ID: 1167218977

View in Genome Browser
Species Human (GRCh38)
Location 19:48184986-48185008
Sequence CACAGGGACAATCCTGCAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 207
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 193}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167218977_1167218982 17 Left 1167218977 19:48184986-48185008 CCCTCTGCAGGATTGTCCCTGTG 0: 1
1: 0
2: 1
3: 12
4: 193
Right 1167218982 19:48185026-48185048 AGATCAGAGCCTTCCCTGGAAGG No data
1167218977_1167218984 19 Left 1167218977 19:48184986-48185008 CCCTCTGCAGGATTGTCCCTGTG 0: 1
1: 0
2: 1
3: 12
4: 193
Right 1167218984 19:48185028-48185050 ATCAGAGCCTTCCCTGGAAGGGG 0: 1
1: 0
2: 3
3: 23
4: 218
1167218977_1167218981 13 Left 1167218977 19:48184986-48185008 CCCTCTGCAGGATTGTCCCTGTG 0: 1
1: 0
2: 1
3: 12
4: 193
Right 1167218981 19:48185022-48185044 TCATAGATCAGAGCCTTCCCTGG 0: 1
1: 0
2: 1
3: 10
4: 133
1167218977_1167218983 18 Left 1167218977 19:48184986-48185008 CCCTCTGCAGGATTGTCCCTGTG 0: 1
1: 0
2: 1
3: 12
4: 193
Right 1167218983 19:48185027-48185049 GATCAGAGCCTTCCCTGGAAGGG 0: 1
1: 0
2: 1
3: 19
4: 185

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167218977 Original CRISPR CACAGGGACAATCCTGCAGA GGG (reversed) Intronic
900523917 1:3119317-3119339 CAGAGGGCCAAGCCTGCAGCGGG - Intronic
900576240 1:3383860-3383882 CACCAGGACACACCTGCAGAAGG + Intronic
900576247 1:3383894-3383916 CACCAGGACACACCTGCAGAAGG + Intronic
901481597 1:9529048-9529070 CAGAGGGGCAGGCCTGCAGAAGG - Intergenic
901511431 1:9719911-9719933 CAATGGGGCAGTCCTGCAGAAGG - Exonic
902336557 1:15757995-15758017 CACCGGGACCCACCTGCAGAGGG + Intronic
902371357 1:16009114-16009136 CCCAAGGACAAGGCTGCAGAGGG + Intergenic
903360836 1:22776031-22776053 GACAGGGATGATCCAGCAGAGGG + Intronic
903667230 1:25015517-25015539 CACAGGGAAAATCCACCAGGGGG + Intergenic
906102510 1:43272429-43272451 CCAAGGGACAGTACTGCAGAGGG + Intronic
906330207 1:44877928-44877950 AACAGGGACTATGCAGCAGACGG - Intronic
908628976 1:66080782-66080804 CTCTGTGACAATCCTGCACATGG - Intronic
909355371 1:74702732-74702754 CACAGAGAAAATCTTGCAAATGG - Intergenic
912696018 1:111842670-111842692 TACAGAGACAGTCCTACAGATGG - Intronic
913242130 1:116838276-116838298 CACAGGGACAAAGCTGCCTAAGG + Intergenic
913479517 1:119274121-119274143 CACAGGGACAGTCTTGGAGAGGG + Intergenic
913575919 1:120174828-120174850 CTCTAGGACCATCCTGCAGAAGG - Intronic
914558232 1:148790399-148790421 CTCTAGGACCATCCTGCAGAAGG - Intergenic
914614602 1:149339831-149339853 CTCTAGGACCATCCTGCAGAAGG + Intergenic
915670336 1:157483511-157483533 CACAAGGACAATCCCAGAGAAGG + Intergenic
