ID: 1167228739

View in Genome Browser
Species Human (GRCh38)
Location 19:48267993-48268015
Sequence GTAAAATGTATGGCTGGGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1243
Summary {0: 1, 1: 1, 2: 21, 3: 135, 4: 1085}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167228739_1167228745 22 Left 1167228739 19:48267993-48268015 CCATGCCCAGCCATACATTTTAC 0: 1
1: 1
2: 21
3: 135
4: 1085
Right 1167228745 19:48268038-48268060 AATACTTTTCAGACTTTAAAAGG 0: 1
1: 1
2: 28
3: 283
4: 2295
1167228739_1167228743 -1 Left 1167228739 19:48267993-48268015 CCATGCCCAGCCATACATTTTAC 0: 1
1: 1
2: 21
3: 135
4: 1085
Right 1167228743 19:48268015-48268037 CTTTTGAACACTACATACCGTGG 0: 1
1: 0
2: 0
3: 1
4: 51

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167228739 Original CRISPR GTAAAATGTATGGCTGGGCA TGG (reversed) Intronic
901300908 1:8199620-8199642 GCAAAGGGTCTGGCTGGGCACGG + Intergenic
901419933 1:9144039-9144061 TTAAAAAGTATGGCCGGGCACGG - Intergenic
901524860 1:9814117-9814139 GAAAAATGTTAGGCTGAGCATGG + Intronic
902049963 1:13555286-13555308 GAAGAAATTATGGCTGGGCACGG + Intergenic
902439399 1:16419647-16419669 GCAAGGTCTATGGCTGGGCATGG + Intronic
902582753 1:17419062-17419084 TTAAATGGCATGGCTGGGCACGG + Intronic
902753525 1:18534107-18534129 AAAAAATATTTGGCTGGGCACGG + Intergenic
902971151 1:20051920-20051942 TAAAAATCTATGGCTGGGCTTGG + Intronic
902994594 1:20213902-20213924 TTAGAATGTTTGGCTGGGCGTGG + Intergenic
903054197 1:20623896-20623918 TTAAATTGTTAGGCTGGGCATGG + Intergenic
903133687 1:21295218-21295240 ATAAAGTGCTTGGCTGGGCATGG + Intronic
903241360 1:21984654-21984676 GTTATAATTATGGCTGGGCATGG + Intronic
903737435 1:25538917-25538939 TTAAAATATGCGGCTGGGCATGG + Intergenic
903772357 1:25771925-25771947 GTAAAATGCCTGGCTGGGAGGGG - Intronic
903866043 1:26398650-26398672 ATAACATTTGTGGCTGGGCACGG - Intergenic
904057632 1:27682307-27682329 GAAAAATGTAAGGCCAGGCATGG - Intergenic
904060546 1:27706755-27706777 GTAAAAGATATCGCTGGGCACGG - Intergenic
904394627 1:30210755-30210777 GTAAAAGGATAGGCTGGGCACGG - Intergenic
904414780 1:30353245-30353267 TCAAAATGTTGGGCTGGGCATGG - Intergenic
904523141 1:31111739-31111761 GTAACAACTGTGGCTGGGCACGG + Intergenic
904636068 1:31882647-31882669 AGAAAATGTATGGCTGGGCGTGG + Intergenic
905058430 1:35119101-35119123 AAAAAATAGATGGCTGGGCATGG + Intergenic
905078050 1:35291923-35291945 GTAACAATCATGGCTGGGCACGG - Intronic
905255969 1:36684764-36684786 GAAAAATGTATGGCCGGGCACGG - Intergenic
905611926 1:39360544-39360566 GTTCAATGTAGGACTGGGCATGG + Intronic
905821493 1:40995687-40995709 AAAAAATTCATGGCTGGGCAAGG - Intronic
906432446 1:45765989-45766011 ATAAAAAGCATGGCCGGGCATGG - Intergenic
906432758 1:45768709-45768731 GTAAAATATGGGGCTGGGCGTGG + Intergenic
906513848 1:46426604-46426626 TTAATATTTATGGCCGGGCACGG - Intergenic
906538662 1:46567828-46567850 TTAAGTTGTTTGGCTGGGCATGG + Intronic
906630669 1:47364605-47364627 TATAAATATATGGCTGGGCATGG - Intronic
906974005 1:50549487-50549509 ACAAAATTTAAGGCTGGGCATGG + Intronic
907377822 1:54058529-54058551 GTAAAATAAAAGGCTTGGCATGG + Intronic
908067921 1:60427497-60427519 TTAAAAAATCTGGCTGGGCACGG + Intergenic
908406962 1:63824036-63824058 GTAAGATTTGGGGCTGGGCACGG - Intronic
908838500 1:68253919-68253941 ATAAAAGGTAAGGCTGAGCATGG + Intergenic
909172154 1:72310964-72310986 TTAAAATTTATGGCCGGGCGCGG + Intergenic
909658442 1:78056184-78056206 GTAAAACTTATGGCTGGGCATGG + Intronic
909822289 1:80081286-80081308 ATAAAATTATTGGCTGGGCATGG + Intergenic
909955785 1:81777478-81777500 TTAAAACATTTGGCTGGGCATGG + Intronic
910225621 1:84933050-84933072 GAAAAATGTAGGGATGGGCCTGG - Intronic
910985870 1:93004034-93004056 TTTAAATTTAGGGCTGGGCATGG - Intergenic
910987756 1:93022946-93022968 GAAAACCCTATGGCTGGGCAAGG + Intergenic
911634916 1:100224724-100224746 ATAAAATCTGAGGCTGGGCATGG + Intronic
911761432 1:101621701-101621723 TGAAAATTTTTGGCTGGGCATGG - Intergenic
912317221 1:108676926-108676948 TATAAATGGATGGCTGGGCATGG + Intergenic
912355317 1:109049940-109049962 CTAAAATTTCTGGCTGAGCATGG - Intergenic
912972307 1:114295103-114295125 GTAAAAAGTCAGCCTGGGCAAGG - Intergenic
913275285 1:117131635-117131657 TTAAAAATTAGGGCTGGGCATGG - Intergenic
913303660 1:117399987-117400009 GTAAAATGTGGGGCTGGGATTGG + Intronic
914257110 1:145969550-145969572 TAAAAATTTTTGGCTGGGCATGG - Intronic
914377722 1:147087267-147087289 ATAAAATTCTTGGCTGGGCATGG + Intergenic
914809438 1:151015953-151015975 GTAAACTGGTGGGCTGGGCATGG + Intronic
914838838 1:151230930-151230952 GTTAATTTTAGGGCTGGGCATGG + Intronic
914867786 1:151447093-151447115 AAAAATTGTATGGCTGGGCGCGG + Intronic
914881226 1:151548589-151548611 GAAAAATGGGAGGCTGGGCACGG - Intronic
915151215 1:153833522-153833544 GTAAGAAATATTGCTGGGCATGG + Intronic
915371014 1:155350624-155350646 GTAATTTGTTTGGCTGGGAATGG + Intronic
915371947 1:155358823-155358845 TTAAAAAATTTGGCTGGGCATGG + Intronic
915374180 1:155377732-155377754 GTAAAAGGATTGGCTGGGCGCGG + Intronic
916236283 1:162592105-162592127 GTAAAATATTGGGCTGGACACGG + Intronic
916688238 1:167167195-167167217 GTTAAATGAATGGATGAGCAGGG - Intergenic
917550366 1:176020395-176020417 TTACACTGTAAGGCTGGGCATGG + Intronic
917807597 1:178627767-178627789 ATAACAAGGATGGCTGGGCATGG + Intergenic
917938883 1:179896398-179896420 TAAAAATGTTTGGCTGGGCATGG - Intronic
918028564 1:180779462-180779484 GTATAATTCAAGGCTGGGCATGG + Intronic
918293540 1:183133204-183133226 TTATAATGTATGGCTTGGCCGGG - Intronic
918555234 1:185791427-185791449 ATAAAAAATTTGGCTGGGCACGG + Intronic
918619586 1:186587486-186587508 ATAATATATTTGGCTGGGCATGG - Intergenic
919213324 1:194517565-194517587 ATAAAATGCATGGCTGGGTGTGG + Intergenic
919259983 1:195179621-195179643 TAAAAATTTTTGGCTGGGCACGG + Intergenic
919552566 1:199010183-199010205 TTAACATTTATGGCTGGGCACGG + Intergenic
919824976 1:201497058-201497080 TTTAAATGCAGGGCTGGGCATGG + Intronic
920108552 1:203571305-203571327 GAAAAAAGAATTGCTGGGCATGG + Intergenic
920281954 1:204850210-204850232 GTAAAATCTCAGGCTGGGAAAGG - Intronic
920319912 1:205112025-205112047 ATAAATTATCTGGCTGGGCATGG + Intronic
920578587 1:207083088-207083110 GTAGAATTTATGGATGGGAAGGG + Intronic
920758940 1:208763113-208763135 ATATAATGTCTGGCCGGGCATGG + Intergenic
921042327 1:211445613-211445635 TTAAAAAGTTAGGCTGGGCACGG + Intergenic
921226235 1:213022766-213022788 GAAAAATAGACGGCTGGGCACGG + Intergenic
921356980 1:214293964-214293986 AAAAAATGAGTGGCTGGGCACGG - Intronic
921448320 1:215272658-215272680 ATAAAAATTATGGCTGGGCGTGG + Intergenic
921916609 1:220619182-220619204 TAAAAATGTAGGGCTGGGCACGG + Intronic
921926044 1:220710799-220710821 GAAAAATGTTTAGCTGAGCATGG + Intergenic
921961767 1:221042790-221042812 TTAAAATTTAAGGCTGGGCATGG - Intergenic
922444177 1:225682575-225682597 CCAAACTGTATGGCTGGGAATGG - Intergenic
922582532 1:226709476-226709498 TTAAAATGTATGGGTGGGGTGGG + Intronic
922650372 1:227332720-227332742 AAGATATGTATGGCTGGGCATGG - Intergenic
922741864 1:228018680-228018702 ATCAAATATAAGGCTGGGCATGG - Intronic
922948324 1:229536208-229536230 AAAAAAAGTAAGGCTGGGCATGG + Intronic
923142688 1:231174454-231174476 GTAAAATAAAAGGCTGGACATGG - Intronic
923389058 1:233495678-233495700 AAAAAATATAAGGCTGGGCATGG - Intergenic
923588215 1:235294802-235294824 TAAAAAGATATGGCTGGGCACGG - Intronic
923799175 1:237190177-237190199 GAAAACAGTATGGCTGGGCACGG - Intronic
923824884 1:237489364-237489386 TTAAAAAGTCAGGCTGGGCACGG + Intronic
923880722 1:238101392-238101414 TTAAAATATAGAGCTGGGCATGG + Intergenic
923892714 1:238234036-238234058 GGGAAATGTAAGGCAGGGCAGGG - Intergenic
924057857 1:240141658-240141680 TTAAAGTATATGGCTGGGCGTGG - Intronic
924144229 1:241057621-241057643 GTTAAATTTATAGCTGGGCATGG + Intronic
924188031 1:241516939-241516961 TTAAAATTTAAGGCCGGGCACGG - Intronic
924695906 1:246399312-246399334 ATAAAATATGGGGCTGGGCAAGG - Intronic
924696103 1:246401620-246401642 TAAAAATTTAAGGCTGGGCATGG - Intronic
924718007 1:246596257-246596279 GTAAAATAATTAGCTGGGCATGG + Intronic
1062853853 10:769385-769407 GAAAAAAGGACGGCTGGGCACGG + Intergenic
1063482399 10:6387464-6387486 CAAAAATGTTTGGCTGGGCGTGG + Intergenic
1063918160 10:10905450-10905472 CTAAAATTTGAGGCTGGGCATGG + Intergenic
1064705926 10:18072615-18072637 AGAAAATCTAAGGCTGGGCATGG - Intergenic
1064744645 10:18466393-18466415 GTAAAAAATTTAGCTGGGCATGG - Intronic
1064764203 10:18654249-18654271 GTTAACTGTCTAGCTGGGCATGG - Intronic
