic
1040560168 8:48516841-48516863 AAGAGGAAGAAGAGAGTGGTTGG - Intergenic
1041192481 8:55367810-55367832 CGGAGGCAGCAAAGGGTGGTCGG - Intronic
1043128251 8:76427776-76427798 ATTAGGAAGCAGGGTGTGGAGGG - Intergenic
1043243526 8:77968016-77968038 ATGTGGCATCAGAGTGTGTGAGG + Intergenic
1044321315 8:90804741-90804763 ATGAGGGAGAAGAGTAAGGTGGG - Intronic
1044449174 8:92313885-92313907 GTGAGGCAGCAGCCTGGGGTGGG - Intergenic
1045492337 8:102679625-102679647 ATGAGGGAGCTGGGTGTGGTTGG - Intergenic
1046075530 8:109307340-109307362 AGGAGTCAGCAAAGGGTGGTGGG - Intronic
1046495679 8:115010497-115010519 CTGAGGCTGCACAGAGTGGTAGG + Intergenic
1047049129 8:121090422-121090444 ATGTAGCAGCAGAGTTTGGGAGG - Intergenic
1047113402 8:121815913-121815935 AGGAGTCAGCAAAGGGTGGTGGG + Intergenic
1047981867 8:130191836-130191858 ATGAGGGAGCAGAGAGGGGCGGG + Intronic
1048369278 8:133763652-133763674 ATGTGAGAGCAGAATGTGGTGGG + Intergenic
1048369284 8:133763704-133763726 ATGTGAGAGCAGAATGTGGTGGG + Intergenic
1049136630 8:140907832-140907854 ATGAGGCAGCAGCGGGTTGGTGG - Intronic
1049225042 8:141446394-141446416 ATAAAGCAGCAGAGGGTGGGAGG + Intergenic
1050840658 9:10144547-10144569 GTGTGGCAGCAGAGTGTTGCTGG - Intronic
1050897708 9:10904229-10904251 ATGAGTCAGCAGGCTGTGATAGG + Intergenic
1050913423 9:11102361-11102383 AGGAGTCAGCAAAGGGTGGTGGG + Intergenic
1052211223 9:25905596-25905618 ATGAGGCACCTAAGTGTGGTAGG + Intergenic
1052424940 9:28292167-28292189 AAGGGACAGCAGAGTGTGATCGG + Intronic
1053074465 9:35121071-35121093 AGGAGTCAGCAAAGGGTGGTGGG - Intergenic
1053133069 9:35629766-35629788 ATGTAGCAGCAGAGCATGGTGGG - Intronic
1054968398 9:71056261-71056283 AAGAGGCAGCATACTGTGATTGG - Intronic
1054972965 9:71110087-71110109 ATTGGGGAGCAGTGTGTGGTGGG - Intronic
1055785363 9:79864619-79864641 AGGAGGCTGCAAGGTGTGGTGGG - Intergenic
1056209173 9:84349101-84349123 AGGAGTCAGCAAAGGGTGGTGGG + Intergenic
1056340096 9:85620743-85620765 AAGAGACAACAGGGTGTGGTGGG + Intronic
1057050439 9:91919713-91919735 ATGAAGGAGCAGAGTGGGCTGGG - Intronic
1057067800 9:92072010-92072032 GGGAGTCAGCAGAGGGTGGTGGG - Intronic
1057165698 9:92923713-92923735 GAGAGGCAAGAGAGTGTGGTAGG + Intergenic
1057840403 9:98481455-98481477 GCAGGGCAGCAGAGTGTGGTTGG - Intronic
1057878147 9:98773208-98773230 AGGAGGCAGCAGTGAGTGCTGGG + Intronic
1058664273 9:107295789-107295811 ATGAGACACCACAGAGTGGTTGG + Intronic
1060499637 9:124143342-124143364 GAGAGTCAGCAAAGTGTGGTGGG - Intergenic
1060691567 9:125665551-125665573 AAGAGTCAGCAAAGGGTGGTGGG - Intronic
1060810166 9:126607295-126607317 ATAAGGCAGCAGGGTGGGGCAGG - Intergenic
1061268536 9:129522816-129522838 AGGAGGAAGGAGAGTGTGGCAGG - Intergenic
1061546988 9:131310055-131310077 AGGAGGCAGCACAGTGAGGTGGG + Intergenic
1062013412 9:134278926-134278948 AGGAAGCCACAGAGTGTGGTAGG - Intergenic
1186642385 X:11469847-11469869 AAGAGGCAGGAGAGAGAGGTGGG + Intronic
1187103296 X:16216970-16216992 AGGAGTCAGCAAAGGGTGGTGGG + Intergenic
1187104035 X:16221969-16221991 AGGAGTCAGCAAAGGGTGGTGGG + Intergenic
1188786528 X:34353326-34353348 ATCAGGCAGAAGAATGTGGAAGG + Intergenic
1188881464 X:35497045-35497067 AGGAGTCAGCAGAGTGTGGTGGG - Intergenic
1189241634 X:39529146-39529168 ATGAGGGAGGGGAGTGTGGTTGG - Intergenic
1189912979 X:45829522-45829544 ATGAAGTAGCACAGTGTGATAGG - Intergenic
1190366126 X:49696122-49696144 ATGAAACAGCAGAGGGAGGTCGG - Intergenic
1192454327 X:71264806-71264828 AGGAGTCAGCAAAGGGTGGTGGG - Intergenic
1192564831 X:72154981-72155003 TTGATGCAACAGAGAGTGGTGGG - Intergenic
1192763642 X:74121695-74121717 AGGAGTCAGCAAAGGGTGGTGGG + Intergenic
1192764909 X:74130294-74130316 AGGAGTCAGCAAAGGGTGGTGGG + Intergenic
1193363640 X:80604566-80604588 AGGAGCCAGCAAAGGGTGGTGGG - Intergenic
1195749561 X:108150413-108150435 TAGAGGCAGTAGAGTGTAGTGGG + Intronic
1195879385 X:109576492-109576514 AGGAGTCAGCAAAGGGTGGTGGG - Intergenic
1196022845 X:111008419-111008441 AGGAGGCTGCAAAGTGTGCTTGG - Intronic
1196103268 X:111869756-111869778 AGATGGCAGCAGAGGGTGGTAGG + Intronic
1196547165 X:116975731-116975753 CTGAGGCTGCAGAAAGTGGTGGG - Intergenic
1196551125 X:117026861-117026883 CTGTAGCACCAGAGTGTGGTTGG + Intergenic
1197852587 X:130879084-130879106 ATGACTCAGCAGAGTGTGTAAGG + Intronic
1197996370 X:132379738-132379760 AAGAGTCAGGAGAGTGTGGTGGG + Intronic
1198047408 X:132916521-132916543 TTGAGTCAGCAGAGTGTTATGGG + Intronic
1198258433 X:134945346-134945368 GAGAGTCAGCAAAGTGTGGTGGG - Intergenic
1198475161 X:136989228-136989250 AAGAGGCAGCAGAGTTTGATGGG + Intergenic
1200147266 X:153932737-153932759 TTCAGGCAGCAGAGGGTGGCAGG - Intronic
1200812543 Y:7500905-7500927 AGGAGTCAGCAAAGGGTGGTGGG - Intergenic
1201605599 Y:15781072-15781094 ACAAGGCAGCTGGGTGTGGTAGG + Intergenic