ID: 1167215571

View in Genome Browser
Species Human (GRCh38)
Location 19:48162244-48162266
Sequence CCCAGCCCTGTGACATACTT TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 220
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 202}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167215568_1167215571 8 Left 1167215568 19:48162213-48162235 CCTGACTGCTAAAGGAAAAAATT 0: 1
1: 0
2: 0
3: 44
4: 454
Right 1167215571 19:48162244-48162266 CCCAGCCCTGTGACATACTTTGG 0: 1
1: 0
2: 0
3: 17
4: 202
1167215566_1167215571 18 Left 1167215566 19:48162203-48162225 CCAAGACAATCCTGACTGCTAAA 0: 1
1: 0
2: 1
3: 20
4: 210
Right 1167215571 19:48162244-48162266 CCCAGCCCTGTGACATACTTTGG 0: 1
1: 0
2: 0
3: 17
4: 202

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167215571 Original CRISPR CCCAGCCCTGTGACATACTT TGG Exonic
901111783 1:6802997-6803019 CCCAGCCCTTTGAGAGACTGAGG - Intronic
903208443 1:21800616-21800638 CCCAGCACTTTGAGATACTGAGG - Intergenic
904165031 1:28548881-28548903 CCCAGGCCTCTGACTTACTTTGG - Intergenic
904962341 1:34343809-34343831 TCTAGCCCTGTGACAGACTCAGG + Intergenic
905804168 1:40863858-40863880 CCCCGACCTGTGGCATCCTTGGG + Intergenic
905855164 1:41306174-41306196 CCCAGCCCTCTCATCTACTTTGG + Intergenic
907248185 1:53121187-53121209 CCCAGGCCTGTGCCAGACCTTGG - Intronic
910768529 1:90807517-90807539 CTCAGCCATGTGACTTGCTTTGG - Intergenic
915280839 1:154821119-154821141 GCCAGCCCTGTGACCTTCCTGGG - Intronic
915981066 1:160420226-160420248 CCCAGCCCTGGGAAAGGCTTGGG + Intronic
916036230 1:160924800-160924822 CCCAGCACTTTGACAGACTGAGG + Intergenic
920065216 1:203264455-203264477 CCCCGCCCTGACACATACTGTGG - Intronic
922442145 1:225664713-225664735 CTCGGCCCTGTGACTTGCTTTGG + Intergenic
923920474 1:238558811-238558833 CTCAGTCCTGTGACTTACATTGG - Intergenic
1062799999 10:371781-371803 CCCAGCCCTGTGACACCTTGGGG + Intronic
1066277047 10:33879584-33879606 CCCACCCCTGTGACTTTCTTTGG + Intergenic
1067068791 10:43118120-43118142 CCCAGCCCTGGGACACTCTGGGG + Intronic
1067155278 10:43776289-43776311 TCCAGCTCTGTGTCATTCTTGGG + Intergenic
1071339743 10:84634377-84634399 CTCAGCCATGTGACTTGCTTTGG + Intergenic
1071418143 10:85460179-85460201 CCCAGCCCTGACATTTACTTGGG + Intergenic
1072614417 10:97039985-97040007 CACAGTTCTGTGACATTCTTGGG + Exonic
1073040927 10:100604858-100604880 CCCAAGCCTGTGACAAACATGGG + Intergenic
1077195214 11:1276426-1276448 GCCAGCCTTGTGACAGACTCCGG - Exonic
1079150228 11:17892270-17892292 CTCAGCCATGTGACTTGCTTGGG + Intronic
1079270719 11:18983236-18983258 CCCATCCCTGAGACAGAGTTAGG - Intergenic
1080683895 11:34499791-34499813 CCCAACCCTGTGACTTCCATTGG - Intronic
1084699870 11:70779638-70779660 CCCACCCCTTTCACATCCTTGGG + Intronic