1065013043 10:21436682-21436704 GAAAAATGGATTGCTGGTCAGGG - Intergenic
1065030050 10:21576527-21576549 GTAAATGGAATGGCCGGGCACGG - Intronic
1065504340 10:26414430-26414452 TTAAAGTGTATGTCTGGGCCAGG + Intergenic
1065574388 10:27103321-27103343 CTGAAATTTAGGGCTGGGCATGG + Intergenic
1065761536 10:28987540-28987562 TAAAAATCTATGGCCGGGCATGG - Intergenic
1066517591 10:36180851-36180873 GAAACATGTGGGGCTGGGCACGG - Intergenic
1066575716 10:36822207-36822229 TTAAAATGTTTAGCTGGGCGAGG - Intergenic
1066588334 10:36963357-36963379 TGAAAATGTATGGCTGGGCGTGG - Intergenic
1068064294 10:52109474-52109496 GTAAAATGTTTGGCTGGGCGTGG + Intronic
1068248666 10:54407763-54407785 GGAAAAGGGATGGCTGGGCGTGG + Intronic
1068756581 10:60661437-60661459 ATAATCTGTATGTCTGGGCATGG - Intronic
1068860015 10:61838563-61838585 GAAAGAATTATGGCTGGGCACGG + Intergenic
1069211775 10:65770591-65770613 TTACAATTTATGGCTGGGCACGG + Intergenic
1069466423 10:68643528-68643550 ATAATAGGTATGGCTGTGCACGG + Intronic
1069561481 10:69433695-69433717 AAAAAATCTAGGGCTGGGCATGG - Intergenic
1069803906 10:71105306-71105328 ATAAAATTTATGGCTGGGCATGG + Intergenic
1069850852 10:71403934-71403956 GTAAAACATTTAGCTGGGCATGG + Intronic
1070023099 10:72606219-72606241 TTAAAAAGTAAGGCTGGGCACGG + Intronic
1070143683 10:73757943-73757965 AAAAAACGTAAGGCTGGGCACGG + Intronic
1071607351 10:87005402-87005424 GTACAAAAAATGGCTGGGCATGG + Intergenic
1071687747 10:87779023-87779045 TTAAAATTCCTGGCTGGGCATGG + Intronic
1072079333 10:92012478-92012500 TAAAAATGTAAGGCTGGGCACGG + Intronic
1073145657 10:101279801-101279823 ATAAAAAGACTGGCTGGGCATGG - Intergenic
1073366522 10:102947151-102947173 TTAAAATGTATGCCAGGGAAGGG - Intronic
1073602087 10:104856026-104856048 TTCAAAAGCATGGCTGGGCATGG - Intronic
1073783297 10:106862653-106862675 ATAAAAAGTTTGGCTGGGCGCGG + Intronic
1073876617 10:107930552-107930574 GCAAAATGAATGGCTGGTCTGGG + Intergenic
1073923281 10:108483165-108483187 GTATATTGTTGGGCTGGGCATGG - Intergenic
1074299708 10:112222819-112222841 GTAAATGGTGTGGCTGGGCCTGG - Intergenic
1075038101 10:119086189-119086211 TTAAAATATATGGCTGGGGGCGG - Intergenic
1075147830 10:119897705-119897727 ATAATATGTAAGGCTGGGCACGG + Intronic
1075367690 10:121907162-121907184 TAAAAAGGTATGGCTGGGCACGG + Intronic
1075379689 10:122008861-122008883 GGGATATGTACGGCTGGGCATGG - Intronic
1075940044 10:126383253-126383275 TTAAATTTTTTGGCTGGGCACGG - Intronic
1075980423 10:126733787-126733809 GTCAAATGAATGGCTGGGGCAGG - Intergenic
1076194454 10:128506745-128506767 ATATAATTAATGGCTGGGCAAGG + Intergenic
1076217464 10:128707576-128707598 TTACAATGTTTAGCTGGGCAGGG - Intergenic
1076354576 10:129842471-129842493 GTGCAATATCTGGCTGGGCACGG + Intronic
1076567507 10:131408974-131408996 CTAAAATATCTGGCTGGGCACGG - Intergenic
1076587651 10:131560321-131560343 GGGACATGTGTGGCTGGGCAGGG + Intergenic
1077064116 11:631649-631671 AAAAAAAATATGGCTGGGCACGG - Intergenic
1077605319 11:3606611-3606633 ATAAAGTTTTTGGCTGGGCACGG - Intergenic
1077642608 11:3895106-3895128 GACAAATGTATTGCTGGCCAAGG - Intronic
1078041524 11:7868172-7868194 TAAAAATTTTTGGCTGGGCACGG + Intergenic
1078822993 11:14901160-14901182 AGTAAATGTATGGCTGGGCGCGG - Intergenic
1078824120 11:14910659-14910681 ATACATGGTATGGCTGGGCATGG - Intronic
1079187793 11:18253121-18253143 GCAAAATATATGGCTGGGCGCGG - Intergenic
1079196391 11:18331344-18331366 TTAATAAATATGGCTGGGCACGG - Intronic
1079207004 11:18424715-18424737 GTACTATGTAATGCTGGGCATGG + Intronic
1080003209 11:27374991-27375013 GAAAAATGTTGTGCTGGGCAAGG + Intronic
1080143034 11:28945366-28945388 GAAAGAGGTTTGGCTGGGCATGG + Intergenic
1080622169 11:33996116-33996138 GAAACATTTAGGGCTGGGCATGG - Intergenic
1080698429 11:34623374-34623396 GAAAACAATATGGCTGGGCACGG - Intronic
1081285509 11:41264378-41264400 AGGAAATTTATGGCTGGGCATGG - Intronic
1081432233 11:42989055-42989077 AGAAAATAAATGGCTGGGCATGG - Intergenic
1081821486 11:46000627-46000649 TATAAATTTATGGCTGGGCATGG + Intronic
1082016473 11:47492341-47492363 TTAAAATGTGTGGCAGGTCATGG + Intronic
1082132212 11:48504918-48504940 GGAAAACATCTGGCTGGGCATGG + Intergenic
1082565674 11:54675536-54675558 GGAAAACATCTGGCTGGGCATGG + Intergenic
1082725949 11:56736780-56736802 GTGACAAATATGGCTGGGCATGG - Intergenic
1082862833 11:57872072-57872094 CCTAAATATATGGCTGGGCATGG - Intergenic
1082877251 11:58000823-58000845 TTAACATTTAAGGCTGGGCACGG - Intergenic
1083182642 11:60997083-60997105 TTTAAATTTTTGGCTGGGCATGG + Intronic
1083294631 11:61708671-61708693 GTAAAGTGTGAGGCTGGGCGTGG - Intronic
1083456067 11:62779483-62779505 TAAAAATATAAGGCTGGGCACGG - Intronic
1083915462 11:65740402-65740424 ATAAAATAAAAGGCTGGGCATGG + Intergenic
1084991673 11:72931395-72931417 AAAAAATTTAAGGCTGGGCATGG - Intronic
1085102532 11:73813749-73813771 TAAAAATCCATGGCTGGGCATGG + Intronic
1085142009 11:74154209-74154231 GTAAGATTGATGGCTGGGCACGG + Intronic
1086089483 11:82991349-82991371 TAAAAATGAATAGCTGGGCATGG + Intronic
1086379319 11:86235817-86235839 ACAAAATATTTGGCTGGGCATGG + Intergenic
1086470086 11:87098976-87098998 TTAAGATATTTGGCTGGGCACGG - Intronic
1086869726 11:92022600-92022622 GTAAAATGTGAGGGTTGGCAAGG - Intergenic
1087030194 11:93695718-93695740 GTAAAATGGATGGCTGGGCGCGG + Intronic
1087505084 11:99010518-99010540 CTAAAAAATGTGGCTGGGCAAGG - Intergenic
1088185645 11:107166148-107166170 TTAATATTTATGGCTGGGCATGG + Intergenic
1088233860 11:107701510-107701532 CTAAAATCTTTGGCTGGGCATGG + Intergenic
1088255043 11:107895832-107895854 AAAAAATTTATGGCTGGGCTTGG + Intronic
1088319797 11:108543754-108543776 GCAAAATGCAAGTCTGGGCAGGG - Intronic
1088412732 11:109553264-109553286 CAAAAATGTATGGCTGAGCCTGG - Intergenic
1088990892 11:114952471-114952493 GTAAATTGTACAGCTGGGGAAGG + Intergenic
1089375447 11:117990904-117990926 GTAAAGTGTTGGGCTGGGCTCGG + Intronic
1089564213 11:119362551-119362573 GAAGAATATCTGGCTGGGCATGG - Intronic
1089853789 11:121522839-121522861 GCAGAATTTCTGGCTGGGCAAGG + Intronic
1089914544 11:122140217-122140239 CTAAAACTTTTGGCTGGGCACGG - Intergenic
1089956846 11:122579169-122579191 TAAAAAGGTACGGCTGGGCACGG - Intergenic
1090051830 11:123386737-123386759 GTATAGTGTGAGGCTGGGCATGG - Intergenic
1090293730 11:125568814-125568836 ATAAAATAAGTGGCTGGGCACGG - Intergenic
1090552754 11:127841014-127841036 GTGAAATTTCAGGCTGGGCACGG - Intergenic
1090564592 11:127974739-127974761 ATAAAAAGTAAGGCGGGGCATGG + Intergenic
1090618401 11:128538664-128538686 GTAAAATATATGGCAGTGCCTGG + Intronic
1090789658 11:130080493-130080515 ATAAAATGTCTGGCCGGGCACGG - Intronic
1090842374 11:130502704-130502726 GTTAAATTTATGGCTGGGCGTGG + Intergenic
1091881790 12:3984818-3984840 TTGAAAGATATGGCTGGGCACGG - Intergenic
1091885128 12:4011465-4011487 TTAAAATGTATGGCCAGGCGCGG - Intergenic
1092352227 12:7764957-7764979 AAAAAATGTAGGGCTGGGCGTGG - Intergenic
1092363605 12:7858787-7858809 TTAAAATTTGGGGCTGGGCAGGG - Intronic
1092531061 12:9345760-9345782 ATATAATGTCAGGCTGGGCATGG - Intergenic
1092607351 12:10135195-10135217 GAAAAGATTATGGCTGGGCACGG + Intergenic
1092774695 12:11932366-11932388 GTGACAGGGATGGCTGGGCATGG - Intergenic
1092824614 12:12386796-12386818 GAAAAAGGTATGGGTGGGCAGGG - Intronic
1092885153 12:12918384-12918406 ATAAAATCTCAGGCTGGGCATGG - Intergenic
1093012343 12:14121391-14121413 GAAAAATATATTGCTGGGCCAGG - Intergenic
1093031116 12:14289368-14289390 GTCAAATGTATGGGTGGCCTGGG - Intergenic
1093235700 12:16606400-16606422 GTATTATGTCTGGCTGGGAAGGG - Intronic
1093379795 12:18478685-18478707 GTTATATTTAAGGCTGGGCATGG + Intronic
1093670463 12:21868347-21868369 ATAAAATTTATGGCCGGGCACGG + Intronic
1093937521 12:25017425-25017447 GTATATTCTCTGGCTGGGCATGG + Intergenic
1094335834 12:29352370-29352392 GTAAAAACCATGTCTGGGCAAGG + Intronic
1095211873 12:39503824-39503846 TTAAAAGATCTGGCTGGGCAAGG + Intergenic
1095258046 12:40063950-40063972 ATAAAATATATGGCCAGGCATGG + Intronic
1095258325 12:40068057-40068079 GAAAAATAAATAGCTGGGCATGG - Intronic
1095485534 12:42680410-42680432 ATAAAATATCAGGCTGGGCATGG + Intergenic
1095995676 12:48081852-48081874 CTAAAACATTTGGCTGGGCATGG - Intronic
1096063626 12:48722549-48722571 GTATCATGTCTGGCTGGGCGTGG - Intergenic
1096065637 12:48737703-48737725 TTAAAAATTAAGGCTGGGCACGG - Intergenic
1096172971 12:49488331-49488353 TAAAAATATATGGCTGGGCATGG - Intronic
1096318420 12:50589467-50589489 TTTAAATTAATGGCTGGGCATGG - Intronic
1096405231 12:51339258-51339280 GTAACAAATTTGGCTGGGCATGG + Intronic
