ID: 1167214211

View in Genome Browser
Species Human (GRCh38)
Location 19:48153711-48153733
Sequence AAGAGGAAGGAGGAGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 8425
Summary {0: 3, 1: 77, 2: 375, 3: 1525, 4: 6445}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167214211_1167214218 29 Left 1167214211 19:48153711-48153733 CCTTCCTCCTCCTCCTTCCTCTT 0: 3
1: 77
2: 375
3: 1525
4: 6445
Right 1167214218 19:48153763-48153785 CACACACACACCTCTCCTTCTGG 0: 2
1: 0
2: 11
3: 68
4: 561
1167214211_1167214219 30 Left 1167214211 19:48153711-48153733 CCTTCCTCCTCCTCCTTCCTCTT 0: 3
1: 77
2: 375
3: 1525
4: 6445
Right 1167214219 19:48153764-48153786 ACACACACACCTCTCCTTCTGGG 0: 2
1: 2
2: 8
3: 49
4: 364

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167214211 Original CRISPR AAGAGGAAGGAGGAGGAGGA AGG (reversed) Intronic
Too many off-targets to display for this crispr