ID: 1167221728

View in Genome Browser
Species Human (GRCh38)
Location 19:48203819-48203841
Sequence AGGAACAAGGTTAAGGAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 320
Summary {0: 1, 1: 0, 2: 3, 3: 21, 4: 295}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167221728_1167221733 1 Left 1167221728 19:48203819-48203841 CCAGCTTCCTTAACCTTGTTCCT 0: 1
1: 0
2: 3
3: 21
4: 295
Right 1167221733 19:48203843-48203865 CCTCCAGCCAGCTCACCCATTGG 0: 1
1: 0
2: 3
3: 15
4: 182

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167221728 Original CRISPR AGGAACAAGGTTAAGGAAGC TGG (reversed) Intronic
900091598 1:923182-923204 AGGAGCAAGGCTAGTGAAGCAGG - Intergenic
900894459 1:5473606-5473628 AGGAACCAGGACAAGGCAGCAGG + Intergenic
901272197 1:7961364-7961386 AGGAACAACGCAAAGGGAGCAGG + Intronic
901395349 1:8977069-8977091 AGGACCAAGTTCAAGGATGCTGG + Intergenic
904648953 1:31989807-31989829 ATGAAAAAGGTGAAGGATGCCGG - Intergenic
904919843 1:33998519-33998541 AGCAGCAAAGTTAACGAAGCTGG - Intronic
905535430 1:38717876-38717898 AAGAACAAGGTGAAGGAAATGGG - Intergenic
906553382 1:46686235-46686257 AGGTACAAGGTGAAGGGAACTGG + Intronic
907111879 1:51934192-51934214 AGTAAAAAGGTTAGGGAGGCAGG - Intronic
907302408 1:53496553-53496575 AGGGTCAAGGTGGAGGAAGCAGG + Intergenic
909909205 1:81240767-81240789 AGGAAGCAGATTGAGGAAGCAGG - Intergenic
909937745 1:81573342-81573364 AGGAAAAAGGTTAAGGAAGGGGG - Intronic
910160119 1:84263427-84263449 AGGTAAAAGGATAAGGAAGAAGG + Intergenic
910180657 1:84479207-84479229 AAGTAAAAGGTTAAGGAAGGGGG + Intergenic
910636989 1:89419486-89419508 AGGAATAAGCTTAACCAAGCAGG - Intergenic
911734541 1:101322490-101322512 AGGAACAAATGCAAGGAAGCTGG + Intergenic
911949646 1:104155724-104155746 AGCAACAACGTTAATGAACCTGG + Intergenic
912191573 1:107347017-107347039 AAGAACAAGGCAAAGCAAGCAGG + Intronic
913687275 1:121244472-121244494 AGGAACAAGGTAAATGATTCAGG - Intronic
914039136 1:144032117-144032139 AGGAACAAGGTAAATGATTCAGG - Intergenic
914459542 1:147870397-147870419 AAGAATAAGGCTTAGGAAGCTGG + Intergenic
914942620 1:152036530-152036552 AGGAGCAAGTTTAAGGCAGGGGG - Intronic
915603545 1:156937235-156937257 AGGCTCAAGGTGAGGGAAGCAGG - Exonic
916026334 1:160836759-160836781 AGGAACAAGAAAAGGGAAGCAGG - Intronic
917525574 1:175785341-175785363 AGGTACATGGGTGAGGAAGCAGG - Intergenic
918372361 1:183873887-183873909 AGGCACAAGGAACAGGAAGCAGG - Intronic
919130211 1:193441559-193441581 AGGAACAAGGTATTGGAAACTGG + Intergenic
920474604 1:206262993-206263015 AGGAACAAGGTAAATGATTCAGG - Intronic
920512809 1:206563366-206563388 AGGTACAAGGTCAAAGAAACAGG - Intronic
920819260 1:209365095-209365117 AGAAGAAAGGTTAAGGAAGGAGG - Intergenic
921755790 1:218854613-218854635 AGGAACAAGGTATTGGAACCTGG + Intergenic
924251317 1:242135979-242136001 AGGAACAAGTTCAGGGAAACAGG - Intronic
924619006 1:245643857-245643879 AGGAACAAAGATAAGGATGACGG - Intronic