1096432512 12:51558543-51558565 GTAAAAATAAAGGCTGGGCATGG - Intergenic
1096706038 12:53422999-53423021 GTAAAATCCACGGCTAGGCATGG + Intergenic
1096866697 12:54568552-54568574 ATAAAATTTATTGCCGGGCACGG + Intronic
1097000220 12:55869964-55869986 TTAAAATTTCTGGCTGGGCATGG - Intergenic
1097004740 12:55907951-55907973 ATAAAAAATAAGGCTGGGCATGG + Intronic
1097136191 12:56858091-56858113 GTGAAATGTAAGTCTTGGCAGGG + Intergenic
1097192975 12:57228692-57228714 AAAAAATTTTTGGCTGGGCATGG - Intergenic
1097255366 12:57669723-57669745 TTAAAAAATATGGCTGGGCGAGG + Intergenic
1097280031 12:57839426-57839448 GTGAAATGTTAGGCCGGGCACGG + Intronic
1097661175 12:62433518-62433540 TTAAAAGGAAAGGCTGGGCATGG + Intergenic
1097716823 12:62975637-62975659 AATAAATGGATGGCTGGGCATGG - Intergenic
1097885203 12:64721977-64721999 GTAAAATGTATGGGTTGGCAAGG + Intronic
1098329728 12:69340674-69340696 GTAAAATGCATGGCAGAGCCTGG + Intergenic
1098549763 12:71750437-71750459 CTAAAATGTATTGCAGGGCCAGG + Intergenic
1098865611 12:75759768-75759790 GTAAAATTGTTGGCTTGGCAGGG - Intergenic
1098888353 12:75983061-75983083 GAAATATATATGGCTGGGCATGG - Intergenic
1098983240 12:76982764-76982786 GTAAACTGCAGGGTTGGGCATGG - Intergenic
1099287349 12:80731092-80731114 GAAAATGGTAAGGCTGGGCATGG + Intergenic
1099287681 12:80735246-80735268 GAAAAATGTGAGGCTGGGCGCGG + Intergenic
1099983775 12:89639211-89639233 AAAAAATGCAAGGCTGGGCACGG + Intronic
1100053490 12:90480632-90480654 ATAAAATGGAAAGCTGGGCATGG + Intergenic
1100827678 12:98490071-98490093 ATAAAATTTTTGGCTGGGCATGG - Intronic
1100986328 12:100204653-100204675 ATAAAAAATAAGGCTGGGCATGG - Intronic
1101098590 12:101369325-101369347 GTTAAAAATATGGCTGGGCATGG + Intronic
1101265608 12:103083072-103083094 AAAAAATATATGACTGGGCACGG + Intergenic
1101633600 12:106518955-106518977 AAAAAATGTGTGGCCGGGCACGG - Intronic
1101660944 12:106765166-106765188 GAAAAAATTAAGGCTGGGCATGG + Intronic
1101920922 12:108932305-108932327 GTTAAAATTATGGCTGGGTATGG - Intronic
1101927590 12:108985379-108985401 TAAAAAAGTCTGGCTGGGCATGG + Intronic
1102384932 12:112500880-112500902 ATAAAAAATAGGGCTGGGCATGG - Intronic
1102481233 12:113225039-113225061 GTAAAATAAAAGGCTGGGCACGG - Intronic
1102938107 12:116914286-116914308 GCAAACTTTGTGGCTGGGCAAGG + Intronic
1103111706 12:118285641-118285663 GTATAGATTATGGCTGGGCATGG - Intronic
1103118540 12:118360275-118360297 AAAAAAAGTATGGCCGGGCACGG + Intronic
1103349004 12:120270111-120270133 AAAAAATATATGGCCGGGCACGG + Intergenic
1103672010 12:122625112-122625134 AAAAGAAGTATGGCTGGGCACGG + Intronic
1103819916 12:123689344-123689366 GAAAAATTTTTGGCTGGGCGCGG - Intronic
1104252709 12:127110430-127110452 TTAAAGTCTATGGCTGGGCGCGG - Intergenic
1104341062 12:127949130-127949152 TTAAATAATATGGCTGGGCACGG + Intergenic
1105364533 13:19752874-19752896 GTGAAAAGAAAGGCTGGGCACGG - Intronic
1105491448 13:20892376-20892398 GTATAAAATTTGGCTGGGCATGG - Intronic
1105502217 13:20982599-20982621 ATAAAAGATTTGGCTGGGCATGG - Intronic
1105716342 13:23068986-23069008 ATAAATTTCATGGCTGGGCATGG - Intergenic
1105765485 13:23554610-23554632 TTGAAATGGATGGCTGGGCATGG + Intergenic
1106159073 13:27184497-27184519 GTAAAAACTATGGCTAGGCATGG + Intergenic
1106464311 13:29999237-29999259 TTAAAAAGTATGGCCGGGCACGG - Intergenic
1106822296 13:33478623-33478645 GTAAAAGGTCAGGCTGGGCATGG + Intergenic
1107172476 13:37359062-37359084 GTAAAAGGTCAGGCCGGGCACGG + Intergenic
1107463281 13:40626105-40626127 ATAAAAAGTAAGGCTGGGCATGG - Intronic
1107491629 13:40885230-40885252 AAAAAATTTAGGGCTGGGCAAGG - Intergenic
1107495180 13:40919495-40919517 AAAAAATTTAAGGCTGGGCACGG + Intergenic
1107515866 13:41128815-41128837 ATAAAAAATATGTCTGGGCATGG - Exonic
1107529871 13:41273034-41273056 GAAGCATCTATGGCTGGGCATGG + Intergenic
1107785106 13:43947587-43947609 GTAAATAATATGGCTGGGCAAGG - Intergenic
1108194984 13:47984490-47984512 GTGAAAAGTAGGGCTGGGCGTGG - Intronic
1108312810 13:49212384-49212406 TTAAAATGTTGGGCTGGGGAAGG + Intergenic
1108390654 13:49944202-49944224 AAAAAATCTGTGGCTGGGCACGG - Intergenic
1108660315 13:52579244-52579266 GGAAAAAAAATGGCTGGGCACGG - Intergenic
1108703412 13:52963144-52963166 GTCAAATGAATGGATGGCCACGG - Intergenic
1109250563 13:60015149-60015171 GTAAAACAAATAGCTGGGCATGG - Intronic
1109256453 13:60088910-60088932 ATAAAATATATGGCTGCGCTTGG - Intronic
1110514457 13:76393363-76393385 ATCAAAGGTATGGCCGGGCATGG - Intergenic
1110695442 13:78482669-78482691 GTTAAATGAAGGGCGGGGCAGGG + Intergenic
1110710277 13:78643495-78643517 GTAAAAATCTTGGCTGGGCACGG + Intronic
1110780719 13:79461569-79461591 GTAAAATTTAAGGCCAGGCACGG - Intergenic
1110829374 13:80012730-80012752 AATAAATATATGGCTGGGCACGG + Intergenic
1110974909 13:81818916-81818938 GGAAAATGTGTGGCTGGGCGCGG + Intergenic
1112019958 13:95363012-95363034 TTAAAAAGTATGACTGGGCATGG + Intergenic
1112446679 13:99470800-99470822 TTAAATTTTAGGGCTGGGCATGG + Intergenic
1113077254 13:106479379-106479401 ATAAAATCTAGGGCTGGGCACGG + Intergenic
1113192482 13:107765657-107765679 ATAAAAAGGATGGGTGGGCAGGG - Intronic
1113860452 13:113481591-113481613 GAAAAATTGGTGGCTGGGCACGG + Intronic
1114445911 14:22787781-22787803 TTAAAATGTTAGGCCGGGCACGG + Intronic
1114464749 14:22913605-22913627 ATAAAAATTAAGGCTGGGCACGG + Intronic
1114505868 14:23212794-23212816 TTTAAATTTCTGGCTGGGCATGG - Intronic
1114546198 14:23503408-23503430 GTACACTGTGAGGCTGGGCATGG - Intronic
1114625742 14:24128842-24128864 TTAAATTTTTTGGCTGGGCACGG + Intronic
1115243796 14:31274651-31274673 TTAAATAATATGGCTGGGCATGG + Intergenic
1115280052 14:31651606-31651628 GAAAAATGTGTGGCCGGGCGTGG + Intronic
1115494429 14:33988309-33988331 GTAAAATGAATGGCAAGGCTAGG + Intronic
1115544797 14:34456031-34456053 TTAAAATGTGTGGCTGGGCGCGG + Intronic
1115594358 14:34894816-34894838 GTAAAATTCTTGGCCGGGCACGG + Intergenic
1115675429 14:35668190-35668212 TTAAAATGTAAGGCTGGGCATGG + Intronic
1115696649 14:35906428-35906450 GTAACATTCTTGGCTGGGCAAGG - Intronic
1115802535 14:37011175-37011197 TTAAAATGTCAGGCTGGGCACGG - Intronic
1116023671 14:39490561-39490583 GTAAAATGTAATATTGGGCAAGG + Intergenic
1116902877 14:50378420-50378442 GTAAAATGTAAGGCTGGAAAAGG + Intronic
1117158901 14:52968235-52968257 TTAAAATGTCTGGCCGGGCACGG - Intergenic
1117355439 14:54919457-54919479 ATAAAATAAATGGCTGGGCATGG - Intergenic
1117704053 14:58444712-58444734 CTTAAAAATATGGCTGGGCATGG - Intronic
1117864795 14:60135838-60135860 GTGATAATTATGGCTGGGCACGG - Exonic
1118365379 14:65090791-65090813 AAAAAATGGTTGGCTGGGCATGG - Intronic
1118530552 14:66701037-66701059 GAAAACTGGATGGCAGGGCAGGG - Intronic
1118843571 14:69529392-69529414 ATAAAATAAATAGCTGGGCATGG + Exonic
1119004586 14:70911953-70911975 TTAAAATTTATGGCTGGGCGCGG + Intronic
1119091031 14:71781502-71781524 ATAAAATTTATGGCTGGGCATGG + Intergenic
1119314548 14:73681820-73681842 ATAATATGTTTAGCTGGGCATGG + Intronic
1119361237 14:74051870-74051892 GGAAGATGTTAGGCTGGGCATGG - Intronic
1119361835 14:74056628-74056650 TTAAAATGTATAACTGGCCAGGG - Intronic
1119742792 14:77025576-77025598 GCAAAATTTGTGGCTGGGGACGG + Exonic
1119811633 14:77525618-77525640 TTAAAAAGGAGGGCTGGGCATGG + Intronic
1120506835 14:85363259-85363281 GAAAAAAGTAATGCTGGGCATGG + Intergenic
1120545055 14:85800932-85800954 TTAAAAATTCTGGCTGGGCATGG - Intergenic
1120549959 14:85858315-85858337 ATAAAACTCATGGCTGGGCATGG - Intergenic
1120610970 14:86640941-86640963 GTAAAAAAAATGGCTGGGCGTGG + Intergenic
1120679884 14:87468144-87468166 TGAAAATATGTGGCTGGGCATGG - Intergenic
1120770766 14:88377228-88377250 ATAAAAAGTCTGGCTGGGCGTGG - Intergenic
1120814181 14:88836767-88836789 TTAAAACTTAAGGCTGGGCATGG + Intronic
1120836617 14:89043976-89043998 AAAAGATGTGTGGCTGGGCACGG + Intergenic
1120907431 14:89632731-89632753 GTCAAATCTGAGGCTGGGCATGG + Intronic
1121196750 14:92080026-92080048 GAAAAATAAAAGGCTGGGCACGG - Intronic
1121654945 14:95588356-95588378 GAAAAAGGTATAGCTGGGGAGGG + Intergenic
1122208823 14:100161777-100161799 ATAAAGTTTATGGCCGGGCATGG + Intergenic
1122439190 14:101718578-101718600 GGAAAATTTCTAGCTGGGCATGG + Intergenic
1123834485 15:24174847-24174869 GTAAATGGCATGGCTGGGAAGGG - Intergenic
1123898666 15:24853681-24853703 TGAAAACCTATGGCTGGGCACGG - Intronic
1123901745 15:24884019-24884041 AAAGAATGTAGGGCTGGGCATGG + Intronic
1123925046 15:25100222-25100244 ATAAAAAGTAAGGCCGGGCACGG - Intergenic
1124370535 15:29102462-29102484 ATATGATCTATGGCTGGGCACGG + Intronic
1124596403 15:31095392-31095414 TTTAAAAATATGGCTGGGCATGG + Intronic