1085470360 11:76753628-76753650 CCCACCAGTGTGACACACTTTGG - Intergenic
1086408157 11:86517185-86517207 CACAGCCCGGTGACCTGCTTTGG + Intronic
1089604608 11:119634674-119634696 CCAAGCACTGTGCCATCCTTGGG - Intronic
1092210146 12:6640505-6640527 CCCAGGTCTGTGACAGCCTTGGG - Exonic
1092872008 12:12813576-12813598 CCCAGCCCTCTGAAATTCTGGGG - Intronic
1093216683 12:16369878-16369900 GCCAGCCCTGTGACTTTCTCTGG - Intronic
1095529986 12:43175662-43175684 CCCATCCCTGTGATAAAATTTGG - Intergenic
1096646125 12:53037169-53037191 CCCAGCCATGTGACCTTTTTAGG - Intronic
1097550026 12:61056078-61056100 CCCATCTCTTTCACATACTTTGG + Intergenic
1098623035 12:72627931-72627953 CCCAGCACTTTGACAGACTAAGG - Intronic
1101616847 12:106346062-106346084 GCTGGCCCTGTGACTTACTTTGG - Intronic
1102211028 12:111127363-111127385 CCATGCCCTGTGACAAACTAAGG - Intronic
1103428259 12:120857804-120857826 CCCACCCCTGTGACAGGCTCTGG - Intronic
1103935571 12:124474804-124474826 CCCCGCCCTGTGCCATCCTTGGG + Intronic
1104217800 12:126751494-126751516 TCCAGCATTGTGCCATACTTAGG + Intergenic
1104532402 12:129584506-129584528 CTCAGCCATGTGACTTGCTTTGG + Intronic
1104947918 12:132425209-132425231 CCCGGCCATGTGACCTGCTTTGG - Intergenic
1107712076 13:43160201-43160223 CCCAGCCCTTTGGCATAGTAAGG - Intergenic
1112640391 13:101267492-101267514 CTCAGCCATGTGACTTATTTTGG + Intronic
1116296021 14:43111187-43111209 CACAGCCCTGTGACTTATTTTGG + Intergenic
1118214881 14:63799327-63799349 CCCAGCACTTTGAGAGACTTAGG - Intergenic
1118800872 14:69188364-69188386 CCCAGCACTTTGAGAGACTTAGG - Intergenic
1118840221 14:69504337-69504359 CCCTGCCCTGTGACTTGCCTGGG - Intronic
1119965459 14:78910530-78910552 GCCAGCCCTGTGACTATCTTGGG - Intronic
1120173881 14:81273604-81273626 CCCAGCCCAGCCACATACGTGGG - Intronic
1120650226 14:87123628-87123650 CTCAGCCATGTGACTTGCTTTGG - Intergenic
1121110019 14:91306280-91306302 CCCTGTCCTGTGAGATACTCAGG - Intronic
1121798067 14:96752185-96752207 CCCAGCCCCATGACTTGCTTTGG - Intergenic
1122182599 14:99967049-99967071 CCCAGCCCTGTGACACAGCCAGG + Intergenic
1122500370 14:102194089-102194111 TCCAGCCCTGCCACTTACTTAGG + Intronic
1122994843 14:105257486-105257508 CCCAGCCCTGGCACCTTCTTAGG - Intronic
1123688733 15:22819394-22819416 ACCAGTCCTGTGACTTACTGAGG + Intronic
1128716254 15:69910347-69910369 CCAAGCCCTCTGAGATTCTTTGG - Intergenic
1129178738 15:73858255-73858277 CCCAGCCATGTGACTTCTTTTGG + Intergenic
1131062068 15:89410445-89410467 CCCAGCCCTCTCACATAGTGTGG + Intergenic
1133641381 16:7720650-7720672 CTCAGCCCTTTGACATAGCTAGG - Intergenic
1134675498 16:16087242-16087264 GCCAGCCCTGTGACTTAATCAGG - Intronic
1135601831 16:23790208-23790230 CCCAGCACTTTGGCATACCTAGG + Intergenic