920343179 1:205288515-205288537 CAGAGGGACCTTCCTGCAGCTGG - Intergenic
921255114 1:213331938-213331960 CACAGGAAAAATACAGCAGAAGG - Intergenic
921730501 1:218572815-218572837 GACAGGCACAATCCTGCACTGGG + Intergenic
1066193708 10:33078742-33078764 CACGGAGACACTCCAGCAGACGG - Intergenic
1067082763 10:43220965-43220987 GCCAGGGACACTCCTGCGGAGGG + Intronic
1067093946 10:43286153-43286175 CTCAGGGAGCATCCTGCAGCTGG + Intergenic
1067173615 10:43927109-43927131 CACAGGAAGTGTCCTGCAGACGG - Intergenic
1068350449 10:55837567-55837589 CAAAGGGAAATTCTTGCAGAAGG + Intergenic
1069548013 10:69342559-69342581 CACAGAGCCACACCTGCAGAGGG + Intronic
1072221420 10:93330698-93330720 CAGAGGGACAGTCCCGGAGAAGG + Intronic
1072905699 10:99451218-99451240 CACAGCCACCATCCTACAGAGGG - Intergenic
1073180658 10:101581049-101581071 CAGAGGGACAATCCTTCAGCTGG - Intronic
1073602494 10:104860861-104860883 TTCAGGGACTATCTTGCAGAGGG - Intronic
1074269110 10:111935496-111935518 AACTGGGTCATTCCTGCAGATGG - Intergenic
1075732111 10:124642582-124642604 CTCAGGGACATTGCTGCCGAAGG - Intronic
1077024881 11:434685-434707 CACAGGGAGGATCCTGCAGCAGG + Intronic
1078645763 11:13140399-13140421 CCCTGGGACCATCCTGCACAGGG + Intergenic
1080407388 11:31991584-31991606 CAGAGGGAGAATCCTTCATAAGG - Intronic
1082433146 11:52698121-52698143 GAGATGGACAATCCTGCTGATGG + Intergenic
1082462488 11:53123127-53123149 GAGATGGACAATCCTGCTGATGG + Intergenic
1083543907 11:63535151-63535173 ACCATGGACACTCCTGCAGAGGG + Intergenic
1084491349 11:69480275-69480297 CTCAGGGTCAGGCCTGCAGAAGG - Intergenic
1084729111 11:71061867-71061889 CACAGGGCAAGTCCTGCAGCTGG - Intronic
1084933003 11:72571618-72571640 CCCAGGGACCGTTCTGCAGAGGG + Intergenic
1085478243 11:76801362-76801384 CAGAGGGACATTCCTGCATTTGG - Intergenic
1086074662 11:82837090-82837112 ACCAGACACAATCCTGCAGAAGG + Intronic
1086492283 11:87367495-87367517 ATCAGAGACAATCCTGCACATGG + Intergenic
1087174861 11:95087515-95087537 CACAGGGACAATGCTGCTCCTGG - Intergenic
1089365149 11:117917024-117917046 GAGAGGGACACTCCTGCAAATGG - Intronic
1092182024 12:6452505-6452527 CACAGGGAAAATGCTAAAGAGGG + Intronic
1096826975 12:54286943-54286965 CACAAGGACGTTCCTGCAAAAGG - Intronic
1098057182 12:66520311-66520333 AACAGGGAAAATCCTCCAGATGG + Intronic
1100409525 12:94301270-94301292 CACAGGCAGAATTCTGCAGTTGG - Intronic
1101750681 12:107580668-107580690 GACAGGGACGAGGCTGCAGATGG + Intronic
1102552215 12:113699771-113699793 CACAGGCAGAAGCCTGCAAATGG + Intergenic
1108527136 13:51294957-51294979 AACAAGAACAATCCTGCAGGAGG + Intergenic
1110124385 13:71924456-71924478 CAAAGAGACAATCCAGCAAATGG + Intergenic