1124914969 15:33961297-33961319 ATATATTTTATGGCTGGGCATGG - Intronic
1124961248 15:34397273-34397295 ATAAAATATATAGCTGGGTATGG - Intronic
1124977878 15:34543497-34543519 ATAAAATATATAGCTGGGTATGG - Intronic
1125005923 15:34818096-34818118 CTAAACTGTATGACTGGGGAGGG - Intergenic
1125039808 15:35172154-35172176 GTAAAATATTAGGCTGGGCGTGG - Intergenic
1125532747 15:40424217-40424239 GTAAGATCTAAGGCTTGGCAAGG + Intronic
1125563238 15:40655301-40655323 ATAAAAAATAAGGCTGGGCACGG + Intronic
1125765275 15:42131362-42131384 CAAAAATGTATGGCTGAGGATGG + Intergenic
1125849822 15:42892414-42892436 ATAAAATGTTTGGCTGGGCACGG + Intronic
1126484443 15:49164488-49164510 ATAAAAAGGAAGGCTGGGCATGG + Intronic
1126611686 15:50536348-50536370 ATTAAAAATATGGCTGGGCATGG + Intronic
1126713527 15:51487746-51487768 GAAAAATTTCAGGCTGGGCATGG - Intronic
1126751405 15:51881223-51881245 AGAATATGTATAGCTGGGCATGG - Intronic
1126783952 15:52161589-52161611 CGAAGAGGTATGGCTGGGCACGG - Intronic
1126823332 15:52526644-52526666 TTAAAAAGTTAGGCTGGGCACGG - Intronic
1127132278 15:55879997-55880019 ATAAAAGGGCTGGCTGGGCATGG + Intronic
1127223098 15:56900969-56900991 ATAACATTTTTGGCTGGGCATGG + Intronic
1127249129 15:57211661-57211683 ATACAATTTAAGGCTGGGCATGG + Intronic
1127507991 15:59613408-59613430 ATAAAATATTTGGCTGGGCATGG + Intronic
1127513210 15:59664669-59664691 AGAAAGTTTATGGCTGGGCACGG - Intronic
1127861044 15:62994581-62994603 CTAAACTGTAAGGCTGGGCCTGG + Intergenic
1128175076 15:65548217-65548239 TTTAAAATTATGGCTGGGCATGG + Intronic
1128202653 15:65822767-65822789 GTAAAATCTTTGGCTTGGCCGGG + Intronic
1128316134 15:66660630-66660652 GTAAATGGAATGGCTGGGCGTGG - Intronic
1129153939 15:73705957-73705979 AAAAAATTTAGGGCTGGGCATGG + Intronic
1129601203 15:76999567-76999589 GTGAAATGTAGTGCTGGGCGCGG - Intronic
1129719914 15:77872311-77872333 GTAAGAGGTGTGGCTGTGCATGG + Intergenic
1129776255 15:78238389-78238411 GTAGGATTCATGGCTGGGCATGG - Intronic
1130227368 15:82069494-82069516 GTAAAAAGAGTGGCTGGGCACGG - Intergenic
1130314757 15:82785612-82785634 AATAAATTTATGGCTGGGCACGG - Intronic
1130458262 15:84137159-84137181 TAAAAATATATGGCTGGGCGTGG + Intergenic
1130563495 15:84976614-84976636 TTAAAAAATTTGGCTGGGCACGG + Intergenic
1130921378 15:88347896-88347918 GTAAAATAGGTGGCTGAGCATGG + Intergenic
1131096553 15:89658565-89658587 ATTAAATGTAGGGCTGGGCCAGG + Intergenic
1131110768 15:89763439-89763461 TTAAATTTTATTGCTGGGCATGG + Intronic
1131216466 15:90540480-90540502 AATAAATGTTTGGCTGGGCATGG + Intronic
1131368715 15:91861933-91861955 GAAAAAAGTAGGGCTTGGCAAGG - Intronic
1131492045 15:92871595-92871617 AAAAATTGCATGGCTGGGCACGG - Intergenic
1131501029 15:92966618-92966640 ATAAAATGTATGGCTGGATATGG + Intronic
1131629282 15:94158848-94158870 ATCAAAGGTACGGCTGGGCATGG - Intergenic
1131694564 15:94861758-94861780 GTAAAATGACAGGCTGGGCACGG - Intergenic
1131979847 15:97984374-97984396 ATACAATCTCTGGCTGGGCATGG + Intergenic
1132635733 16:945229-945251 GGAAAATATTTGGCTGGGCACGG + Intronic
1132952501 16:2571644-2571666 ACAAAATTTATGGCTGGGCGTGG + Intronic
1132961850 16:2628526-2628548 ACAAAATTTATGGCTGGGCGTGG - Intergenic
1133006875 16:2887449-2887471 ATAAATTATATGGCTAGGCATGG - Intronic
1133307255 16:4818281-4818303 GTAAAGTGTGAGGCCGGGCATGG - Intronic
1133457724 16:5957513-5957535 TTAGAAATTATGGCTGGGCAAGG - Intergenic
1133546011 16:6807658-6807680 ATAAAAAATTTGGCTGGGCATGG + Intronic
1133571788 16:7048167-7048189 ATAAAATATTGGGCTGGGCACGG - Intronic
1133612806 16:7449217-7449239 GAAAAATGTCAGGCTGGGCATGG - Intronic
1133705626 16:8352048-8352070 TTAAAAACCATGGCTGGGCATGG - Intergenic
1134226094 16:12391234-12391256 ATAATTTGTAAGGCTGGGCATGG - Intronic
1134323590 16:13186585-13186607 TTAAGATGGATGGCTGGGCACGG - Intronic
1134632893 16:15769715-15769737 TTAAATTGTTTTGCTGGGCATGG - Intronic
1135085550 16:19472049-19472071 GTCAAGTTTATGGCTGGGCATGG - Intronic
1135704381 16:24662157-24662179 GATAATTATATGGCTGGGCACGG + Intergenic
1135802184 16:25507739-25507761 TTAAAATGTATGGGGGGGCCAGG + Intergenic
1136248310 16:28987799-28987821 ATAAAATAGCTGGCTGGGCATGG + Intronic
1136401473 16:30021592-30021614 GGAAAACGGATGGCTGGGAATGG - Intronic
1136474075 16:30501283-30501305 TTAAAATGTTTGGCTGGGCACGG + Intronic
1136509807 16:30730055-30730077 GTCAAATTCATGGCCGGGCATGG - Intronic
1136536187 16:30901181-30901203 GATAAATGTGGGGCTGGGCACGG - Intronic
1136669364 16:31842311-31842333 GGGCAAAGTATGGCTGGGCACGG + Intergenic
1137427481 16:48391794-48391816 AAAAAATGCCTGGCTGGGCACGG + Intronic
1137974110 16:53016117-53016139 CTAAAATGAGGGGCTGGGCATGG + Intergenic
1137995863 16:53212109-53212131 TTAAAATTAATGGCTGGGCGCGG + Intronic
1138466409 16:57195219-57195241 GTATAATATTAGGCTGGGCATGG + Intronic
1138570412 16:57868199-57868221 GTTAAAGTTATGGCTGGGCACGG + Intergenic
1138602788 16:58066686-58066708 TTAAAATGTAAGACTGGACATGG - Intergenic
1138783392 16:59815626-59815648 ATAAAACTCATGGCTGGGCATGG + Intergenic
1139025015 16:62805562-62805584 CTGGAATCTATGGCTGGGCAGGG + Intergenic
1139417241 16:66822956-66822978 TTCAGATTTATGGCTGGGCACGG - Intronic
1139696345 16:68678037-68678059 GTTAAAAGGGTGGCTGGGCATGG - Intronic
1139723556 16:68877177-68877199 GAAAAATGTGGGGCTGGGCACGG + Intronic
1139833994 16:69823756-69823778 CAAAAATTTTTGGCTGGGCACGG - Intronic
1139935306 16:70566270-70566292 TAAAAATGACTGGCTGGGCATGG + Intronic
1140542284 16:75767946-75767968 TTAAAATATTGGGCTGGGCATGG - Intergenic
1140647823 16:77052316-77052338 TTAAAAATCATGGCTGGGCACGG + Intergenic
1140835939 16:78793783-78793805 TGAAAATTTTTGGCTGGGCAAGG + Intronic
1141504280 16:84464319-84464341 ATAAAGAGTAGGGCTGGGCATGG + Intergenic
1142298782 16:89244127-89244149 GAAGAATGTTTGTCTGGGCACGG + Intergenic
1142394602 16:89824875-89824897 TTAAAAGTTAGGGCTGGGCACGG - Intronic
1142537558 17:630001-630023 CTGAAATGAGTGGCTGGGCATGG + Intronic
1142796096 17:2308566-2308588 GAAAAATTTTTGGCTGGGCACGG + Intronic
1142923718 17:3214206-3214228 AGAAAATATTTGGCTGGGCACGG + Intergenic
1143159786 17:4861793-4861815 GTAAAATCTTTGGTTGGGCCGGG - Intronic
1143211174 17:5189035-5189057 GTCAAATTTTTGGCTGGGCGTGG - Intronic
1143549462 17:7620919-7620941 GCAAAATTTTTGTCTGGGCACGG - Intronic
1143638114 17:8178218-8178240 GTTAAATGTCCGGCTGGGCGCGG - Intergenic
1143687648 17:8531679-8531701 ATAGAGTTTATGGCTGGGCACGG - Intronic
1144178208 17:12728767-12728789 TTAAAAAGACTGGCTGGGCACGG - Intronic
1144239962 17:13300953-13300975 ATAAAAAATATGGCTGGGCGTGG + Intergenic
1144513774 17:15900738-15900760 ATAAAAAGTCAGGCTGGGCACGG - Intergenic
1144567022 17:16368136-16368158 TAAAAAGGTAAGGCTGGGCACGG - Intergenic
1144746738 17:17621058-17621080 TTAAAATATTTGGCCGGGCACGG + Intergenic
1144858875 17:18287241-18287263 CAAAAAAGTCTGGCTGGGCATGG + Intronic
1145003180 17:19319945-19319967 GTATAATCTGTCGCTGGGCATGG - Intronic
1145165646 17:20611730-20611752 GAAAAATTTGAGGCTGGGCATGG + Intergenic
1145244746 17:21261194-21261216 GTACTGTTTATGGCTGGGCATGG + Intergenic
1145299806 17:21625389-21625411 ACAAAAAATATGGCTGGGCATGG - Intergenic
1145350476 17:22077876-22077898 ACAAAAAATATGGCTGGGCATGG + Intergenic
1146019725 17:29267192-29267214 AAAAAATGTAGGGCCGGGCACGG - Intronic
1146080600 17:29776919-29776941 TTTAAATTCATGGCTGGGCATGG + Intronic
1146095212 17:29923461-29923483 ATAAAATATTTAGCTGGGCATGG + Intronic
1146631009 17:34469307-34469329 GTCAAATGTATATCTGGGCCAGG - Intergenic
1147248959 17:39141183-39141205 GTAAAAAGATTAGCTGGGCATGG - Intronic
1147574076 17:41588618-41588640 GGAAATTGTAGGGCTGGGCCAGG - Intergenic
1147619006 17:41851311-41851333 GTAAATTTGAGGGCTGGGCATGG + Intergenic
1147682681 17:42261848-42261870 GAAAAAAATCTGGCTGGGCATGG - Intronic
1147749510 17:42720939-42720961 ATAAAGCCTATGGCTGGGCACGG - Intronic
1147875261 17:43616460-43616482 GAAAAATGTAGTGCTGGACAAGG - Intergenic
1148008545 17:44455209-44455231 ATAAAATGAGTGGCCGGGCATGG + Intronic
1148010799 17:44479676-44479698 AAAAAATTGATGGCTGGGCAAGG + Intronic
1148660917 17:49331991-49332013 ATAAAATAAAAGGCTGGGCATGG + Intronic
1148661952 17:49341360-49341382 AAAAGATGGATGGCTGGGCAAGG + Intronic
1148718605 17:49733850-49733872 TTAAGATCTATGGCTGGGCGTGG + Intronic
1148913809 17:50957728-50957750 GTAAAAAGTAAGGCCAGGCATGG - Intergenic
1149149481 17:53542915-53542937 CAAAAATGTGAGGCTGGGCATGG - Intergenic
1149692692 17:58591225-58591247 CTAAAATGTCTGGCTGGGCGCGG + Intronic
1149715516 17:58785598-58785620 ATAAAAGTTATGGCTGGGCAAGG - Intronic