924919909 1:248618018-248618040 AGCAACAAAGTTTTGGAAGCTGG + Intergenic
1062920400 10:1274807-1274829 AGGGTCAAGGTCAAGGCAGCTGG - Intronic
1063564200 10:7158077-7158099 AGGGACAGGGTTAAGGGAGAAGG - Intergenic
1063689520 10:8273017-8273039 AGGGAATAGCTTAAGGAAGCTGG - Intergenic
1065667868 10:28082443-28082465 AGGAGGAAGGATAAGGAAGGAGG - Intronic
1066321549 10:34308147-34308169 AGGGACAAGGTCAAAGAGGCTGG + Intronic
1067949174 10:50712689-50712711 AAGGACAAGGTCAAGGAAGGTGG + Intergenic
1069077052 10:64049264-64049286 AGGAATAAGTTTAATGAAGGAGG + Intergenic
1069506856 10:69006748-69006770 AGGCCCAAGGATAAGGCAGCGGG - Intronic
1070884489 10:79877701-79877723 AAGGACAAGGTCAAGGAAGGTGG + Intergenic
1071111802 10:82166965-82166987 AGGAACAAAGATAAGAAAGATGG - Intronic
1071666353 10:87562641-87562663 AGGCCCAAGGGTAAGGAAGTTGG - Intergenic
1072421990 10:95297010-95297032 AGGAACAGGGCAAAGGAGGCAGG + Intergenic
1072948692 10:99834001-99834023 AGGACCAAGGGGAAGGGAGCTGG - Intronic
1076419868 10:130323726-130323748 AGGAACAAGGTATTGGAAACTGG + Intergenic
1076848119 10:133080056-133080078 AGGAACCAGGCTGAGGCAGCTGG + Intronic
1076870885 10:133193582-133193604 AGGAAAAAGGAGAAGGAAGGAGG + Intronic
1077721828 11:4637623-4637645 AGGAACAAGGTCCAGGAACCGGG - Intergenic
1077800446 11:5530907-5530929 AGGAACAACGCTAAGAATGCGGG - Intronic
1079626814 11:22625936-22625958 AGGAACACGGATAAAGACGCTGG - Exonic
1080340214 11:31254200-31254222 ATAAAGAAGGGTAAGGAAGCTGG + Intronic
1081290588 11:41320751-41320773 AGGACCAAGTTTAACGATGCTGG - Intronic
1081567537 11:44269377-44269399 AGGAAAGAGGTCAAGGAAGATGG + Intronic
1084230001 11:67744704-67744726 GGGCACAGGGGTAAGGAAGCTGG - Intergenic
1086576359 11:88342577-88342599 AGGAACAAGGTATTGGAAACTGG - Intergenic
1088646760 11:111923785-111923807 AAAAACAAGGACAAGGAAGCAGG + Intronic
1089017560 11:115179012-115179034 TGGAACAAGCTTAGGGAGGCAGG + Intronic
1089127726 11:116189224-116189246 AGGAAAAAGATTTAGGAAGGGGG - Intergenic
1089629136 11:119773011-119773033 AAGAACAAGGTCAGGGAGGCTGG - Intergenic
1090574873 11:128089867-128089889 AGGAACAAGGTATTGGAAACTGG - Intergenic
1090935702 11:131340022-131340044 AGGAACAAGGCTAAGAGAGCAGG - Intergenic
1092485250 12:8897311-8897333 AGTAACAAGGCAAAGGAAGGGGG + Intergenic
1092531648 12:9350109-9350131 AGGAACTTGGTAAAGAAAGCAGG + Intergenic
1093508404 12:19896785-19896807 AGGAAGAAGGAGAAGGAAGGAGG - Intergenic
1095148398 12:38759905-38759927 AGGAACAAGTTCAAGAAGGCTGG - Intronic
1095725821 12:45451902-45451924 AGGAATAAATTTAATGAAGCAGG + Intergenic
1100037629 12:90272446-90272468 AGGAACAAGATGAAGGAATTTGG - Intergenic
1101151414 12:101886018-101886040 ACTAACAAGGTTAATGAAACAGG - Intronic
1102899318 12:116624064-116624086 AAGAAGAAGGTGAAGGAAGAAGG + Intergenic
1104217933 12:126752823-126752845 AGGAACAGTGATTAGGAAGCGGG + Intergenic