1114600430 14:23951903-23951925 CAAAGGGACAGGCCTGCAGGGGG - Intergenic
1114604613 14:23986738-23986760 CAAAGGGACAAGCCTCCAGGGGG - Intronic
1117680057 14:58194652-58194674 CAAAGGGACAAAGCTGCAGAAGG + Intronic
1118760758 14:68879168-68879190 CACAGGGACAGGCATGCGGAGGG + Intronic
1122081017 14:99268037-99268059 CACAGTGGCAATCGTGCCGAGGG - Intronic
1122743662 14:103885834-103885856 GTCAGGGACATTCCTGGAGAAGG - Intergenic
1123481623 15:20637932-20637954 GACAGTGACAAGCATGCAGATGG + Intergenic
1123636390 15:22362433-22362455 GACAGTGACAAGCATGCAGATGG - Intergenic
1124254454 15:28129587-28129609 CAGAGGGCCAAGCCTGCAGCAGG + Intronic
1125367369 15:38932484-38932506 CACTGGGAGAAACCAGCAGATGG + Intergenic
1126163340 15:45633734-45633756 CACAGAAGCAATGCTGCAGATGG + Intronic
1126673542 15:51137531-51137553 CACTGGGGCTATCCTACAGATGG - Intergenic
1127140390 15:55969848-55969870 CACAGGGAGACTCCTGCTTAAGG + Intronic
1131184690 15:90264717-90264739 CAGAAGGACAAGCCAGCAGAAGG + Exonic
1131370588 15:91877930-91877952 CACAGGGAGCATCCTGTGGAAGG + Intronic
1131379782 15:91954342-91954364 CACAGTGCCCGTCCTGCAGATGG - Intronic
1132070198 15:98769925-98769947 CACCGGAATAATCCAGCAGACGG - Intronic
1132529902 16:441614-441636 CACAGGGACTAGCCTGGAGTTGG + Intronic
1137037656 16:35579997-35580019 CACAGGCACCATCCTAGAGATGG + Intergenic
1138444543 16:57055202-57055224 CCCTGGAACAACCCTGCAGAGGG + Intronic
1138756633 16:59494230-59494252 GACAAGGACACTCCTTCAGAAGG - Intergenic
1139355482 16:66364910-66364932 CCCAGGGAGCATCCAGCAGACGG - Intergenic
1139434562 16:66928543-66928565 GACAGGGACTGTCCGGCAGAAGG + Intergenic
1139868972 16:70088365-70088387 GACCGGGAGAATCCTGCTGATGG - Intergenic
1139878237 16:70163599-70163621 TACAAAGACAACCCTGCAGAGGG - Intergenic
1140386415 16:74543807-74543829 GACCGGGAGAATCCTGCTGATGG + Intronic
1141136387 16:81468384-81468406 GAGAGGGACACTCATGCAGATGG - Intronic
1141313027 16:82933893-82933915 CACAGGGACAAAGCTGCCCAAGG - Intronic
1142005949 16:87689704-87689726 CACCGGGACACCCCTGCAGCAGG + Exonic
1143894928 17:10128318-10128340 CACAGGGACAACCAGGCAGAGGG - Intronic
1144779102 17:17799030-17799052 CCCATGGACTGTCCTGCAGAGGG - Intronic
1145037358 17:19550815-19550837 CACAGGGGACAACCTGCAGAGGG - Intronic
1145906133 17:28517257-28517279 CACAGGGACACACCTCCACAGGG + Intronic
1145906147 17:28517324-28517346 CACAGGGACACACCTCCACAGGG + Intronic
1147464151 17:40597831-40597853 CCCAGGGAAAATCCTCCACAGGG + Intergenic
1148714108 17:49703371-49703393 CACACAGACACTCCTGCACATGG + Intronic
1148850927 17:50554798-50554820 CACAGAGGCAAACCTGCAGATGG - Intronic
