ID: 1167227408

View in Genome Browser
Species Human (GRCh38)
Location 19:48255964-48255986
Sequence TTGACTGCCCACAGCCATCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 135}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167227408_1167227416 20 Left 1167227408 19:48255964-48255986 CCATGATGGCTGTGGGCAGTCAA 0: 1
1: 0
2: 2
3: 9
4: 135
Right 1167227416 19:48256007-48256029 GGGCCATCTTTAATGTGGGCAGG 0: 1
1: 0
2: 1
3: 13
4: 114
1167227408_1167227413 0 Left 1167227408 19:48255964-48255986 CCATGATGGCTGTGGGCAGTCAA 0: 1
1: 0
2: 2
3: 9
4: 135
Right 1167227413 19:48255987-48256009 TGGGGTCAGTGCAAGCATCTGGG 0: 1
1: 0
2: 0
3: 19
4: 173
1167227408_1167227412 -1 Left 1167227408 19:48255964-48255986 CCATGATGGCTGTGGGCAGTCAA 0: 1
1: 0
2: 2
3: 9
4: 135
Right 1167227412 19:48255986-48256008 ATGGGGTCAGTGCAAGCATCTGG 0: 1
1: 0
2: 1
3: 14
4: 138
1167227408_1167227415 16 Left 1167227408 19:48255964-48255986 CCATGATGGCTGTGGGCAGTCAA 0: 1
1: 0
2: 2
3: 9
4: 135
Right 1167227415 19:48256003-48256025 ATCTGGGCCATCTTTAATGTGGG 0: 1
1: 0
2: 1
3: 8
4: 107
1167227408_1167227414 15 Left 1167227408 19:48255964-48255986 CCATGATGGCTGTGGGCAGTCAA 0: 1
1: 0
2: 2
3: 9
4: 135
Right 1167227414 19:48256002-48256024 CATCTGGGCCATCTTTAATGTGG 0: 1
1: 0
2: 0
3: 11
4: 116

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167227408 Original CRISPR TTGACTGCCCACAGCCATCA TGG (reversed) Intronic
900550984 1:3255439-3255461 TTGACAGCTCAGTGCCATCATGG - Intronic
903691371 1:25176063-25176085 TCACCTGCCCACAGCCATCTGGG - Intergenic
905801176 1:40843955-40843977 TTGTCTCCCCACTGCTATCATGG - Intergenic
905974779 1:42166206-42166228 TTGGCTACACACACCCATCAGGG - Intergenic
908038620 1:60083364-60083386 TTGTCTTGCCACAGGCATCATGG - Intergenic
909060561 1:70874343-70874365 TTGAGTGCCCACAGACAGCATGG - Intronic
909692233 1:78421550-78421572 TTGAATGCCAAAATCCATCAGGG - Intronic
910448318 1:87321021-87321043 TTGCCATCCCACAACCATCAGGG + Intergenic
918093566 1:181317157-181317179 TTAACTGCCCACAGGAAACAGGG + Intergenic
918366681 1:183815467-183815489 TTTAGGGCCCAGAGCCATCAAGG + Intronic
921116684 1:212098700-212098722 GTGACAGACCACAGCCAGCAAGG + Intronic
922192112 1:223328545-223328567 CTGACTGCCCACACCATTCAAGG + Intronic
923567059 1:235084117-235084139 TTGACTGTCCGTATCCATCAAGG - Intergenic
1062857538 10:786760-786782 ATCACTGCCCACTGCCCTCAGGG + Intergenic
1064493700 10:15885968-15885990 TTGACTGCATACAGCAAGCAAGG - Intergenic
1065677813 10:28197012-28197034 TTGGCTGCCCACAGCCTTCCTGG + Intronic
1066214060 10:33268430-33268452 TTGACTTCCCACATCCAATACGG - Intronic
1067837100 10:49648277-49648299 TTCACTGCCCACAGCTTTTACGG + Intronic
1068387459 10:56350723-56350745 TTGAATCCCTATAGCCATCAGGG + Intergenic
1068461254 10:57332452-57332474 TTGACTGTACATAGACATCAAGG - Intergenic
1069769966 10:70892104-70892126 ATTTCTGCCCACAGACATCATGG - Intergenic
1072759662 10:98045966-98045988 TTGGCTGCCCTCAGCCAGCAGGG - Intergenic