1105576998 13:21662829-21662851 AGGAACAAGGTATTGGAACCTGG - Intergenic
1105966207 13:25387071-25387093 ATTAACAAGGCTAAGGAAGTGGG - Intronic
1106007626 13:25785837-25785859 AGGAAGAAGATAAAGGAAGGAGG + Intronic
1106641183 13:31586093-31586115 AGGAAAAAGGTTTTGGAAACTGG + Intergenic
1107112253 13:36710853-36710875 AGGAACAGGGTTCAGGAATTGGG + Intergenic
1107484321 13:40811833-40811855 AGCAAAAAGCTTAAGGAACCTGG - Intergenic
1107888143 13:44891551-44891573 AGGGAAAAGGGAAAGGAAGCCGG + Intergenic
1107966040 13:45599016-45599038 AGGAAAAAGGGAGAGGAAGCAGG - Intronic
1108792994 13:53995549-53995571 AGGAACAAGGTATTGGAAACTGG + Intergenic
1110207986 13:72939906-72939928 AGGAACAAAGATAAGGATGACGG - Intronic
1110763535 13:79255963-79255985 AGGAACAGGACTAAGAAAGCAGG - Intergenic
1112611294 13:100957276-100957298 AGGATCAAGGTCAAGGATACAGG - Intergenic
1113075009 13:106459601-106459623 AGGAGCAAGGTTAGGCAAGTAGG + Intergenic
1114735265 14:25037144-25037166 AGGAACCAGGTTTGGGAAACAGG + Intronic
1115631135 14:35246589-35246611 AGCAACAAGATTTTGGAAGCTGG - Intronic
1115785604 14:36822002-36822024 AGGAACAAGGTTAAGGGTTTGGG + Intronic
1116342452 14:43741664-43741686 ATGAGCAAGGTTAAGGCAGAAGG - Intergenic
1118344515 14:64927606-64927628 AGGAAGAAGGTAAAGGAAGGTGG + Intronic
1119561555 14:75594141-75594163 AGGAACAAGGTATTGGAAACTGG - Intronic
1121082430 14:91119194-91119216 AGCAACAAGATGGAGGAAGCTGG - Intronic
1122752172 14:103944859-103944881 AGGAAAAAGGGAAAAGAAGCCGG - Intronic
1123770205 15:23521228-23521250 AGGAACAAGGCATTGGAAGCTGG - Intergenic
1127600675 15:60533724-60533746 AGGAATCAGGGTAAGGAGGCTGG - Intronic
1132984471 16:2757221-2757243 AAGAAAAAAGTTAAGCAAGCAGG - Intronic
1133633837 16:7647478-7647500 AGGAACAATGGAAAGGACGCAGG - Intronic
1136039414 16:27566236-27566258 AGAATCAAGGTTCAGGAAGCCGG + Intronic
1138191600 16:55018166-55018188 AGAAATTAGGTTCAGGAAGCAGG + Intergenic
1140791982 16:78400636-78400658 AGGAAAAGGGGGAAGGAAGCAGG + Intronic
1141439633 16:84021463-84021485 AGGAACAAGGTTTTGGAAGCTGG - Intronic
1141810794 16:86374019-86374041 ACCCAAAAGGTTAAGGAAGCTGG - Intergenic
1142964256 17:3571178-3571200 AGGAACAGGGCTGAGGAGGCAGG + Intronic
1143347552 17:6261124-6261146 AGGAACAAATTTGGGGAAGCAGG - Intergenic
1146476712 17:33168542-33168564 AGGAACAAGGTACTGGAAACTGG + Intronic
1148389213 17:47258208-47258230 AGGGCCAAGGTTCAGGAAGAGGG - Intronic
1149513681 17:57263683-57263705 AAAAACAAAGTTAAGGAAGGGGG - Intronic
1151587034 17:75015665-75015687 AGGAACATGCTTCAGGAAGGAGG + Intronic
1151911097 17:77083842-77083864 AGGAACCAGGGCCAGGAAGCAGG - Intergenic
1153397165 18:4637065-4637087 ATGAACAAGACTCAGGAAGCAGG + Intergenic
1153645694 18:7194279-7194301 AGGAACATGGTTAAAGAGCCAGG - Intergenic
1154038177 18:10827168-10827190 ACGAACAAGTTAAAGGAAGAAGG + Intronic
1156677781 18:39551593-39551615 AGAAACTAGATAAAGGAAGCTGG + Intergenic