1136254525 16:29029350-29029372 CCCAGCCCCGCCACACACTTGGG + Intergenic
1137781104 16:51098563-51098585 CCCAGCCTTGTGCCAGGCTTGGG + Intergenic
1138234003 16:55364878-55364900 CTCAGCCCTGTGAGTTGCTTTGG + Intergenic
1138293223 16:55865997-55866019 CCCAGCTCTGTGACCATCTTTGG - Exonic
1139359318 16:66387791-66387813 CCCAGGCTGGTGACATACCTTGG - Intronic
1139529931 16:67537970-67537992 CCCCGCCCCGTGACCTCCTTGGG + Intronic
1142106444 16:88306111-88306133 CCCTGCCTTGTGACTTCCTTAGG - Intergenic
1142134895 16:88447303-88447325 CATGGCCCTGTGACCTACTTCGG - Intergenic
1142174976 16:88640951-88640973 CCCAGGCCTGTGACAGTCTCAGG + Intergenic
1142694678 17:1627372-1627394 CCCAGCCCTGGAACATAGCTTGG - Intronic
1143293973 17:5856795-5856817 TTCAGCCCTGTGACTTACTTGGG - Intronic
1143745792 17:8993241-8993263 CCCAACCCTGCCACTTACTTAGG + Intergenic
1146045069 17:29498620-29498642 CCCAGCCATGTTCCAAACTTCGG - Intronic
1146182051 17:30704737-30704759 CCCAGCCCTTTGGGAGACTTAGG + Intergenic
1146967936 17:37048711-37048733 CCCATTCCCGTGACATACATAGG + Intronic
1147757336 17:42777715-42777737 CCCAGCCCATTTATATACTTTGG + Intronic
1148482529 17:47969596-47969618 CCCAGCGCTGTGAGATCCTGGGG + Intronic
1151330634 17:73404947-73404969 CCCAGCTCTGTCACTTACTGTGG + Intronic
1153835726 18:8962401-8962423 CACAGCCCTGTCCCATATTTAGG + Intergenic
1154040501 18:10850289-10850311 TCCAGCCCTGTGCCACACATCGG + Intronic
1157715878 18:49886820-49886842 CCTTGCCCTGTGTCATACTAGGG - Intronic
1157767048 18:50307333-50307355 CCCAGCCCTGTGTCCCTCTTGGG + Intergenic
1159334418 18:67044360-67044382 CCCAGGCCTGTGACACCCTTTGG + Intergenic
1161629163 19:5343227-5343249 CCCAGCCCAGTGACCTGTTTGGG + Intergenic
1162368814 19:10266560-10266582 CCCAGCCCTTTGAGAGACTGAGG - Intergenic
1162976784 19:14211085-14211107 CCCAGCCCTCTGGGAGACTTAGG - Intergenic
1164786067 19:30932058-30932080 CCCAGCCAAGTGAGATACTCGGG + Intergenic
1165754141 19:38282177-38282199 CCCATCACTGTGACATATTTGGG + Intronic
1166046359 19:40233113-40233135 CCCAGCCCCGTGCCTTACTAGGG - Exonic
1166049487 19:40249473-40249495 CCCAGCCCTGGGCCATCCTGCGG + Intronic
1166401352 19:42482875-42482897 CCCAGCCCTTTGAAAGGCTTAGG - Intergenic
1167215571 19:48162244-48162266 CCCAGCCCTGTGACATACTTTGG + Exonic
1167299914 19:48672387-48672409 CCCAGCCCAGGGACATTCCTGGG - Intronic
925286556 2:2720109-2720131 CTCAGCCCTGTGAGACACTGGGG + Intergenic
925804350 2:7633655-7633677 CCCAGCCCTGCCCCATGCTTTGG + Intergenic
932943807 2:76203137-76203159 CCTAGACCTGGGACACACTTCGG - Intergenic
933799575 2:85950004-85950026 CCCACCCCTGTGACAGAGGTAGG + Intergenic
934099227 2:88636176-88636198 CTTGGCCATGTGACATACTTTGG - Intergenic
934996557 2:98967076-98967098 CACTGCCCTGTGAAGTACTTTGG - Intergenic