1149718014 17:58812855-58812877 AAAAAGTGTGTGGCTGGGCACGG - Intronic
1149760971 17:59229651-59229673 AAAAAATTTATGGCTGGGCGTGG - Intronic
1149766309 17:59281624-59281646 ACAAAATGTATGGCCGGGCGTGG + Intergenic
1149886427 17:60344416-60344438 ATAAAAACTATGGCTGGGCAAGG - Intronic
1149925021 17:60694174-60694196 TTAAAATGTTTGGCCGGGCGCGG - Intronic
1150053494 17:61989298-61989320 TTAAAATATATGGCTGGGCGTGG - Intronic
1150166852 17:62952009-62952031 TTAAAAAGAATGGCTGGGCGCGG - Intergenic
1150422638 17:65052442-65052464 GTAAAACTGCTGGCTGGGCACGG - Intronic
1150467480 17:65405675-65405697 ACAAAATTTATAGCTGGGCATGG + Intergenic
1150689637 17:67353595-67353617 ATAAACTTTTTGGCTGGGCATGG - Intronic
1151269274 17:72980732-72980754 ATAGAATGTGAGGCTGGGCACGG + Intronic
1151519117 17:74615793-74615815 AGAAAATGTCAGGCTGGGCATGG + Intronic
1151646869 17:75438655-75438677 GAAAAATCCATGGCCGGGCACGG + Intergenic
1151738011 17:75958062-75958084 TAAAAATGTATGGCTGTGCGTGG + Intronic
1151782220 17:76254743-76254765 ATAAAATGCAGAGCTGGGCACGG - Intergenic
1152006033 17:77681831-77681853 AGAACATGTAGGGCTGGGCACGG - Intergenic
1153195605 18:2592647-2592669 ATAAAATTTATGGCTGGGTGTGG - Intronic
1153302245 18:3601550-3601572 ATAAAACCTACGGCTGGGCATGG + Intronic
1154052833 18:10978178-10978200 ATAAAATAAATAGCTGGGCATGG + Intronic
1154079017 18:11235608-11235630 GTAAGATGTAGGGCCGGGCACGG - Intergenic
1154216275 18:12419031-12419053 ATAAAAAGTTGGGCTGGGCACGG + Intronic
1154235867 18:12605226-12605248 TTAAAATAAAAGGCTGGGCATGG + Intronic
1154981248 18:21504242-21504264 GTACCATCTCTGGCTGGGCAGGG + Intronic
1155037619 18:22038490-22038512 TTAAAAAATATGGCTGGGCATGG + Intergenic
1155183935 18:23371383-23371405 TTATTATGTAAGGCTGGGCACGG - Intronic
1155189280 18:23414822-23414844 ATAAAATGTATGGCCAGGCATGG + Intronic
1155329862 18:24704155-24704177 GGAAAATGGCTGGCAGGGCATGG + Intergenic
1156392585 18:36664839-36664861 GAAAAATGTATTACTGGGCTGGG + Intronic
1156578082 18:38342830-38342852 GGAAAATTTATGGCCGGGCGTGG + Intergenic
1156582053 18:38388995-38389017 GAAAAATGAAAAGCTGGGCATGG + Intergenic
1157010884 18:43647188-43647210 CAAAATTTTATGGCTGGGCACGG + Intergenic
1157083290 18:44551721-44551743 TTTAATTGTGTGGCTGGGCACGG - Intergenic
1157130889 18:45006240-45006262 GAAAGATTTTTGGCTGGGCATGG - Intronic
1158163076 18:54507881-54507903 TAAAAATGTATGGCTTGGCCGGG + Intergenic
1158353320 18:56587754-56587776 GTTAATTATATGGCTGGGCATGG - Intergenic
1158707344 18:59804818-59804840 TTAAAATGTATTGCATGGCAAGG - Intergenic
1159049171 18:63401700-63401722 TAAAAAACTATGGCTGGGCATGG + Intronic
1159254467 18:65928620-65928642 GTAGAATTTTTGGCTGGGCATGG + Intergenic
1159498253 18:69234191-69234213 TTAAAATATATGGCCAGGCATGG + Intergenic
1159897030 18:74007066-74007088 TAAAAATTTAGGGCTGGGCATGG - Intergenic
1161228295 19:3158440-3158462 ATAAAATGTTTGGCCGGGCATGG - Intronic
1161834542 19:6636772-6636794 TTAAAAAGTAAGGCCGGGCACGG - Intergenic
1161992696 19:7693937-7693959 AAAAAATCTGTGGCTGGGCATGG - Intronic
1162048799 19:8019497-8019519 TTAAAATAAATAGCTGGGCACGG + Intronic
1162096662 19:8314029-8314051 GAAGAATACATGGCTGGGCATGG + Intronic
1162274760 19:9644298-9644320 TAAAGATGTCTGGCTGGGCATGG + Intronic
1162343088 19:10103802-10103824 TAAAAATGTAAGGCTGGGCGCGG + Intergenic
1162492152 19:10999364-10999386 TTAAAACTTGTGGCTGGGCATGG + Intronic
1162516892 19:11153775-11153797 GAAGAAAATATGGCTGGGCACGG + Intronic
1162693980 19:12457451-12457473 TTAAAGTTTTTGGCTGGGCATGG + Exonic
1162695690 19:12472590-12472612 AAAAAAGGTCTGGCTGGGCACGG + Intronic
1162720891 19:12662133-12662155 TAAAAATTGATGGCTGGGCATGG - Intronic
1162813029 19:13176106-13176128 TTAAAAATTAAGGCTGGGCATGG - Intergenic
1162853600 19:13450952-13450974 AAAAAATGTAAAGCTGGGCAGGG - Intronic
1162880841 19:13658046-13658068 ATAAAATTTAAGTCTGGGCACGG + Intergenic
1163022711 19:14491893-14491915 TGAAAATATATGGCTGGGCGTGG - Intronic
1163074631 19:14878964-14878986 GTAAAATTTTTGGCCCGGCATGG - Intergenic
1163083162 19:14958118-14958140 TTGAAGTTTATGGCTGGGCATGG + Intronic
1163107392 19:15132929-15132951 TAAAAATGTATGGTTGGGCTGGG + Intergenic
1163129128 19:15261194-15261216 TTAAAAAGTCTGGCCGGGCACGG + Intronic
1163363815 19:16865119-16865141 AAAAAATTTATGGCCGGGCACGG - Intronic
1163373777 19:16917455-16917477 GTAAGATCTATGGCCGGGCGAGG + Intronic
1163534268 19:17868159-17868181 TAAAAATTTTTGGCTGGGCATGG + Intergenic
1163543442 19:17925903-17925925 GTCCACTTTATGGCTGGGCATGG - Intergenic
1163616928 19:18334842-18334864 ATAAAATAAATGGCCGGGCACGG - Intergenic
1163812218 19:19440546-19440568 ATAAAATGAGTGGCTGGGCACGG - Intronic
1164044476 19:21524232-21524254 GTAAAATGTGATGCTGGGCCAGG + Intronic
1164264471 19:23600678-23600700 AAAAAATTTATGGCTGGGCATGG - Intronic
1164273652 19:23697445-23697467 TAAAAATTTATGGCTAGGCACGG - Intergenic
1164640993 19:29825576-29825598 GCAAAAATTAAGGCTGGGCATGG + Intergenic
1165038116 19:33049314-33049336 GAGAAATGTATGGGTGGGGATGG - Intronic
1165207767 19:34205524-34205546 GAAAAATGGTTAGCTGGGCATGG + Intronic
1165294340 19:34914492-34914514 TTAAAAGGTCTAGCTGGGCATGG + Intergenic
1165307742 19:35012675-35012697 GGAACATTCATGGCTGGGCACGG + Intronic
1165341962 19:35218976-35218998 GTAAACTGAAGGGCTGGGCGTGG - Intergenic
1166061057 19:40326048-40326070 GTAAAATGAGTGGCTGTGCTTGG - Intronic
1166181208 19:41110437-41110459 TGAAAATCTACGGCTGGGCATGG - Intergenic
1166378492 19:42342346-42342368 GGAGAATTTCTGGCTGGGCACGG + Intronic
1166399634 19:42468780-42468802 ATAAAAATTAAGGCTGGGCATGG + Intergenic
1166839645 19:45689021-45689043 TGAAAATGTCTGGCTGGGCACGG - Intronic
1167141726 19:47655942-47655964 CTATAATGTGAGGCTGGGCATGG + Intronic
1167228739 19:48267993-48268015 GTAAAATGTATGGCTGGGCATGG - Intronic
1167536554 19:50056870-50056892 TAAAAATATATGGCCGGGCACGG + Intergenic
1167614069 19:50521883-50521905 GAAAAAAATAAGGCTGGGCATGG + Intronic
1167804963 19:51774900-51774922 TGAAAATTTCTGGCTGGGCATGG - Intronic
1167856559 19:52246656-52246678 ATTAAAAGAATGGCTGGGCATGG - Intergenic
1167905331 19:52655918-52655940 AAAAAATATATGTCTGGGCACGG + Intronic
1168476712 19:56681209-56681231 ATAGAATGTGTGGCTGGACACGG + Intergenic
1168535939 19:57171059-57171081 GAAAATTTGATGGCTGGGCATGG - Intergenic
1168550396 19:57288483-57288505 GGAAAATTCTTGGCTGGGCACGG - Intronic
1168699857 19:58431232-58431254 GTACAATCTTTGGCAGGGCAAGG + Intergenic
927286943 2:21366886-21366908 GAGAAATGCATAGCTGGGCATGG - Intergenic
928163518 2:28951599-28951621 GAAAAATAAATAGCTGGGCATGG + Intergenic
928541414 2:32287651-32287673 CTCAAATGTATGACTGGGTATGG - Intronic
928550518 2:32366159-32366181 TTAAAATTGCTGGCTGGGCATGG - Intronic
928565218 2:32538638-32538660 GTACAGTGTATGGCTGGGCATGG + Intronic
928692570 2:33815977-33815999 ATAATATGGAAGGCTGGGCACGG - Intergenic
929203061 2:39258220-39258242 ATAAAGGATATGGCTGGGCATGG - Intronic
929235111 2:39596834-39596856 AGAAAATGTTTGGCTGGGCGCGG - Intergenic
929544697 2:42848080-42848102 GTAAAAAATTTAGCTGGGCATGG + Intergenic
929752886 2:44735609-44735631 TTAAAACCTGTGGCTGGGCATGG + Intronic
930256368 2:49097616-49097638 GGAAAATGTATCTCTGAGCAAGG + Intronic
930584789 2:53256276-53256298 GAAACATGCATGGCCGGGCACGG + Intergenic
930823787 2:55675296-55675318 AAAAAAAATATGGCTGGGCATGG + Intronic
931278180 2:60763055-60763077 ATAAAATTTATGGTTGGGCGTGG - Intronic
931281446 2:60796427-60796449 GCAAAATCTAGGGCCGGGCATGG - Intronic
931322284 2:61182717-61182739 GTTAAAGCTGTGGCTGGGCATGG + Intronic
931393445 2:61864758-61864780 TTAAGATGTATGGCCGGGCGCGG + Intergenic
931401472 2:61935336-61935358 GTAAAATTTCTGGCTGGACGTGG + Intronic
931619566 2:64196234-64196256 GTAAAGTCTATGTCTGGGAATGG + Intergenic
932164944 2:69497588-69497610 TGATTATGTATGGCTGGGCACGG - Intronic
932255642 2:70283766-70283788 TAAAAAAGAATGGCTGGGCATGG + Intronic
932315928 2:70782776-70782798 TAAAAATTAATGGCTGGGCATGG + Intronic
933673204 2:85028776-85028798 GTAAAAAGTAAGGCCGGGCGCGG - Intronic
933865766 2:86515865-86515887 AAAAAATTTTTGGCTGGGCATGG + Intronic
933884535 2:86705773-86705795 GTGAAATGATTGGCTGGGCACGG - Intronic
933916992 2:87005550-87005572 GTGAAATATAAGGCTGGGCATGG + Intronic
933939936 2:87236604-87236626 ATAAAATTTACGGCTGGGCTAGG + Intergenic
934006003 2:87764364-87764386 GTGAAATATAAGGCTGGGCATGG - Intronic
935002218 2:99030054-99030076 TTAAAATTGTTGGCTGGGCACGG + Intronic
935141623 2:100358146-100358168 AAAAAAAATATGGCTGGGCATGG + Intergenic