1156963103 18:43056884-43056906 AGGGGCAAGAGTAAGGAAGCAGG - Intronic
1157614371 18:48978027-48978049 AGGGACAGGGTTAGGGAGGCTGG - Intergenic
1159939625 18:74396900-74396922 ATGAAAAAGCTTGAGGAAGCTGG - Intergenic
1161701762 19:5799832-5799854 AGGAGCAAGGTTGTGCAAGCAGG - Intergenic
1161835358 19:6642380-6642402 AGGAACAAGGACAAGAAAGAAGG + Intergenic
1163761616 19:19140060-19140082 AGGAAAAGGGTCAAGGTAGCGGG - Intergenic
1164441162 19:28281926-28281948 GGGAAGAAGGTCAAGGAAGAAGG - Intergenic
1165009642 19:32834712-32834734 AGGAACAAAGTTAAGTTTGCTGG + Intronic
1165908988 19:39212372-39212394 AGGAAGCCGGTGAAGGAAGCTGG + Intergenic
1166352767 19:42207944-42207966 TAGAACAAGCTCAAGGAAGCTGG - Intronic
1167221728 19:48203819-48203841 AGGAACAAGGTTAAGGAAGCTGG - Intronic
1167402166 19:49280088-49280110 GGGAACTAGGTTCAGGAAGAAGG + Intergenic
926956745 2:18310068-18310090 AGGAAGAAGGCTTATGAAGCTGG + Intronic
927351027 2:22115021-22115043 AGGAACAAACTTAATGAAGAAGG + Intergenic
928921838 2:36534711-36534733 AGGAAGAAGGAAAAGGAAGATGG + Intronic
928946990 2:36780430-36780452 AGTAATAAGGCTAAAGAAGCAGG + Intronic
930219744 2:48734535-48734557 AGGAAGAAAGGTAAGCAAGCAGG - Intronic
930573450 2:53115430-53115452 AGAAACAAAGATAAGGAAGTCGG + Intergenic
932550017 2:72759317-72759339 AGTAACAAGGTTAAAGGAGATGG - Intronic
934182476 2:89638769-89638791 ACGAACAAGGGTGAGGGAGCAGG - Intergenic
935301882 2:101699526-101699548 CGGTACAAGGTTAGGGAAGCAGG + Intronic
935560051 2:104550242-104550264 AGGAACAAGGTATTGGAAACCGG - Intergenic
936944042 2:117914682-117914704 TGGAACAAGAATATGGAAGCAGG + Intergenic
937802042 2:126091613-126091635 AGGAACAAGGTATTGGAACCTGG + Intergenic
938068607 2:128294833-128294855 AGGAAGGAGTTTCAGGAAGCAGG - Intronic
939243097 2:139587667-139587689 AGGATCACAGTTAAGGAATCGGG - Intergenic
940920078 2:159296364-159296386 AAGAACAAGCTGCAGGAAGCTGG - Intergenic
941590572 2:167415744-167415766 AGGAACAAGGTATTGGAAACTGG + Intergenic
941831847 2:169970210-169970232 AGGAACAAGTTTAACCAAGGAGG - Intronic
942018779 2:171845397-171845419 ATGAACAAAGTTAAGAAAGCAGG + Intronic
942835274 2:180288300-180288322 AGGTTTAAGGTTAAGGAAGCTGG - Intergenic
944269995 2:197771625-197771647 AGGAAAGAGGGTAAGGAAGTGGG + Intronic
946337984 2:219050987-219051009 AGGTTCAAGGTCAAGGATGCTGG + Intergenic
946660516 2:221994059-221994081 AGGAAAAAGATAATGGAAGCTGG + Intergenic
946887417 2:224236406-224236428 AGAAACAAGGTTAAGGATGATGG - Intergenic
946941170 2:224771625-224771647 AGGAAAAAGGTAAAAGAAGAAGG + Intronic
947343044 2:229159996-229160018 AGGAACAGGATGAAGGAAGAGGG + Intronic
948564376 2:238874437-238874459 AAGAAAAATGTTAAGGATGCAGG + Intronic
1170224103 20:13972344-13972366 AGGAATAAATTTAATGAAGCTGG - Intronic
1170749543 20:19133320-19133342 AGGAAGAAGTTTAAGGAACTGGG + Intergenic
1170767391 20:19301951-19301973 AGGGACAAAGTAAAGGAACCGGG + Intronic