1073510190 10:104037986-104038008 TTGCTGGCCCACAGCCCTCATGG - Intronic
1075997435 10:126890009-126890031 TTGACTCCCCAGACCCACCAGGG + Intergenic
1076458826 10:130624128-130624150 TTGACTCCCCAGAGCCCTCTCGG + Intergenic
1076469007 10:130705640-130705662 GTCACTGCCCACAGCCACCCAGG + Intergenic
1080246920 11:30189618-30189640 TTCACTGCCCTCAACCATCCAGG + Intergenic
1081736194 11:45406099-45406121 TTCACTGCCCCCAGCTATGAGGG + Intergenic
1081753859 11:45531045-45531067 CTCCCTGCCCACAGCCATCCTGG - Intergenic
1089053358 11:115564942-115564964 TTGACTTCCCCCTGCCCTCAGGG - Intergenic
1089774258 11:120825374-120825396 TTGAATCCCCTCAGCCATCCCGG - Intronic
1093116438 12:15217486-15217508 TTGTCTACCAACACCCATCATGG - Exonic
1093755065 12:22843003-22843025 TTCACTGCCAATAGCCTTCAAGG + Intergenic
1094090680 12:26645592-26645614 TTGAATGCCCAGAGGCAGCATGG + Intronic
1094183419 12:27615822-27615844 GTGACTGCCCTCAGCCATCCTGG + Intronic
1094720645 12:33059571-33059593 TTGCCTGCCTCCAGCCATCCAGG - Intergenic
1101897329 12:108766621-108766643 TTGGCTCCCCAGAGCCCTCAGGG + Intergenic
1102551711 12:113696241-113696263 ATGGCTCCCCACAGCCATCCTGG + Intergenic
1104426985 12:128685933-128685955 TTGACTGGCCACAGTTATCCAGG - Intronic
1104856192 12:131903559-131903581 TTGGATGCCCACAGCCCTGAGGG + Intronic
1105707552 13:22977468-22977490 TTGCTTGCCAGCAGCCATCAAGG - Intergenic
1106179309 13:27357417-27357439 TTTACTGCCCACAGCCTTGAAGG - Intergenic
1108475695 13:50814600-50814622 TTGATTCCCCACAGCCATGTTGG - Intronic
1110410753 13:75201707-75201729 TAGATTTCCCACAGCCATCTTGG + Intergenic
1111111920 13:83722623-83722645 TTGCCTGCCAGCAGCCATTACGG - Intergenic
1112065947 13:95793279-95793301 AAAACTGCCGACAGCCATCAAGG - Exonic
1112595765 13:100805716-100805738 TTCACTGCCCACAACCACCCTGG + Intergenic
1113676884 13:112213881-112213903 TTGCCTGGCCACAGCCAGCCAGG + Intergenic
1117348346 14:54856227-54856249 CTGCCAGGCCACAGCCATCATGG + Intronic
1119113692 14:71998596-71998618 TTGACTGTTCACTGCTATCAAGG - Intronic
1124911352 15:33924178-33924200 TTGAGTGCCTAAAGCAATCAAGG + Intronic
1129165587 15:73775400-73775422 CGCACTGCCCACAGCCCTCAGGG - Intergenic
1132154183 15:99484105-99484127 TAGACAGCCCTCAGCCTTCATGG - Intergenic
1133655910 16:7863519-7863541 TTGACTGCAAATAGGCATCAGGG + Intergenic
1138831097 16:60375354-60375376 TTGACTATCCACTGCCTTCACGG - Intergenic
1139969578 16:70765429-70765451 TTCACTTTTCACAGCCATCATGG - Intronic
1142954128 17:3509152-3509174 TTGACAGCCAACAGCCATGATGG + Intronic
1143456993 17:7074690-7074712 TGGACTGCCCAGAGGCATGAGGG + Exonic
1144108352 17:12007547-12007569 CTGACTGCCCAAAGTCAGCAGGG - Intergenic
1150034310 17:61777481-61777503 GTGACTGGCCACAGAAATCAGGG - Intronic
1153602369 18:6793766-6793788 TTGACTACCCTTAGCCTTCACGG - Intronic
1157084877 18:44569640-44569662 TTGGCTGACTAAAGCCATCAGGG - Intergenic
1159609121 18:70507142-70507164 TTGGCTACCTACAGCCACCATGG - Intergenic