1148864009 17:50619194-50619216 CACAGGGCCACCCCAGCAGACGG + Intronic
1150721800 17:67619784-67619806 CACACCCACAAGCCTGCAGATGG - Intronic
1152279347 17:79376191-79376213 GACAGAGACAAACCTGGAGAAGG - Intronic
1152694232 17:81735625-81735647 CACGCGCACCATCCTGCAGACGG + Intergenic
1152774380 17:82191313-82191335 CAGACAGACACTCCTGCAGAAGG + Intronic
1152797899 17:82316944-82316966 CACGGGGACAGTCGTGCAGTGGG + Exonic
1153814108 18:8778565-8778587 CACAGGGACAGGGCTGCAGGAGG - Intronic
1154165047 18:12008570-12008592 CACAGGGACCAGCCTGCAGAAGG + Intronic
1154496337 18:14963889-14963911 CAGAGGGACAGTGCTGCAGTGGG + Intergenic
1155990144 18:32271634-32271656 CACACTGACAAGGCTGCAGAAGG + Intronic
1156505624 18:37589435-37589457 CACAGAGACGAGCCTGCAGCTGG + Intergenic
1160039246 18:75330921-75330943 CACAGGGAGACGCCTGGAGATGG - Intergenic
1160276460 18:77442386-77442408 CACAGGGTCACACCTGCAGGAGG - Intergenic
1162043995 19:7987039-7987061 CGGAAGGACATTCCTGCAGAGGG + Intronic
1165138947 19:33687850-33687872 CCCAGGGACAATACTTCAGCCGG - Intronic
1166240988 19:41493576-41493598 CACAGGGGCAGTCCAGCACATGG + Intergenic
1167218977 19:48184986-48185008 CACAGGGACAATCCTGCAGAGGG - Intronic
1167646322 19:50707280-50707302 CACAGGGACTATTCGGTAGAAGG + Intronic
1168642355 19:58038729-58038751 CACAGGGGCAAAGATGCAGAAGG - Intronic
925085436 2:1104110-1104132 CACAGGGACAGACATGCAAATGG + Intronic
925487993 2:4357632-4357654 TACAGGAAAAATCATGCAGAAGG + Intergenic
925513293 2:4651419-4651441 CACATGGACAAAGCTGCCGAAGG + Intergenic
927927774 2:27025392-27025414 CACATGGACACTCCAGCAGCTGG - Intronic
929123550 2:38502764-38502786 CACAGGGCCAGTCAAGCAGAAGG - Intergenic
931427208 2:62182177-62182199 CAGAGGGAGAATCCAGCAAAAGG - Intergenic
941157644 2:161999007-161999029 CACTGGGAGAAGCCTCCAGAGGG + Intronic
943879998 2:193131276-193131298 CACAGGGACAGAGCTGCACAAGG - Intergenic
947102182 2:226632577-226632599 CACAAGAAGAATGCTGCAGAAGG + Intergenic
948389020 2:237598754-237598776 CACAGTGACAGACCTGCAGTGGG - Intronic
1169923803 20:10761972-10761994 CACACGGACAAGCCTGAACAGGG + Intergenic
1170152425 20:13239408-13239430 CTCAGGGAGGACCCTGCAGATGG - Intronic
1175529625 20:59665678-59665700 CACTTGGAGAAGCCTGCAGAGGG + Intronic
1179006809 21:37522476-37522498 TACAGGGACCATCCAGCTGAAGG - Intergenic
1179116434 21:38497564-38497586 CACAGGTACAATCCTAAATATGG - Intronic
1184339819 22:43880142-43880164 CACAGCCTCATTCCTGCAGAAGG - Exonic
1185062769 22:48615707-48615729 CACAGGGCCCCTCCTGGAGAGGG - Intronic
950303354 3:11900371-11900393 CACATGGACACTCATACAGATGG - Intergenic
953690289 3:45112189-45112211 CACAGTGCCATTGCTGCAGAAGG + Exonic