1172638789 20:36428475-36428497 GGGAACAAGGTTGGAGAAGCTGG + Intronic
1173278419 20:41604761-41604783 GGGAAGAAGGCTCAGGAAGCTGG + Intronic
1174046193 20:47735650-47735672 AGGAACAAGGTATAGGAACGAGG + Intronic
1174986641 20:55461491-55461513 AACAACAAGGTAAAGGAAGGGGG + Intergenic
1175171858 20:57086371-57086393 TGGAACAAGGTCATGGCAGCAGG - Intergenic
1175281397 20:57806467-57806489 AGGAACAAGTTTTAGAAAGATGG - Intergenic
1177538420 21:22460080-22460102 AGGAAAAAGGAAAAGGAAGCAGG + Intergenic
1177609743 21:23431444-23431466 AGGAACAAGGTATTGGAAACTGG + Intergenic
1178406648 21:32329631-32329653 AGGAATAAGGTTAAGAAAATAGG + Intronic
1178700231 21:34827116-34827138 AGGAACAAGGTATTGGAAACTGG + Intronic
1179998544 21:44984942-44984964 AGGGACAGGGTTCAGGCAGCGGG - Intergenic
1181951749 22:26558723-26558745 AGGAACAGGGTGAGGCAAGCAGG + Intronic
1182165682 22:28170704-28170726 AGGAACAAAGATAAGAGAGCAGG - Intronic
949520487 3:4848616-4848638 AGGCACAATGTGAAGGAAGCAGG - Intronic
949823123 3:8137068-8137090 AGTATGAACGTTAAGGAAGCAGG + Intergenic
950884938 3:16354969-16354991 AGGAACAAGGTATTGGAAACTGG - Intronic
951221889 3:20077391-20077413 AGCAAAAAGGTTAAGGAACTTGG - Intronic
953072495 3:39535610-39535632 AGGAACAAGGTTGAAGAAAAAGG - Intergenic
953387770 3:42516368-42516390 AGGGACATGGTCAGGGAAGCAGG - Intronic
953458113 3:43060260-43060282 AGGGACAAAAATAAGGAAGCTGG - Intergenic
953604746 3:44404433-44404455 CAGAAAAAGGCTAAGGAAGCAGG - Intronic
954428882 3:50458723-50458745 AGGAACAACATTTTGGAAGCTGG + Intronic
954683362 3:52357868-52357890 GGGAACAGGGGTGAGGAAGCGGG - Intronic
955989344 3:64609558-64609580 AGGAACAAGCTTAAACAAGGAGG + Intronic
956776260 3:72567997-72568019 AGGAACAGGGTTTAGGAGGTGGG + Intergenic
960399023 3:117173057-117173079 AGGAACAAGTAGAAGGAAGTTGG - Intergenic
960583418 3:119299536-119299558 AAGAACAAGGATAAGGCAACGGG + Intronic
960667215 3:120121822-120121844 AGGAACAAAGATAAAGATGCAGG + Intergenic
961878634 3:130043797-130043819 GGGCACAGGGGTAAGGAAGCTGG - Intergenic
962266350 3:133947158-133947180 AAGAATAGAGTTAAGGAAGCAGG + Intronic
962581535 3:136802147-136802169 AGGAACCAGGTTAGGGTACCAGG - Intergenic
963040273 3:141065210-141065232 AGGAGGAAGGATAAGGGAGCCGG - Intronic
963931462 3:151008340-151008362 AAGAACAAAGTCAAGGAGGCAGG - Intergenic
963998384 3:151738412-151738434 AGGAAAAATGTAAAGGCAGCTGG - Intronic
964520435 3:157561149-157561171 AGGAACAAGGTGAGGAAATCTGG - Intronic
965403253 3:168239052-168239074 AGGAAGAAGGTTTAGGAAGTGGG - Intergenic
967311462 3:188110288-188110310 AGGAACAGAGATAAGGAAGGTGG + Intergenic
967619170 3:191611382-191611404 AGGAACATGGGTAAGGAGGTAGG + Intergenic
968059295 3:195714808-195714830 AGGAACAAGGTTAGGAAAAGGGG + Intergenic
969727482 4:8930395-8930417 AGGAACCAGGAAAAGGAACCAGG + Intergenic
969824476 4:9746678-9746700 GGGCACAGGGGTAAGGAAGCTGG + Intergenic
970279026 4:14433762-14433784 AGGAACAAGAATAAGAAAACAGG - Intergenic