1162932795 19:13965737-13965759 GCGACTGCCCAAAGCCATCCTGG - Exonic
1163314885 19:16535154-16535176 CTGCCTGGCCACAGCCATTAGGG + Intronic
1165884650 19:39069314-39069336 TTGACTGGCCACAGAATTCAGGG - Intergenic
1166116929 19:40662202-40662224 GTGACAGCCTAGAGCCATCACGG + Intergenic
1167226776 19:48249557-48249579 TTTACCGCCCACAGCCATCATGG + Intronic
1167227408 19:48255964-48255986 TTGACTGCCCACAGCCATCATGG - Intronic
1168349280 19:55666856-55666878 GTGACTCCCCACAGGCAGCATGG - Intronic
1168351450 19:55678464-55678486 TGGCCTGCCCAGAGCCCTCAGGG - Intronic
1168514393 19:56999001-56999023 TTTACTGCCCATTGCCAACATGG + Intergenic
927785617 2:25972424-25972446 TTAACTGACCACACCCACCAGGG + Intronic
932469108 2:71942371-71942393 TTGACTGCCCACTTCCACCCAGG - Intergenic
934300998 2:91776015-91776037 CTGACTGCCCTCAGCCTCCAAGG + Intergenic
934580257 2:95432152-95432174 TTGACTGCCCACAGGTAACCAGG - Intergenic
934599189 2:95644562-95644584 TTGACTGCCCACAGGTAACCAGG + Intergenic
936532540 2:113286560-113286582 TTGACTGCCCACAGGTAACCAGG + Intergenic
937086391 2:119174640-119174662 ATAACTGCCCACGGCCACCAGGG - Intergenic
938405384 2:131030031-131030053 CTGACTGCACACACCCAGCAGGG + Intronic
938949357 2:136242810-136242832 TTCACAGTCCACAGCCATCTCGG - Intergenic
939958353 2:148545482-148545504 TTGAGTGTCCAGAGCCACCAGGG + Intergenic
941031339 2:160515319-160515341 ATGACTGCCCACACTCAACATGG - Intergenic
942063234 2:172247428-172247450 TTGCCAGGCCACAGCCATCAGGG + Intergenic
943502386 2:188708197-188708219 TTTACTGCCCTCAGACAGCATGG + Intergenic
1170750634 20:19141655-19141677 TTGACAGCCCACAGAGCTCAAGG - Intergenic
1171135098 20:22688520-22688542 TTGTGTGCCCACAGCCCTCCAGG + Intergenic
1171164492 20:22958057-22958079 TTGCCTGCCCACACCCAGTAGGG - Intergenic
1173706635 20:45115030-45115052 CTGACTCCCCACAGCCAGGAGGG + Exonic
1174197856 20:48786103-48786125 TTCTCTGCCCAGAGCCATCCTGG - Intronic
1176297749 21:5083210-5083232 GTGACTGCGCACAGGCATCCTGG - Intergenic
1179859280 21:44178739-44178761 GTGACTGCGCACAGGCATCCTGG + Intergenic
1180055053 21:45353422-45353444 TGGGCGTCCCACAGCCATCATGG - Intergenic
1180971077 22:19816056-19816078 CCGACAGCCCACAGCCATCCTGG + Intronic
1180983202 22:19889068-19889090 GTGACTGCCAGCAGCCACCAGGG + Intronic
1183354425 22:37350739-37350761 GTGGCTGCCCACAGCCAGCGTGG - Intergenic
1183937727 22:41273171-41273193 TTGCCTGCTCACAGCAACCAGGG - Intronic
1184098781 22:42330704-42330726 ATGGGTGCCCACAGCCCTCAAGG - Intronic
950944681 3:16932839-16932861 TTGACTTGGAACAGCCATCATGG - Intronic
952974159 3:38679971-38679993 CTGAGTGCCCACAGTCACCATGG - Intergenic
953000186 3:38925049-38925071 GTGACTTCCCATAGCCCTCATGG + Intronic
953847967 3:46443876-46443898 TCTGCTGCACACAGCCATCACGG - Intronic
953906605 3:46871602-46871624 TGGTCTCCCCACAGCCCTCAAGG - Intronic
954262501 3:49449671-49449693 AAGACTGCCCACAGCCTTCAAGG + Intergenic
956955270 3:74331289-74331311 TAAACTGCCCACAGCATTCAGGG + Intronic