935678401 2:105616104-105616126 CACAGCCCTGTGATATGCCTTGG + Intergenic
936054126 2:109247997-109248019 GGCAGCCCTGTGACTTCCTTTGG - Intronic
936517151 2:113188506-113188528 CCCAGCACTTTGACAGACTGAGG - Intronic
937674729 2:124577769-124577791 CCAAACCCTGTGGCATACATGGG + Intronic
940020162 2:149147807-149147829 CCCAGCCTTGTGTGATGCTTTGG + Intronic
941253596 2:163199184-163199206 CTCAGCTATGTGACTTACTTTGG - Intergenic
944886407 2:204066808-204066830 CCCAGCCCTGTGATATCTTGAGG + Intergenic
945051206 2:205825927-205825949 CTCAGCCATGTGACTTGCTTTGG - Intergenic
945168390 2:206969991-206970013 CTCAGCCATGTGACTTCCTTTGG - Intergenic
946050753 2:216860301-216860323 CCCAGCCCTGTGCCAGGCATTGG + Intergenic
1168829929 20:840328-840350 CCCAGCCCTCTGCCACACTCAGG - Intronic
1169757546 20:9059463-9059485 CCCAACCCAGTGACTTGCTTTGG + Intergenic
1170360794 20:15543977-15543999 CTCAGCCATGTGACTTGCTTTGG - Intronic
1172332275 20:34083468-34083490 CTTAGCCATGTGACTTACTTTGG - Intronic
1172619536 20:36309827-36309849 TCCAGCCCTGTGCCAGGCTTGGG + Intronic
1175508474 20:59504529-59504551 CTCTGCCCTGTGACTTGCTTGGG - Intergenic
1176192337 20:63817938-63817960 TCCAGCCCTGTGACAGAATAAGG + Intronic
1176228322 20:64016727-64016749 CCCAGCCCTGTCACATTCCTCGG - Exonic
1177058404 21:16338536-16338558 TCCAGGCCTGTGACATACTAAGG + Intergenic
1179891152 21:44335661-44335683 CCCAGCACTGTGACATAACCTGG - Intronic
1181047409 22:20222125-20222147 CCAAGCCCTGTGGCACACTGGGG - Intergenic
1181507835 22:23373629-23373651 CCCAGCTCTGTGACCATCTTTGG - Intergenic
1182110508 22:27719786-27719808 CTCAGCCATGTGACTTGCTTTGG - Intergenic
1184352489 22:43953455-43953477 CCCATCCATGTGACTTGCTTTGG - Intronic
1184469384 22:44687385-44687407 CCCAGGCCTGTGACAGCCGTAGG - Intronic
949854884 3:8452394-8452416 CCCAGCTCAGTGACTTATTTCGG + Intergenic
950484934 3:13267564-13267586 CCCAGCCCTGTGCCCTTCTGGGG + Intergenic
950585711 3:13890737-13890759 CCCAGCCATGTGACTTCCTCTGG + Intergenic
955175749 3:56611770-56611792 CCGAGCCCAGTGAAATACATGGG - Intronic
960038327 3:113124157-113124179 CCCAACCCTCTGAGAGACTTGGG + Intergenic
968548000 4:1208329-1208351 CCCTGCCCTGTGCCCTGCTTGGG + Intronic
968659308 4:1792672-1792694 CCCAGGCCTGTGTCCTCCTTGGG + Intergenic
970032312 4:11690425-11690447 CACTGCTCTGTGAAATACTTTGG + Intergenic
971251492 4:24976415-24976437 CCCAGCCTGATGACACACTTTGG - Intronic
972070118 4:35008723-35008745 CCTCTCCCTCTGACATACTTCGG - Intergenic
972342602 4:38165557-38165579 CCCAGCCCTCACACTTACTTAGG - Intergenic
973056501 4:45665963-45665985 CACAGTCATGTGACATGCTTTGG - Intergenic
975310235 4:72896097-72896119 CACAGCCCTGGGACATAGTAGGG - Intergenic
975391117 4:73818482-73818504 AACATCCCAGTGACATACTTAGG + Intergenic
