ID: 1167214224

View in Genome Browser
Species Human (GRCh38)
Location 19:48153793-48153815
Sequence AAGAGGAAGGAGGAGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 8425
Summary {0: 3, 1: 77, 2: 375, 3: 1525, 4: 6445}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167214224_1167214234 28 Left 1167214224 19:48153793-48153815 CCTTCCTCCTCCTCCTTCCTCTT 0: 3
1: 77
2: 375
3: 1525
4: 6445
Right 1167214234 19:48153844-48153866 ACACACTTCTCTCCTTCTGGGGG 0: 1
1: 0
2: 3
3: 17
4: 204
1167214224_1167214233 27 Left 1167214224 19:48153793-48153815 CCTTCCTCCTCCTCCTTCCTCTT 0: 3
1: 77
2: 375
3: 1525
4: 6445
Right 1167214233 19:48153843-48153865 CACACACTTCTCTCCTTCTGGGG 0: 1
1: 0
2: 3
3: 42
4: 390
1167214224_1167214231 25 Left 1167214224 19:48153793-48153815 CCTTCCTCCTCCTCCTTCCTCTT 0: 3
1: 77
2: 375
3: 1525
4: 6445
Right 1167214231 19:48153841-48153863 CACACACACTTCTCTCCTTCTGG 0: 1
1: 0
2: 6
3: 39
4: 326
1167214224_1167214232 26 Left 1167214224 19:48153793-48153815 CCTTCCTCCTCCTCCTTCCTCTT 0: 3
1: 77
2: 375
3: 1525
4: 6445
Right 1167214232 19:48153842-48153864 ACACACACTTCTCTCCTTCTGGG 0: 1
1: 0
2: 8
3: 53
4: 332

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167214224 Original CRISPR AAGAGGAAGGAGGAGGAGGA AGG (reversed) Intronic
Too many off-targets to display for this crispr