971158613 4:24109776-24109798 AGGAACAAGTTCAAGGATGAGGG + Intergenic
971717706 4:30200797-30200819 AGGAATAAATTTAATGAAGCAGG - Intergenic
972389289 4:38598196-38598218 TATAAGAAGGTTAAGGAAGCTGG + Intergenic
972408457 4:38768009-38768031 AGGATTATGGTTAGGGAAGCTGG - Intergenic
972925456 4:44000471-44000493 AGGAACAAAGTAAAGACAGCTGG + Intergenic
973177074 4:47220355-47220377 TGGAACAGGGAGAAGGAAGCAGG - Intronic
975954491 4:79821429-79821451 AGGAACAAGGTTTTGGAAATTGG - Intergenic
977617532 4:99102968-99102990 AGGTACAAGGATAAGGAAAATGG + Intergenic
977712608 4:100144970-100144992 AGGAACAAGGTATTGGAAACTGG + Intergenic
978057760 4:104293652-104293674 AGCAACAAGGTAAAGGAAGGAGG - Intergenic
978557235 4:109993841-109993863 GGGAAGAAGATTCAGGAAGCAGG - Intronic
980317715 4:131224580-131224602 AGAAACAATGTTAATGAAGAAGG - Intergenic
980453291 4:133005548-133005570 AGGTGGAAGGATAAGGAAGCAGG + Intergenic
980768275 4:137336548-137336570 AGAAACAAAATTAAGGAAACAGG - Intergenic
981245578 4:142533642-142533664 AGGAACAAAGTTAGTGAATCAGG + Intronic
981437597 4:144744512-144744534 AGGTACAAGTTTAAGGGAGCAGG + Exonic
981601186 4:146490887-146490909 AGGAAAAGGGTTTGGGAAGCTGG - Intronic
981648172 4:147023696-147023718 AAGAAGAAGGTTAAGAAAGAAGG - Intergenic
982287170 4:153747507-153747529 AGGAACAAGGTATCGGAAGCTGG - Intronic
982304174 4:153912071-153912093 AGGAATAAGGTAAAGGAATAAGG - Intergenic
982411577 4:155083915-155083937 AGAAATAAGGTCAATGAAGCAGG + Intergenic
983646161 4:169993612-169993634 AGGAACTTTCTTAAGGAAGCGGG + Intronic
984318284 4:178157458-178157480 AGGAACAAGGTGAAAGATGAGGG + Intergenic
984738323 4:183133072-183133094 AGGAAAAAGGTAAGGGAAGAGGG - Intronic
985958433 5:3281748-3281770 GGGAAGAAGGAAAAGGAAGCAGG + Intergenic
986522367 5:8633365-8633387 AGGAAGAAGGGGAAGGAAGTGGG - Intergenic
987330893 5:16856708-16856730 AGGGACGAGGGTAAGGAAGCAGG + Intronic
987778122 5:22395968-22395990 AGGAAGAAGGCTAAGGCAGGAGG - Intronic
987811419 5:22840960-22840982 AAGAACAAGGGGAAGGATGCAGG + Intronic
989000494 5:36755399-36755421 AGGAACAAGTCAAAGGCAGCTGG + Intergenic
989019723 5:36989168-36989190 ATTAACAATGTTTAGGAAGCAGG - Intronic
989671463 5:43922600-43922622 AGGAGCAAAGTTAAGGAATAGGG - Intergenic
990382157 5:55228633-55228655 AGGAACAAGTTGTGGGAAGCTGG - Intergenic
992190737 5:74289259-74289281 AGGAAAAATGTTGAGGAAGGTGG - Intergenic
992845360 5:80741509-80741531 TGGAACAACATTAAGGAATCTGG + Exonic
994915701 5:105975920-105975942 AGGGAAAAGGTTGAGGAAGGTGG - Intergenic
996540561 5:124626782-124626804 AAAAACAAGGTTTAGGGAGCTGG - Intergenic
996760756 5:126983860-126983882 ATGAAAAAGATGAAGGAAGCTGG - Intronic
996965600 5:129304415-129304437 AGGAACAAGGTAGGGGAAGGGGG + Intergenic
997741605 5:136259829-136259851 AGGAGCAAGGCTGAGGAAGGAGG - Intronic
998083854 5:139299936-139299958 GGGAAACAGGTTAAGGATGCAGG + Intronic