935149771 2:100423314-100423336 TCAAAATGTAGGGCTTGGCAGGG - Intergenic
935582022 2:104764252-104764274 GTAAGAAGGAGGGCTGGGCATGG - Intergenic
935637411 2:105260116-105260138 AGAAAATTCATGGCTGGGCATGG + Intergenic
935655278 2:105417392-105417414 AAAAAATGTGTTGCTGGGCACGG + Intronic
935768958 2:106398466-106398488 GTGAAATATAAGGCTGGGCGTGG - Intronic
935911141 2:107897459-107897481 GTGAAATATAAGGCTGGGCGTGG + Intergenic
935969256 2:108514293-108514315 GTGAAATATAAGGCTGGGCGTGG + Intergenic
936132918 2:109862502-109862524 GTGAAATATAAGGCTGGGCGTGG + Intergenic
936211779 2:110508983-110509005 GTGAAATATAAGGCTGGGCGTGG - Intergenic
936353202 2:111729171-111729193 ATAAAATTTACGGCTGGGCTAGG - Intergenic
936420918 2:112363562-112363584 GTGAAATATAAGGCTGGGCGTGG - Intergenic
936495532 2:113017356-113017378 GTACAAATCATGGCTGGGCACGG + Intergenic
937413207 2:121694236-121694258 GAGTAATGTATGGCTGGGCGTGG - Intergenic
937851866 2:126643230-126643252 GTGAAAAGTCTGTCTGGGCATGG - Intergenic
937939945 2:127277399-127277421 AGAAAATGTAAGGCCGGGCATGG + Intronic
937999796 2:127723784-127723806 ATAAAATGTGGGGCCGGGCAAGG + Intronic
938075851 2:128335791-128335813 TTAAAATTTGTGGCTGGGAATGG + Intergenic
938085606 2:128398622-128398644 ATCAACTGTAGGGCTGGGCACGG - Intergenic
938300535 2:130208151-130208173 TTAAAATATAGGGTTGGGCATGG - Intergenic
938456192 2:131466320-131466342 TTAAAATATAGGGTTGGGCATGG + Intronic
938910458 2:135880533-135880555 GAATCATGGATGGCTGGGCATGG - Intergenic
939165981 2:138641826-138641848 GTAATCTCCATGGCTGGGCATGG + Intergenic
939284798 2:140115025-140115047 GCAAGAGGCATGGCTGGGCAGGG + Intergenic
939332199 2:140779404-140779426 GTAAGAAGTGTGGCCGGGCATGG + Intronic
940488696 2:154329391-154329413 ATAAAATTTCAGGCTGGGCATGG - Intronic
940556806 2:155239180-155239202 GAGATATGTGTGGCTGGGCACGG + Intergenic
941209324 2:162617047-162617069 GTAAAATTTAAGGTTGGGGAGGG + Intronic
941576708 2:167241698-167241720 GAAGAAATTATGGCTGGGCATGG - Intronic
941706914 2:168668600-168668622 GAAAAATAATTGGCTGGGCACGG - Intronic
941810453 2:169750357-169750379 TTAAGATGTCTGGCTGGGCATGG + Exonic
941999606 2:171632822-171632844 GTGAATTTTCTGGCTGGGCATGG + Intergenic
942242046 2:173971838-173971860 ACAAAATATAGGGCTGGGCACGG + Intergenic
942284553 2:174402395-174402417 GGAAAATTATTGGCTGGGCATGG + Intronic
942415694 2:175757009-175757031 GTAAAATGTAGGGTTGGAAACGG - Intergenic
942427576 2:175876186-175876208 TTAAAATGGCTGGCTGGGCATGG - Intergenic
942509027 2:176675992-176676014 GTAAAATGTGTGACTGGAAAAGG - Intergenic
943541777 2:189224396-189224418 CTAGAAAATATGGCTGGGCACGG + Intergenic
943594865 2:189844351-189844373 GAAAAATAGTTGGCTGGGCATGG + Intronic
943690506 2:190864959-190864981 TTAAAAGTTATGGCTGGGCGCGG + Intergenic
944055095 2:195515356-195515378 GTAGAAAATATGGCTGGGCGTGG - Intergenic
944171931 2:196788772-196788794 CTAAAATACAGGGCTGGGCACGG + Intronic
944204234 2:197140609-197140631 TTAAAATGTCTAGCTGGGCATGG - Intronic
944582438 2:201143671-201143693 TAAAAAATTATGGCTGGGCATGG + Intronic
945082917 2:206104182-206104204 GCCAAGTGTGTGGCTGGGCACGG - Intergenic
945245706 2:207714977-207714999 GTAAAACATTTGGCTGGGCATGG + Intronic
945501267 2:210578402-210578424 TTAATATTTATGGCTGGGCGCGG - Intronic
945547179 2:211169965-211169987 TTAAAATGAAGGGCTGGGCCGGG + Intergenic
945591403 2:211736409-211736431 TAAAAATGTATTGTTGGGCAGGG + Intronic
945614243 2:212047772-212047794 TTAATATGAAGGGCTGGGCACGG - Intronic
945702663 2:213190944-213190966 TTGAAATTTAAGGCTGGGCACGG + Intergenic
946025065 2:216666686-216666708 GGAAGATGGCTGGCTGGGCAGGG + Intergenic
946233625 2:218308475-218308497 AAAAAATCTAAGGCTGGGCACGG - Intronic
946852935 2:223924781-223924803 TTAAAATGTACTGCTGTGCAGGG + Intronic
947687760 2:232105106-232105128 ACAAAATGTGTGGCTGGGCATGG - Intronic
948450966 2:238071314-238071336 GTAAAAAGTCTGCCAGGGCACGG + Intronic
1168854973 20:1002063-1002085 GTACAAGGGGTGGCTGGGCAGGG - Intronic
1169160308 20:3372011-3372033 GTAAAAGCTGTGGCTGGGCCTGG + Intronic
1169340667 20:4794132-4794154 GTAACAAGTACAGCTGGGCATGG + Intronic
1169407889 20:5339019-5339041 ACAAAAAGTATAGCTGGGCATGG - Intergenic
1169634755 20:7676811-7676833 GAAAATTGTATGGCCAGGCATGG - Intergenic
1170071671 20:12375721-12375743 GTATAAGATATGGGTGGGCACGG - Intergenic
1170151124 20:13227491-13227513 GAAAAAAGTTGGGCTGGGCATGG - Intronic
1170982217 20:21225167-21225189 TTAAAATGTAAGGCAAGGCAAGG - Intronic
1172055074 20:32148958-32148980 GTAATATTTCTGGCTGGGCGCGG - Intronic
1172085617 20:32379989-32380011 AAGAAATGGATGGCTGGGCATGG + Intronic
1172395570 20:34601984-34602006 GTAAAATGTATGTATGGGCTGGG + Intronic
1172402836 20:34664697-34664719 AAAAAGTATATGGCTGGGCATGG + Intronic
1172521925 20:35572870-35572892 AAAAAATGTATGGCTTGGCTGGG - Intergenic
1172545247 20:35755815-35755837 ATAGAATATATGGCTGGGCATGG - Intergenic
1172594098 20:36137812-36137834 TTAAAAAATTTGGCTGGGCATGG - Intronic
1172848110 20:37942189-37942211 AACAAATGGATGGCTGGGCATGG + Intronic
1172857642 20:38018856-38018878 TAAAAAGGTAAGGCTGGGCATGG + Intronic
1172886178 20:38232334-38232356 AAAAAATTTGTGGCTGGGCACGG + Intronic
1172964638 20:38825787-38825809 TTAAAATCCTTGGCTGGGCATGG - Intronic
1173725026 20:45291321-45291343 GTAAAATGAATGGTAAGGCAAGG + Intergenic
1173731864 20:45334775-45334797 ATAAATTTTATGGCCGGGCACGG - Intronic
1174004209 20:47397448-47397470 GGAAGAAGAATGGCTGGGCATGG + Intergenic
1174148612 20:48469901-48469923 GCAAAAATTATGGCCGGGCACGG + Intergenic
1174266647 20:49336826-49336848 TTAAAAATAATGGCTGGGCACGG - Intergenic
1174399614 20:50269059-50269081 GAAAAATTGTTGGCTGGGCACGG - Intergenic
1174425690 20:50430401-50430423 TGAAAATGCAGGGCTGGGCACGG - Intergenic
1174765336 20:53248362-53248384 GAAAAGTTAATGGCTGGGCATGG - Intronic
1174906005 20:54552116-54552138 TAATACTGTATGGCTGGGCAAGG - Intronic
1174974780 20:55319646-55319668 ATAAAATCTAAGGCTGGGCGCGG - Intergenic
1175118648 20:56701910-56701932 ATAAAGTGTGGGGCTGGGCACGG - Intergenic
1175669112 20:60886261-60886283 GTAAAACTTATGGCTGTACAAGG - Intergenic
1176703841 21:10094089-10094111 AGAAAATTTGTGGCTGGGCACGG + Intergenic
1176872350 21:14093759-14093781 GTAAAATCCAAGGCTGGGCATGG + Intergenic
1177571414 21:22891847-22891869 GTGAAAGGTATGGCTTGGAATGG + Intergenic
1177998828 21:28135089-28135111 ATAGAATTTAAGGCTGGGCATGG + Intergenic
1178197724 21:30367567-30367589 ACAAAATGTATCGTTGGGCAGGG - Intronic
1178520495 21:33285179-33285201 TAAAACTGGATGGCTGGGCATGG - Intronic
1178567516 21:33701500-33701522 TTAAAAAATTTGGCTGGGCATGG + Intronic
1179009453 21:37545094-37545116 GTAATAAATATGGCTGGGTACGG + Intergenic
1179387136 21:40954649-40954671 GTAAAATTTATGTATGGACAAGG - Intergenic
1179399306 21:41069500-41069522 GTAAATTGTAGGGCTGGGCATGG + Intergenic
1180787606 22:18555635-18555657 GTAATACTTTTGGCTGGGCACGG - Intergenic
1180939446 22:19647760-19647782 AAATAATTTATGGCTGGGCATGG - Intergenic
1181234133 22:21439671-21439693 GTAATACTTTTGGCTGGGCACGG + Intronic
1181244514 22:21495160-21495182 GTAATACTTTTGGCTGGGCACGG - Intergenic
1181272062 22:21665021-21665043 GTAACATGTCTGGATGGGCGTGG - Intronic
1181296166 22:21841114-21841136 ATATAATTTATGGCTGGGCACGG - Intronic
1181379780 22:22492594-22492616 AGAAAATATCTGGCTGGGCACGG + Intronic
1182031740 22:27164527-27164549 CCAAGATGTATGGATGGGCAAGG + Intergenic
1182077051 22:27501894-27501916 TAAAAATGTTTGGCCGGGCACGG + Intergenic
1182274062 22:29173528-29173550 ACAAGATGTATGGCTGGGCGTGG - Intergenic
1182376116 22:29849442-29849464 GTACAAGATGTGGCTGGGCATGG - Intergenic
1182498637 22:30729345-30729367 CTAAAATTATTGGCTGGGCACGG + Intronic
1182513335 22:30836006-30836028 ATACAATTAATGGCTGGGCATGG - Intronic
1182578150 22:31287618-31287640 ATAAAATGTGTGGCTGGGCGTGG - Intronic
1182590527 22:31376128-31376150 TTAAAAGGAAGGGCTGGGCACGG - Intergenic
1182689483 22:32148285-32148307 GTAATATATATGGCTGGGCACGG + Intergenic
1182703955 22:32263056-32263078 AAAAAATGTAGGGCCGGGCACGG - Intergenic
1182727440 22:32459371-32459393 ATAAAAAATAAGGCTGGGCACGG + Intronic
1182844195 22:33417193-33417215 TTAAAAAGAAAGGCTGGGCACGG - Intronic
1183152726 22:36050691-36050713 ATCAAATATCTGGCTGGGCATGG + Intergenic
1183397708 22:37582105-37582127 GAAAAAAGAATGGCTGGGCATGG + Intronic
1183882564 22:40847241-40847263 GGAAAACTTTTGGCTGGGCATGG + Intronic
1183895995 22:40969457-40969479 GTAAAGAGTATGGCTGGGCTTGG + Intronic
1184185847 22:42864776-42864798 GAAAAAAATCTGGCTGGGCATGG - Intronic