975746797 4:77482739-77482761 CCCAGACCTGTGCCTTAGTTTGG - Intergenic
976449243 4:85167435-85167457 CCCACTCCTCTCACATACTTTGG - Intergenic
977227002 4:94404163-94404185 CCCAGCCATTTGACGTAATTTGG - Intergenic
980691446 4:136300114-136300136 CTGAGCCCTGTGATATGCTTTGG - Intergenic
982150143 4:152445119-152445141 CCCAGCCCTGAACCACACTTTGG + Intronic
985682676 5:1264742-1264764 CCCAGCCCTGCTCCAGACTTCGG + Intronic
986529557 5:8721930-8721952 CCCAGTCCTATGACAAGCTTTGG - Intergenic
986836546 5:11645079-11645101 CCCAGCCATCTGAGATACTGAGG - Intronic
990818152 5:59808209-59808231 CTCAGCCCAGTGACATCCTGTGG + Intronic
991368378 5:65892599-65892621 CCCAGCACTTTGACATGCTGAGG - Intergenic
993029910 5:82694246-82694268 CCCAGCCCTGTCACCTTCCTGGG - Intergenic
993833170 5:92785015-92785037 CTCAGCCATGAAACATACTTAGG + Intergenic
994706505 5:103213251-103213273 CAAAGCACTTTGACATACTTTGG - Intergenic
996585899 5:125088301-125088323 CCAAGCTCTGTCACATTCTTGGG - Intergenic
997658883 5:135575203-135575225 CCCAGCCCTGGGACAATCTGTGG - Intronic
998669119 5:144333803-144333825 ACCAGCCATGTGACATGCTTTGG - Intronic
998801430 5:145873526-145873548 CCCTGCTCTGTCACTTACTTAGG - Intergenic
999393134 5:151208797-151208819 GCCAGCTCTGTTACAAACTTGGG + Intronic
999677233 5:154016217-154016239 CCCAGCCTTGTTAGAGACTTAGG + Intronic
999985887 5:157004995-157005017 CCCAGCCCTGGCAGATACCTTGG - Intergenic
1001141929 5:169151701-169151723 CCCAGCCCTGTAAAGTACTAGGG + Intronic
1001490646 5:172152407-172152429 CCCAGCCCTGAGCCAGATTTTGG - Intronic
1002347998 5:178561373-178561395 CCCAGCCCTGTGCCAGATTTGGG + Intronic
1004288665 6:14346555-14346577 CCCAGCCCTGTGCCCTGCCTGGG - Intergenic
1011504056 6:88021871-88021893 GCCAGTTCTGTGACATATTTGGG - Intergenic
1011656508 6:89556885-89556907 CCCAGCTCTGCCACTTACTTTGG - Intronic
1012265403 6:97135973-97135995 CTCAACCCACTGACATACTTAGG - Intronic
1014370436 6:120600595-120600617 CCCAGGACTGAGACATAGTTTGG + Intergenic
1015037367 6:128672403-128672425 CTCAGATCTGTTACATACTTGGG - Intergenic
1016937638 6:149459417-149459439 CCCAGGATTTTGACATACTTTGG + Intronic
1018924877 6:168199012-168199034 CCCCGCCCTGAGACATTCTGGGG + Intergenic
1019299409 7:295893-295915 CCCAGCCCTGTCACAGCCTGGGG - Intergenic
1019736679 7:2653302-2653324 CCCAGCCCTGAGACCCACCTGGG - Intronic
1021719063 7:23488621-23488643 CCCAGCACTGTGAGAGACTAAGG + Intergenic
1023603608 7:41906400-41906422 CTCAGCTATGTGACTTACTTTGG - Intergenic
1024491903 7:49995250-49995272 CCCAGCTCTATGTCATAATTTGG - Intronic
1024582443 7:50810765-50810787 CCCAGGCCTGTGACTTTGTTGGG + Intergenic
1026054246 7:66970852-66970874 GCCAGCCCTGTGGCAGTCTTCGG + Intergenic