998677525 5:144426257-144426279 AGGAACAAGGTATTGGAAACTGG - Intronic
998880299 5:146638437-146638459 AGGAACCAGGAGAAGGAGGCAGG + Intronic
1000603888 5:163307521-163307543 AGTCAGAAGGTTAAGGAAGAAGG - Intergenic
1001877834 5:175216610-175216632 AGGAAAAAGTTAAAGGAAGGAGG - Intergenic
1003931826 6:10931274-10931296 AGGAACAAGGTTGAATAATCAGG + Intronic
1004564957 6:16787607-16787629 AGGAACACTGTTAAAGAAGGGGG + Intergenic
1006305231 6:33214547-33214569 AGGAACAGGGTAGAGGAAGGAGG + Intergenic
1007079457 6:39088596-39088618 ACTAACAAGTTTGAGGAAGCTGG - Intergenic
1009848927 6:69171408-69171430 AAGAACAAGGGTATGGAAGTTGG - Intronic
1011515646 6:88149656-88149678 AGGGACAAGGTGAAGGAGGAAGG - Intronic
1012470423 6:99567833-99567855 ATGAAAAAGGTTAAAGAAACAGG + Intronic
1012832656 6:104225083-104225105 AGGGAGAAGGTTAGGGAAGGTGG + Intergenic
1012995270 6:105966656-105966678 AGCAACATGGTTAAGGACCCAGG + Intergenic
1013563146 6:111327012-111327034 AAGACCAGGGTCAAGGAAGCAGG + Intronic
1013669995 6:112390588-112390610 AGCAACAGAGTTAAGGATGCTGG + Intergenic
1013732911 6:113190165-113190187 AGGAAGAAGGCTGAGGAAGATGG - Intergenic
1014404229 6:121028571-121028593 AGGAACAAGTTTAACCAAGGAGG + Intergenic
1014778832 6:125540418-125540440 AGGACCAAGGTGGAGGCAGCAGG - Intergenic
1015808551 6:137138143-137138165 AGGAACAAAGTTAACCAAGGTGG + Intergenic
1019331229 7:461834-461856 AGGCCCAAGGGTGAGGAAGCGGG + Intergenic
1020313689 7:6888782-6888804 GGGCACAGGGGTAAGGAAGCTGG - Intergenic
1020903095 7:14030297-14030319 AAGAACAAGGTGGAGGGAGCTGG + Intergenic
1022436417 7:30390124-30390146 TAGAACAAGGTAAAGGAAACAGG - Intronic
1022489529 7:30805821-30805843 AAGAAGAAGGTTAAGGAATAGGG + Intronic
1022806685 7:33829572-33829594 AGGAAAAAGGAGAAGGAAACAGG - Intergenic
1023693434 7:42818642-42818664 AGGAAGAAGGAGAAGGAAGGAGG + Intergenic
1029871367 7:103696546-103696568 AGGGACAAGGTATAGGCAGCTGG - Intronic
1031526340 7:122825566-122825588 AAGAACAAGGTAAAGGAAACAGG + Intronic
1031935152 7:127728509-127728531 AAGAACTAGGTCAAGGAAGAGGG - Intronic
1032061732 7:128730435-128730457 AGGAAGTAGGTTAAGGGGGCTGG + Intronic
1032273297 7:130431506-130431528 AGGAACAAGGAAAGGGAAGGAGG + Intronic
1033832016 7:145266378-145266400 AGGAACAAGGTATTGGAAACTGG + Intergenic
1034857305 7:154563699-154563721 AGGAAAAAGGTTACAGGAGCTGG + Intronic
1037791193 8:21944148-21944170 AGGAACAAGGTTTAGGGCCCAGG + Intronic
1038139884 8:24832984-24833006 AGCAACAAGGTCAAGAAAACTGG + Intergenic
1038709884 8:29933725-29933747 AGCAACCAGGGTAAGGAATCAGG - Intergenic
1039296638 8:36163412-36163434 AGGCACAGGTTTGAGGAAGCAGG - Intergenic
1039738430 8:40357256-40357278 AGGCACAAGATTGAGGAACCTGG - Intergenic
1040710774 8:50186142-50186164 AGGGACATGGTTCAAGAAGCTGG - Intronic
1040820806 8:51554728-51554750 AGGAACAAGGTAATGGAAACTGG - Intronic
1042311061 8:67379859-67379881 AAGAACAAGGAGAAGGAAGAAGG - Intergenic