954925829 3:54233429-54233451 CACAGGGACAATTCATCCGAAGG + Intronic
956291802 3:67668487-67668509 CAAAAGGACAATAGTGCAGAGGG - Intergenic
961385213 3:126519335-126519357 CACAGGCAGATTCCTGGAGAGGG + Intergenic
961694293 3:128693600-128693622 CACAGGCAGATTCCTGGAGAGGG - Intergenic
961704086 3:128770686-128770708 CACAGAGACAATGCAGGAGATGG - Intronic
963843180 3:150128921-150128943 CACAGAAACAATGCTGCAGTAGG + Intergenic
964975561 3:162615083-162615105 CACAGGGGCAAACCTGCCTAAGG + Intergenic
966926932 3:184650621-184650643 CAGAGGGACAAACCAGCAGAGGG + Intronic
967975750 3:195033987-195034009 CACAGGAACACTCCTGAAGTGGG - Intergenic
969461905 4:7333477-7333499 CACAGGGCCCAGCCTGCAGGAGG + Intronic
969873837 4:10121522-10121544 GACAGGGACAGGCCTGCAAAAGG - Intergenic
970387368 4:15569055-15569077 CACCAGGACAAGCCAGCAGAGGG + Intronic
971387187 4:26151693-26151715 CACAGGATCAACCCAGCAGAGGG - Intergenic
973832123 4:54772157-54772179 TACAGTGACAATAGTGCAGATGG - Intergenic
974834289 4:67228577-67228599 AACAGGAAAATTCCTGCAGAAGG + Intergenic
974972313 4:68845281-68845303 CACAGGGACAAAGCTGCTCAAGG + Intergenic
975342898 4:73260891-73260913 CACAGAGACTAGACTGCAGAGGG - Intergenic
977332953 4:95661032-95661054 CACAGAGCCAACCCTGCTGAAGG - Intergenic
978206807 4:106089831-106089853 CACAGGGACAAACCTGTCCAAGG - Intronic
979230683 4:118346058-118346080 CAAAAGGACATTCCTGCAGAGGG + Intronic
981455118 4:144944717-144944739 CACAGGAACAGGGCTGCAGAGGG + Intergenic
982056184 4:151551043-151551065 CAGAGGGAAAATTCTGGAGAGGG + Intronic
982122429 4:152156077-152156099 CACAGGGAACAGCCTGAAGAGGG - Intergenic
982267095 4:153548060-153548082 CACAGGGACCCTACTCCAGACGG - Intronic
986098212 5:4580916-4580938 CACAGCGACACTCTTGCACATGG + Intergenic
986205800 5:5623880-5623902 CACAGGGGCAAAGCTGCACAAGG + Intergenic
990496456 5:56353134-56353156 GAAAGGGACTATTCTGCAGAAGG + Intergenic
997597614 5:135117585-135117607 CCCAGGGAAAAGGCTGCAGAAGG - Intronic
997840963 5:137239288-137239310 CACAGGGAAACTCCTGCACTTGG + Intronic
998478214 5:142439404-142439426 CACAGGAAGCATGCTGCAGAAGG - Intergenic
1001109771 5:168885942-168885964 CACAGGCAAAATCCTGCACTTGG + Intronic
1005138408 6:22598484-22598506 CACAGGAAGAAGTCTGCAGATGG + Intergenic
1005854955 6:29853434-29853456 CACATGGACCGTCCTGGAGAGGG + Intergenic
1007727808 6:43927228-43927250 CTGAGGGACATTCCAGCAGAGGG - Intergenic
1008205925 6:48656412-48656434 TACAGTGACACTCCAGCAGAAGG + Intergenic
1008619704 6:53259640-53259662 CACAGGAACAATGCAGCTGAAGG + Intergenic
1013450612 6:110276722-110276744 CACTGGGAAATCCCTGCAGAAGG - Intronic
1019637497 7:2083878-2083900 CACTGGGAGCATCCTGCAGCCGG - Intronic