1028834930 7:95364449-95364471 CACAGCCATGTGACTTGCTTTGG + Intronic
1029157273 7:98526162-98526184 CCCATCCCTGTTACACACTTGGG + Intergenic
1029481302 7:100814762-100814784 CCCAGCACTCTGAGATACTGAGG + Intronic
1031975903 7:128093372-128093394 CCCCTCCCTGGCACATACTTTGG + Intergenic
1033130300 7:138740233-138740255 CCCAGCCCAGGGACATGCTTGGG + Intronic
1037594106 8:20340195-20340217 GCCAGCCCTTTGAGAGACTTGGG - Intergenic
1038721573 8:30041444-30041466 CCCAGCCATGTGACTTTCTCTGG - Intergenic
1039064259 8:33595627-33595649 CCCAGCACTTTGGGATACTTAGG - Intronic
1039131751 8:34272796-34272818 CCCAGCCCTGTGATATAGGCAGG - Intergenic
1039766407 8:40633044-40633066 CCCAGCCCTGGAAGATTCTTGGG - Intronic
1040042717 8:42932578-42932600 CCCAGCCCCCTGACATTTTTGGG + Intronic
1040081259 8:43288653-43288675 CCCAGACCTGTCACAGATTTCGG + Intergenic
1040978951 8:53225469-53225491 CCCAGACCTGTGAATTGCTTAGG - Intergenic
1041169029 8:55121859-55121881 CACACCCCTTTGACATACTTTGG + Intronic
1041687808 8:60660430-60660452 TCCAGCGCTGTGACCTTCTTGGG + Intergenic
1041727714 8:61033445-61033467 CCCAGCCCTGTGACTTGCTCTGG - Intergenic
1041810629 8:61904899-61904921 CCCAGCTCTGTAAAAGACTTTGG - Intergenic
1044542749 8:93426036-93426058 CCCATGCCTCTGACTTACTTTGG - Intergenic
1044910168 8:97049343-97049365 CTCTGCCCTTTGACATCCTTTGG - Intronic
1046682592 8:117186937-117186959 CCCTGCCCTGTGACACAGTCTGG - Intergenic
1046799749 8:118412901-118412923 CCTAGCTATGTGACATGCTTTGG + Intronic
1047431720 8:124798810-124798832 CTCAGGCCAGTGACATTCTTTGG - Intergenic
1048826934 8:138437251-138437273 CCTAGCTCTGTGATATAGTTAGG + Intronic
1049275840 8:141719748-141719770 CCCAGCCCTGGGACACACAGGGG + Intergenic
1053222297 9:36322567-36322589 CGGAGCCCTGTGACATACATTGG - Intergenic
1057715599 9:97492999-97493021 CCAAGCCCTTTGACATATTTAGG + Intronic
1061271394 9:129545522-129545544 CCCAGCCCTGTGTCAGACCGGGG - Intergenic
1062072970 9:134568299-134568321 CCCAGCCCTGTGTCATAGCCTGG + Intergenic
1062535408 9:137019054-137019076 CGCAGCTCTGCTACATACTTGGG + Exonic
1185882786 X:3756355-3756377 CCCAGGCATGTGACTCACTTGGG - Intergenic
1186499387 X:10039059-10039081 CCCAGCCCTCAGCCATCCTTTGG - Intronic
1187482530 X:19670970-19670992 CCTAACCCTGAGTCATACTTGGG + Intronic
1190183071 X:48210114-48210136 CCCAGCACTTTGACAGACTGAGG - Intronic
1194288615 X:92040229-92040251 CCCAGCACTAGGACATGCTTAGG + Intronic
1197004344 X:121478549-121478571 CCCAGGTCTGTCACATATTTTGG + Intergenic
1198064388 X:133082037-133082059 CCCAGACCTGTGATATCCCTTGG + Intronic
1199240155 X:145537663-145537685 CCCAGCCCTGTTTGAAACTTGGG - Intergenic
1199574508 X:149300380-149300402 CATAGCCCTGTGACTTGCTTTGG + Intergenic
1200606136 Y:5264794-5264816 CCCAGCACTAGGACATGCTTAGG + Intronic