1184325990 22:43786070-43786092 GAAAAATTCAAGGCTGGGCATGG + Intronic
1185158862 22:49210550-49210572 TTAAAAATTATGGCCGGGCATGG - Intergenic
949198764 3:1345404-1345426 AGTAATTGTATGGCTGGGCATGG - Intronic
949306694 3:2649836-2649858 AGAAAATTTGTGGCTGGGCACGG + Intronic
949694759 3:6681456-6681478 GTCCAAAGTATGGCTGGGCATGG - Intergenic
949780119 3:7676969-7676991 TTAAAAAATAAGGCTGGGCATGG + Intronic
949780540 3:7682043-7682065 GAAGAATTTATGGCTGGGCGTGG + Intronic
949835580 3:8266240-8266262 TTAAAATGTTAGGCAGGGCATGG + Intergenic
949959315 3:9299070-9299092 AGAAAATAGATGGCTGGGCATGG + Intronic
950001345 3:9658897-9658919 GAAAATAGTTTGGCTGGGCATGG + Intronic
950199363 3:11032229-11032251 GTAGAATGTACTGCTGGGCTTGG - Intronic
950208723 3:11100906-11100928 TTAAAAACTAAGGCTGGGCACGG - Intergenic
950367094 3:12494833-12494855 AAAAAAAGTTTGGCTGGGCATGG + Intronic
950501744 3:13368365-13368387 ATAAAATTTTAGGCTGGGCACGG - Intronic
950514256 3:13453873-13453895 GTAAAGATTCTGGCTGGGCACGG + Intergenic
950732376 3:14972098-14972120 AAGAAATTTATGGCTGGGCACGG - Intronic
951150809 3:19287872-19287894 GTCGAATGTGGGGCTGGGCATGG - Intronic
951388106 3:22067731-22067753 CAAAAATATCTGGCTGGGCATGG + Intronic
951876087 3:27427428-27427450 ATAAAACTTGTGGCTGGGCATGG - Intronic
951876313 3:27429923-27429945 AAAAAAGGTATGGCTGGGCCTGG + Intronic
952148085 3:30555522-30555544 GAAAAATGTTTTCCTGGGCATGG - Intergenic
952283069 3:31941982-31942004 ATGCAATGTATGGCAGGGCACGG + Intronic
952318292 3:32251602-32251624 GTAACAGATGTGGCTGGGCATGG - Intronic
952725952 3:36584675-36584697 GTACAATGACTGGCTAGGCATGG + Intergenic
953393219 3:42545772-42545794 GTCAACTGCAGGGCTGGGCAAGG + Intergenic
953519364 3:43626589-43626611 GTAAAGAACATGGCTGGGCATGG - Intronic
953615603 3:44488143-44488165 AAAAAAAGAATGGCTGGGCACGG + Intergenic
953692955 3:45135010-45135032 GTAAAAGGTATGGATGTGGAAGG + Intronic
953956333 3:47234844-47234866 TGAAAGTATATGGCTGGGCACGG - Intronic
953975452 3:47378793-47378815 GTAAACTTTGTGGCTGGGCACGG - Intergenic
954318841 3:49817191-49817213 AAAAAATTTTTGGCTGGGCAAGG - Intergenic
954471233 3:50697297-50697319 GGAAAATGCAAGTCTGGGCATGG + Intronic
954477144 3:50757883-50757905 ATTAATTGGATGGCTGGGCACGG + Intronic
954812642 3:53257456-53257478 CTCAAACGGATGGCTGGGCAGGG + Intergenic
954891344 3:53932652-53932674 GTAAATTCTGAGGCTGGGCACGG + Intergenic
955264621 3:57429464-57429486 GTGAAGAGGATGGCTGGGCACGG - Intronic
956427090 3:69147336-69147358 GTAAAAGTAAAGGCTGGGCATGG + Intergenic
956591175 3:70916478-70916500 GTAACATGTATCACTGAGCACGG - Intergenic
956721082 3:72117997-72118019 ATAGAATATGTGGCTGGGCATGG + Intergenic
956797515 3:72730106-72730128 ATAAAATTTAGGGCCGGGCACGG - Intergenic
956842324 3:73152083-73152105 GTAAAATATGTGGCTGGGTGTGG - Intergenic
957498775 3:81026286-81026308 GTAGATTTTAAGGCTGGGCACGG + Intergenic
957806198 3:85152665-85152687 TTAAAATGTAAGGCTGGGCACGG + Intronic
958031993 3:88122717-88122739 ACAATATGTATGGCTGGGTACGG + Intronic
958759877 3:98294426-98294448 AAAAAATGTGTAGCTGGGCAAGG + Intergenic
958872062 3:99571439-99571461 ATAAAATGAATGGCCAGGCATGG + Intergenic
959020701 3:101184982-101185004 AGAAAATTTTTGGCTGGGCACGG + Intergenic
959036651 3:101374463-101374485 TGAAAACTTATGGCTGGGCATGG + Intronic
959627914 3:108473297-108473319 TTAAAAATTTTGGCTGGGCACGG - Intronic
959745056 3:109766681-109766703 TTAAAAATTGTGGCTGGGCATGG + Intergenic
959759921 3:109948904-109948926 GGAGAATATATGGCTGGGAAGGG + Intergenic
960031794 3:113061305-113061327 GTAAAATTAGAGGCTGGGCAGGG - Intergenic
960789942 3:121417753-121417775 TAAAAATTTGTGGCTGGGCACGG - Intronic
960799489 3:121523419-121523441 AGTAAATATATGGCTGGGCACGG + Intronic
961058228 3:123807136-123807158 TTAAATCTTATGGCTGGGCATGG + Intronic
961612366 3:128151353-128151375 AAAAAAGGTTTGGCTGGGCACGG - Intronic
961763758 3:129191712-129191734 ATAATATTTAAGGCTGGGCATGG - Intergenic
961860403 3:129912727-129912749 TTAAGATTTGTGGCTGGGCACGG + Intergenic
962512181 3:136113496-136113518 CTTAAATGTAAGGCTGGCCATGG + Intronic
962586417 3:136846877-136846899 ATAAAATTTCCGGCTGGGCATGG + Intronic
962588822 3:136868204-136868226 TTACAATGTAAGGCTGGGCATGG - Intronic
962600226 3:136985963-136985985 GAACAATGTTAGGCTGGGCATGG + Intronic
963115218 3:141723180-141723202 GTAAAGTGTGTGTCAGGGCATGG + Intergenic
963130252 3:141851336-141851358 GAAACAGGTATGGCTGGGCACGG - Intergenic
963731845 3:148982292-148982314 ATAAGCTGTAAGGCTGGGCACGG + Intergenic
963899743 3:150722661-150722683 GATAGATGTAGGGCTGGGCATGG - Intergenic
964101738 3:152995770-152995792 TTAAAAGTTGTGGCTGGGCATGG - Intergenic
964241953 3:154604747-154604769 TTCAAATGTATGGCTGTGAAAGG - Intergenic
964263430 3:154867236-154867258 GGAAAGAGTCTGGCTGGGCAGGG + Intergenic
964542709 3:157797431-157797453 TGAAAATATGTGGCTGGGCATGG - Intergenic
965429263 3:168566584-168566606 GTAGAATTCCTGGCTGGGCACGG + Intergenic
965646373 3:170885878-170885900 GGAAAAAATAAGGCTGGGCATGG - Intergenic
965784523 3:172321882-172321904 AATAAATGTCTGGCTGGGCATGG - Intronic
965791502 3:172393091-172393113 AAAAAATTCATGGCTGGGCATGG - Intronic
965923853 3:173953067-173953089 GTAAATTTTAGGGCTGAGCACGG - Intronic
966021618 3:175218959-175218981 ATAAAATGAATGGCTGGGCACGG - Intronic
966226505 3:177603762-177603784 GTCAAATGTAGGGCTGGCTAAGG + Intergenic
966336055 3:178869523-178869545 GAAAAAGGCATGGCTGGTCAAGG + Intergenic
966586558 3:181632869-181632891 GTAAATTTATTGGCTGGGCATGG - Intergenic
966804120 3:183792797-183792819 ATAAAATCTCTGGCTGGGCATGG - Intronic
967140491 3:186554136-186554158 AAAAAATGTAAGGCTGGGCGCGG - Intronic
967161185 3:186739759-186739781 GAAAAATGCATGGCTGGGCGCGG + Intronic
967314127 3:188134795-188134817 TTAAAATTTTTAGCTGGGCATGG - Intergenic
967716620 3:192770017-192770039 CAAAAATTTGTGGCTGGGCATGG + Intergenic
967869461 3:194218076-194218098 TAAAAAATTATGGCTGGGCATGG - Intergenic
967898445 3:194421261-194421283 AAAAAATGTGGGGCTGGGCACGG + Intronic
967938972 3:194751665-194751687 ATAAAATGTATACCTTGGCAAGG + Intergenic
968166119 3:196466620-196466642 GCAAAATGTAGGGCCGGGCGCGG - Intergenic
968263322 3:197342577-197342599 ATAAAATTTCAGGCTGGGCACGG + Intergenic
968419840 4:474584-474606 ATAAAATGTTAGGCTGAGCACGG + Intronic
970999565 4:22306823-22306845 AAAAAATGCTTGGCTGGGCATGG + Intergenic
971242847 4:24904088-24904110 GTAAAAATTAAGGCTAGGCACGG - Intronic
971537167 4:27767814-27767836 GTAAAAGTTCTGGCTGGGCGCGG - Intergenic
972430150 4:38973758-38973780 GGAAAATTTCTGGCTCGGCAGGG + Intronic
973275512 4:48302888-48302910 AGAAAATGTGTAGCTGGGCACGG + Intergenic
973622606 4:52742393-52742415 AAAACATGGATGGCTGGGCACGG - Intronic
973664506 4:53144154-53144176 TCAAAATATAAGGCTGGGCATGG + Intronic
973742495 4:53931510-53931532 CAAAAATGTGTGGCCGGGCACGG - Intronic
974004590 4:56543400-56543422 ATAAAGTTTAGGGCTGGGCATGG + Intronic
974057479 4:56998508-56998530 TTAAAATTTTAGGCTGGGCACGG - Intronic
974918542 4:68207500-68207522 TTAAAATGCTTGGCTGGGCGTGG + Intergenic
975038894 4:69720075-69720097 GTGGACTTTATGGCTGGGCATGG + Intergenic
975571960 4:75826882-75826904 AAAAAATATTTGGCTGGGCATGG - Intergenic
976494626 4:85713000-85713022 TTAAAATGTATGTCTAGGCTGGG + Intronic
976620596 4:87123182-87123204 TTAAAATGTTAGGCTGGGCGCGG - Intronic
976822557 4:89223097-89223119 GTGAAATTTCTGGCTGGGCATGG + Intergenic
977606527 4:98990007-98990029 AATAAATGTTTGGCTGGGCATGG - Intergenic
978057859 4:104294986-104295008 GTACCAGGAATGGCTGGGCATGG - Intergenic
978180583 4:105790366-105790388 GTGAAAGGCAAGGCTGGGCATGG + Intronic
978498863 4:109387232-109387254 GGAAAACTTAGGGCTGGGCACGG + Intergenic
978534874 4:109750284-109750306 ATAAAAACTATGGCTGGGCGTGG - Intronic
978735800 4:112082882-112082904 GCAACATGTTAGGCTGGGCACGG - Intergenic
978766607 4:112411513-112411535 GTAAAAAGTAGGGCCGGGCATGG - Intronic
979053775 4:115970646-115970668 TTAAAAAATAAGGCTGGGCATGG - Intergenic
979268936 4:118736293-118736315 TTAAGACATATGGCTGGGCATGG - Intronic
979680993 4:123459485-123459507 GTTAAAAATATGGCTGGGCATGG + Intergenic
979708229 4:123746914-123746936 ATAACATTTAAGGCTGGGCATGG - Intergenic
979759783 4:124388229-124388251 GTACAATGGTTGGCTGGGCTTGG - Intergenic
980114597 4:128667027-128667049 GAAAAAGTTTTGGCTGGGCATGG + Intergenic
980376057 4:131950441-131950463 AGAAAATTTGTGGCTGGGCACGG + Intergenic
980548543 4:134302802-134302824 AAAAAAAGTCTGGCTGGGCATGG - Intergenic
980601359 4:135029689-135029711 GTAAATTGTAAGTCTGGGCATGG + Intergenic