1043277882 8:78423149-78423171 AGGAATAAATTTAAGGAAGAAGG - Intergenic
1043558911 8:81467779-81467801 AGGAACAAGTTTAAGGGAGAGGG + Intergenic
1044569919 8:93706031-93706053 AGTAACAACCTTAAGGAAGCAGG - Intronic
1044642305 8:94396080-94396102 AGGAAAAAGAGTAAGGAAGGGGG + Intronic
1045930511 8:107620450-107620472 AGGAGCAAGGGCAAGGATGCGGG - Intergenic
1046111290 8:109729151-109729173 AGGACCTAGGTGAAGGAAGCAGG + Intergenic
1046676187 8:117111304-117111326 AGGAACTGGGTTTTGGAAGCAGG + Intronic
1047461582 8:125070814-125070836 AGGATAAAGGTTTAAGAAGCTGG + Intronic
1048387915 8:133930527-133930549 AGTAATGAGGTGAAGGAAGCAGG + Intergenic
1050173979 9:2851134-2851156 AGGAACCAGGGGAAAGAAGCAGG - Intergenic
1051187901 9:14479974-14479996 AGGAAGAAGGAGAAGGAGGCAGG + Intergenic
1051431740 9:16986343-16986365 AGGAAAAAGGATAATCAAGCGGG + Intergenic
1051520042 9:17976440-17976462 AGGAACAAATTTAAGCAAGGAGG - Intergenic
1053099562 9:35359826-35359848 AGGGACAAGGTTCTAGAAGCAGG - Intronic
1055418809 9:76114013-76114035 AGTTACAAGGGTAAAGAAGCAGG + Intronic
1056159689 9:83876340-83876362 AGGAACAAGTTTAAGTAAAGAGG + Intronic
1056350889 9:85747588-85747610 AGGAACAAGTTTAAGTAAAGAGG - Intergenic
1057108604 9:92445313-92445335 AGGCTCAAGGGGAAGGAAGCTGG - Intronic
1057750660 9:97790190-97790212 AGGAACAAGGAGAGCGAAGCAGG + Intergenic
1058122886 9:101158042-101158064 AAAAACAAGCTTAAGGAAGATGG + Intronic
1058263950 9:102874190-102874212 AGCAAGAAGTATAAGGAAGCAGG + Intergenic
1059135425 9:111802276-111802298 AAGAAGAAGGTTAAAGAAGGTGG - Intergenic
1059730297 9:117050476-117050498 AGGAACATTGTCATGGAAGCTGG - Intronic
1059761247 9:117339754-117339776 AGGAAGAAGGTGAAGGAAGAAGG + Intronic
1060732346 9:126046714-126046736 AGGAAGAAGGGGAAGGAAGAGGG - Intergenic
1187019761 X:15368792-15368814 AGGAAGAAAGTGAATGAAGCAGG + Intronic
1187100858 X:16189881-16189903 TGGAGGAAGGTTCAGGAAGCAGG + Intergenic
1187605259 X:20875265-20875287 AGGGACCTGCTTAAGGAAGCAGG - Intergenic
1187957156 X:24530604-24530626 ATGAACAAGGTTAAGGAAGGAGG - Intronic
1188029050 X:25243940-25243962 AGGAACAAAGTTAAGAAAATGGG - Intergenic
1188938200 X:36203477-36203499 AGGAAAAAGCTAAAGGAAGAAGG - Intergenic
1189277932 X:39800503-39800525 AGGATCGTGGTTAAGGAGGCAGG + Intergenic
1189553341 X:42115541-42115563 TGGGACAAGCTAAAGGAAGCTGG + Intergenic
1189716139 X:43868472-43868494 AGGAACAAGGGGAGAGAAGCAGG + Intronic
1190016685 X:46833646-46833668 AGGAACAAACTTAAGGCAGGAGG + Intergenic
1191625670 X:63268450-63268472 TGAAACAAGGTAAAGGAATCAGG - Intergenic
1192317408 X:70063531-70063553 AGCAGCAAGGTTAGGAAAGCGGG - Exonic
1193762702 X:85487689-85487711 AGAAAAAATGTTAAGGCAGCTGG - Intergenic
1194695790 X:97048193-97048215 GGGAAGAGGGTTAAGGAAGAGGG - Intronic
1200176133 X:154117517-154117539 AGGAACAAGGTTTGGAGAGCCGG - Intergenic
1200385178 X:155883097-155883119 AGGTATAAAGTTAAGGAAGAAGG - Intronic