957131976 3:76234685-76234707 TAGACTGACCAAAGACATCAAGG - Intronic
960962249 3:123080243-123080265 TTGAGTTCCCACAGCCTTCTGGG + Intronic
962386645 3:134937493-134937515 TTGGCTGGCCCCAGCCAGCATGG + Intronic
980410144 4:132406479-132406501 TTGACTGCCCACATCCTTATTGG - Intergenic
980514222 4:133832949-133832971 TTGACTGCTCACAGGTTTCACGG - Intergenic
985521487 5:375939-375961 GTGACTGCGCACAGCCCCCAAGG - Intronic
985622995 5:965582-965604 TTGGTGGCCGACAGCCATCACGG + Intergenic
990676881 5:58196654-58196676 TTTACTGCCCACACCCATGTTGG + Intergenic
997490026 5:134267393-134267415 CTGCCTGACCGCAGCCATCATGG + Intergenic
998185996 5:139980561-139980583 TTTCCTGCCCCCAGCCTTCAAGG - Intronic
998581612 5:143382934-143382956 TCTACTGCCCACAGTCATCCTGG + Intronic
999853976 5:155573303-155573325 TTAACTCCCCACACCAATCATGG + Intergenic
1001184915 5:169561102-169561124 TTGGCTGCCCTCAGCCCTCTTGG - Intergenic
1001542218 5:172547646-172547668 TGAACTGCCCACAGTCGTCAGGG + Intergenic
1001709715 5:173768470-173768492 ATGGATGCCCACTGCCATCACGG - Intergenic
1003065805 6:2902985-2903007 TTGGCGGCCCACAGCCACCGCGG - Intronic
1003324726 6:5083727-5083749 TTGCCTGCCCTCTGCCAACATGG + Intergenic
1004732692 6:18373663-18373685 TTGGCTGTCCTCAGCCACCAGGG - Intergenic
1006363307 6:33599609-33599631 GTGGCTGCTCACTGCCATCAGGG - Intergenic
1007130794 6:39471557-39471579 TAGACAGCCTGCAGCCATCATGG - Intronic
1007658353 6:43466692-43466714 ATGAATGCCCTCAGACATCAAGG + Intergenic
1008805590 6:55423306-55423328 TTTATTGCCCAGATCCATCAGGG + Intergenic
1009044735 6:58224954-58224976 TTCAATGCCAATAGCCATCAGGG + Intergenic
1015119180 6:129682674-129682696 TTGACTGTCCACAGCCTGCCTGG + Intronic
1018002409 6:159591313-159591335 GGAACTGCCCACAACCATCAGGG + Intergenic
1027580386 7:79987185-79987207 TTAACTGCCCACGTCCTTCAGGG - Intergenic
1031174433 7:118331998-118332020 ATGACTGCCCACATCGATGATGG - Intergenic
1032080780 7:128857421-128857443 TAGTCTGCCCCCAGACATCATGG + Intronic
1032091473 7:128913739-128913761 TAGTCTGCCCCCAGACATCATGG - Intergenic
1035679336 8:1476699-1476721 CTGACAGCACTCAGCCATCAAGG - Intergenic
1035679387 8:1476908-1476930 CTGACAGCACTCAGCCATCACGG - Intergenic
1035810706 8:2488777-2488799 CTGACTGCCCAAACCCAGCAAGG - Intergenic
1037540044 8:19862257-19862279 TTCATTGCCCACAGCCACCTCGG + Intergenic
1039789077 8:40859752-40859774 TTGGCTGCTCATAGTCATCAAGG - Intronic
1041202108 8:55460285-55460307 TTGACTGCAAACAGGCATGAGGG + Intronic
1042965621 8:74348863-74348885 TTGAATTCCCACAGCCATCTGGG + Intronic
1049282412 8:141756873-141756895 TTGTCTGCCCAAGGCCATCTTGG + Intergenic
1050033553 9:1411727-1411749 TTGACTACCCACAGCAAGAAGGG - Intergenic
1057414831 9:94851906-94851928 TTGACTGCACACTGGAATCACGG - Intronic
1062226469 9:135455283-135455305 TCGAGGGCCCACAGCCAGCATGG - Intergenic
1193940901 X:87680006-87680028 TTCACTGCCCAGAGCCACCTTGG - Intergenic
1197599230 X:128508108-128508130 TTGACTGCCCAGAGCCATCTTGG + Intergenic