1020403027 7:7799264-7799286 CAGAGAAACAATCTTGCAGATGG + Intronic
1021231638 7:18092485-18092507 CACAGGACAAATTCTGCAGAGGG - Intronic
1022488020 7:30795170-30795192 CACATGGACACTCCTACAGTTGG + Intronic
1023964429 7:44955443-44955465 CAGAAGAATAATCCTGCAGATGG - Intergenic
1024983591 7:55177720-55177742 CTCAGGGACACTCCTGCGGTGGG + Intronic
1026541339 7:71282571-71282593 CAAAAGGAAAATCCTGCATAAGG + Intronic
1030695300 7:112578648-112578670 CACAGAGACATTTCTGAAGATGG - Intergenic
1031459321 7:122026535-122026557 CACAGAAACTATCCTACAGAAGG - Intronic
1035244083 7:157551050-157551072 CCCACGGACACTCCTGCAGTTGG + Intronic
1037716145 8:21402461-21402483 CCCAGGCACTAACCTGCAGAGGG + Intergenic
1038524798 8:28263590-28263612 CACAGGAACACACCTGCAGCTGG + Intergenic
1042509064 8:69592267-69592289 CTAAGGAACAATGCTGCAGAGGG + Intronic
1045258116 8:100546775-100546797 CACAGGGACAAAGCTGCTCAAGG + Intronic
1047973904 8:130110911-130110933 CACAGGGAGAACCCTGCATTTGG + Intronic
1048952183 8:139505358-139505380 CCCAGGGACAAGCCTGTGGAAGG - Intergenic
1049386836 8:142347123-142347145 AAGAGGGAGAAGCCTGCAGAAGG + Intronic
1050660351 9:7877239-7877261 CACAGGGACAAAGCTGCCCAGGG + Intronic
1051370740 9:16356843-16356865 CACAGGGTCAACCCTTTAGAAGG - Intergenic
1051547586 9:18293682-18293704 CCCACATACAATCCTGCAGAGGG - Intergenic
1055426593 9:76203103-76203125 CACAGGGATGATGCTGAAGAAGG - Intronic
1060194367 9:121613869-121613891 CACAGGGAGAAGTCTTCAGATGG + Intronic
1061386885 9:130295661-130295683 CACAGGGAGGATCCTGCAGGAGG + Intronic
1061785436 9:133025076-133025098 CTCAGGGACCCTCCTGCTGAAGG - Intergenic
1062071169 9:134555745-134555767 CCCAGAGACAGTCCTGCAGGTGG - Intergenic
1062079967 9:134618646-134618668 AACTGGGACAGTCTTGCAGAAGG + Intergenic
1062489528 9:136798615-136798637 TACAGGGACAATCCAGGACATGG + Intronic
1187176186 X:16898167-16898189 CACCCGGACATTCCTGCAGAAGG - Intergenic
1187739424 X:22339622-22339644 GACAGTGACAACCATGCAGAGGG - Intergenic
1189327625 X:40122443-40122465 AACAAGGACAACCATGCAGAAGG - Intronic
1191690896 X:63936842-63936864 CACAGGTAATATCCTGCAGAGGG - Intergenic
1193008186 X:76644287-76644309 CACAGGGACAATAGTGCCCAAGG + Intergenic
1194560376 X:95412165-95412187 CACAGGGACAAATCTGCCCAAGG + Intergenic
1195048986 X:101079867-101079889 CAGAGGGGAAAACCTGCAGAGGG - Intronic
1202160338 Y:21927780-21927802 AACAGAGGCACTCCTGCAGATGG + Intergenic
1202231018 Y:22658598-22658620 AACAGAGGCACTCCTGCAGATGG - Intergenic
1202312140 Y:23537567-23537589 AACAGAGGCACTCCTGCAGATGG + Intergenic
1202558663 Y:26133027-26133049 AACAGAGGCACTCCTGCAGATGG - Intergenic