981139300 4:141249831-141249853 TAAAAATGGAGGGCTGGGCATGG - Intergenic
981278185 4:142926671-142926693 GCAATGTGTATGGCAGGGCAGGG + Intergenic
981370860 4:143957177-143957199 ATAGACTGGATGGCTGGGCATGG - Intergenic
981597751 4:146446284-146446306 TTGAAATGACTGGCTGGGCATGG + Intronic
981813726 4:148804900-148804922 TTAAAATATTAGGCTGGGCATGG - Intergenic
982001044 4:151021416-151021438 TTAAAATGTCTTGCTGGGCGTGG - Intergenic
982344311 4:154339735-154339757 TAAAAATGTTTGGCTGGGCGCGG - Intronic
982588012 4:157267133-157267155 AAAAAATGTTGGGCTGGGCACGG + Intronic
983006890 4:162494370-162494392 GTAAGATGCTTGGCCGGGCACGG + Intergenic
983291470 4:165812141-165812163 TTTAAATGCAGGGCTGGGCATGG - Intergenic
983621971 4:169771577-169771599 TTAAAAAATATGGCCGGGCACGG - Intergenic
983991193 4:174121931-174121953 GAAAATATTATGGCTGGGCACGG - Intergenic
984099576 4:175468756-175468778 ATAAAAATTATGGCCGGGCATGG - Intergenic
984908674 4:184651936-184651958 TTAAAATGTTTGGCTGGGCACGG - Intronic
984992928 4:185398246-185398268 TAAAAATGTGTGGCTGGGCGCGG - Intronic
985251046 4:188024753-188024775 GTAAAGAGTTAGGCTGGGCATGG - Intergenic
985326200 4:188773560-188773582 TCAAAAAGTCTGGCTGGGCATGG - Intergenic
985377134 4:189353551-189353573 ATAGAAGTTATGGCTGGGCACGG - Intergenic
986100266 5:4601901-4601923 TTTAAATGTATTGCTGGGCGGGG - Intergenic
986797793 5:11229364-11229386 ATAAAATATTTAGCTGGGCATGG + Intronic
987019575 5:13855496-13855518 GTAAGATTTATGGCCGGGCGCGG - Intronic
987218783 5:15768239-15768261 GTAACATTGCTGGCTGGGCACGG + Intronic
987399082 5:17456396-17456418 GAGAAATTTATGGCTGGGCGTGG + Intergenic
987451820 5:18094460-18094482 GAAAAATGCTCGGCTGGGCACGG + Intergenic
987954704 5:24723496-24723518 TTAAAGTATATAGCTGGGCATGG + Intergenic
987971075 5:24945312-24945334 GTAAAATATTTGGCAGGGGAGGG - Intergenic
988050892 5:26029896-26029918 TTAAAAAATGTGGCTGGGCATGG + Intergenic
988170929 5:27654332-27654354 TTAAAATATATGGCAGGGCACGG + Intergenic
988565734 5:32319044-32319066 TTGAAATCTAGGGCTGGGCATGG - Intergenic
988811406 5:34788677-34788699 ATACCATGTTTGGCTGGGCATGG + Intronic
988845846 5:35126989-35127011 GTAAGAAGAATGGCTGTGCAGGG + Intronic
989271639 5:39540194-39540216 AGAGAATTTATGGCTGGGCACGG - Intergenic
989491304 5:42058481-42058503 TTATTATTTATGGCTGGGCATGG - Intergenic
990261686 5:54029701-54029723 ATAAAAAGAATGGCTGGGCGCGG + Intronic
990383346 5:55235955-55235977 AAAAAATAGATGGCTGGGCACGG - Intergenic
990445997 5:55895005-55895027 GTAAAATTACTGGCTGGGCACGG - Intronic
990561200 5:56984945-56984967 ATAAAATGTCAGGCTGGGCGTGG + Intergenic
990861432 5:60331719-60331741 CTGAAATGCAGGGCTGGGCAGGG + Intronic
991702997 5:69333204-69333226 TTAAAAAGTAGGGCTGGGCGCGG + Intergenic
991730439 5:69581944-69581966 AGAAAATATATAGCTGGGCATGG + Intronic
991806874 5:70437109-70437131 AGAAAATATATAGCTGGGCATGG + Intergenic
991864513 5:71045907-71045929 AGAAAATATATAGCTGGGCATGG - Intronic
991904975 5:71500615-71500637 TTAGAAGGAATGGCTGGGCATGG - Intronic
992126094 5:73643522-73643544 GTAAAAATTTGGGCTGGGCATGG + Intronic
992223753 5:74598236-74598258 GTAAAAGTAATGGCTGGACACGG - Intergenic
992392398 5:76341219-76341241 TAAAAATCTGTGGCTGGGCACGG - Intronic
992674037 5:79087887-79087909 GTGAAATGTAAGGCTGGGCATGG + Intronic
994282100 5:97917426-97917448 TTAAAATATGGGGCTGGGCATGG - Intergenic
994363664 5:98885098-98885120 GTAAAATTCTTGGCTGGGCGCGG + Intronic
994460359 5:100063323-100063345 TTAAAAATTAGGGCTGGGCATGG + Intergenic
994484503 5:100376736-100376758 TTAAAAATTAGGGCTGGGCATGG + Intergenic
995013396 5:107283392-107283414 GGAAACAGTTTGGCTGGGCATGG + Intergenic
995578249 5:113565103-113565125 TTAAAAAATATGGCTGGGCATGG - Intronic
996175454 5:120350450-120350472 AGAAAATGATTGGCTGGGCATGG - Intergenic
996483933 5:124008595-124008617 GTAAGATGTTTAGCTGAGCATGG + Intergenic
996644037 5:125793243-125793265 GTGATATGCATGACTGGGCAAGG - Intergenic
996666095 5:126062105-126062127 GTAGAAAGTGAGGCTGGGCATGG - Intergenic
997083224 5:130765470-130765492 TAAAAATGTCTGGCTGGGCCTGG - Intergenic
997328030 5:133038155-133038177 GTTCCATGTATGGCTGGGCATGG + Intergenic
997762525 5:136463259-136463281 AAAATATTTATGGCTGGGCACGG - Intergenic
997921236 5:137981290-137981312 ATAAAAGAAATGGCTGGGCATGG + Intronic
998008204 5:138671671-138671693 GTTAAATGCTAGGCTGGGCATGG - Intronic
998195213 5:140063144-140063166 GTAACATGAATGGCTGTCCAGGG - Intergenic
998235139 5:140392199-140392221 AAAAATTGTAAGGCTGGGCATGG + Intergenic
998260069 5:140623869-140623891 GAGAAAGGGATGGCTGGGCAAGG - Intergenic
998796467 5:145824933-145824955 AAAAAATGCTTGGCTGGGCATGG + Intronic
998841202 5:146256144-146256166 GGAAAATGCTAGGCTGGGCATGG - Intronic
998991862 5:147825729-147825751 TTAAAGAGTTTGGCTGGGCATGG - Intronic
999138222 5:149338163-149338185 TTAAAATGCATGGCTTGGCCAGG + Intronic
999368967 5:151041359-151041381 GAAAAATGTATGGCCAGGCATGG - Intronic
999601843 5:153275122-153275144 TAAAAATGCATAGCTGGGCATGG + Intergenic
999660141 5:153852766-153852788 AAATCATGTATGGCTGGGCATGG - Intergenic
1000002536 5:157152575-157152597 GTAGAGTGGTTGGCTGGGCACGG - Intronic
1001365549 5:171134976-171134998 GAAAAGTTTAAGGCTGGGCATGG + Intronic
1001687201 5:173602749-173602771 GTAACATGTAGAGCTGGGGAAGG - Intergenic
1001921377 5:175602637-175602659 ATAAAATTTTTGGCTGGGCACGG + Intergenic
1002046884 5:176546628-176546650 TTAAAAATTGTGGCTGGGCAGGG + Intronic
1002120760 5:177002509-177002531 ATAATAAATATGGCTGGGCACGG + Intronic
1002555110 5:180031194-180031216 ATTAAATTTAGGGCTGGGCACGG + Intronic
1003000482 6:2327287-2327309 GGAAAATATTTGGCTGGGCGTGG - Intergenic
1003106149 6:3217547-3217569 GAAAAATCCATAGCTGGGCATGG - Intergenic
1003557887 6:7157139-7157161 GTAAAATATTTGGCTGGGCGCGG + Intronic
1003585221 6:7382589-7382611 GAGAAATGCAGGGCTGGGCACGG - Intronic
1003877861 6:10454077-10454099 ATAAAATAAATAGCTGGGCATGG - Intergenic
1004069532 6:12285848-12285870 TAAAAATGTTTGGCTGGGCATGG - Intergenic
1004391196 6:15211127-15211149 TAAAAATGTAGGACTGGGCATGG - Intergenic
1004657067 6:17673076-17673098 GTAAAACTTCTGGCTGGGCGCGG + Intronic
1004773771 6:18818639-18818661 GTAAAAAAAATAGCTGGGCATGG + Intergenic
1005547628 6:26886404-26886426 TTAAAAATTAGGGCTGGGCATGG + Intergenic
1005695982 6:28353260-28353282 AGAAAATGTAAGGCTGGGCTGGG - Intronic
1005830717 6:29669209-29669231 GAAATATTTATGGCCGGGCACGG - Intronic
1005877952 6:30028674-30028696 ATAAATTGAGTGGCTGGGCACGG + Intergenic
1006202019 6:32302160-32302182 TTAAAATATTTGGCTGGGCATGG + Intronic
1006447574 6:34088410-34088432 GTAAAATGTGTGGTCGGGTACGG - Intronic
1006540960 6:34739342-34739364 AAAAAAAGTAGGGCTGGGCATGG - Intergenic
1006543959 6:34764003-34764025 AAAAAATTTTTGGCTGGGCATGG - Intronic
1007164300 6:39817886-39817908 GAAAAAATTCTGGCTGGGCATGG + Intronic
1007560865 6:42807119-42807141 AAAACATGAATGGCTGGGCATGG - Intronic
1007657302 6:43458513-43458535 AAAAAATGTTAGGCTGGGCACGG - Intergenic
1007865081 6:44959178-44959200 GTTAAATATTTGGCTAGGCACGG - Intronic
1008075701 6:47143487-47143509 AAAAAATTTGTGGCTGGGCATGG - Intergenic
1008509456 6:52262646-52262668 ATAAAGTGTACAGCTGGGCACGG - Intergenic
1008916456 6:56792775-56792797 GACAAATGGTTGGCTGGGCATGG + Intronic
1009894191 6:69726861-69726883 TTAAAATAACTGGCTGGGCAAGG + Intronic
1010237038 6:73583633-73583655 TTAGAAAATATGGCTGGGCATGG - Intergenic
1010409843 6:75548761-75548783 AAAAAAAATATGGCTGGGCATGG + Intergenic
1010954912 6:82079028-82079050 TTAAAATCTTTGGCTGGGCATGG - Intergenic
1011056105 6:83205168-83205190 GTAAAATGTATGGCTAGAGTAGG - Intergenic
1011457797 6:87570708-87570730 ATAAAAAATCTGGCTGGGCATGG - Intronic
1011606961 6:89115570-89115592 GTAAAATATAAGGCTGGGCGCGG - Intronic
1011636044 6:89374442-89374464 GTAAATTGTGAGGGTGGGCACGG + Intronic
1012128384 6:95458694-95458716 GTAGAAGGTATGGCTGCACATGG - Intergenic
1012779269 6:103536068-103536090 GTAAAAAGTCTATCTGGGCATGG - Intergenic
1013035674 6:106379867-106379889 GTAAAAATCATGGCTGAGCATGG - Intergenic
1013069934 6:106719535-106719557 ATAAAATATACAGCTGGGCACGG + Intergenic
1013523712 6:110955616-110955638 TTAAAATTATTGGCTGGGCATGG + Intergenic
1013782465 6:113744027-113744049 GTAAAATGTTCAGCCGGGCATGG + Intergenic
1013950318 6:115772225-115772247 GTAAAATGTAGGGCTTGAGAGGG + Intergenic
1013988156 6:116221616-116221638 GTAAAATACATGGCTCCGCACGG - Intronic
1014158099 6:118135536-118135558 GCCAAATGAAGGGCTGGGCAGGG - Intronic
1014172200 6:118291081-118291103 GTCAATTTTCTGGCTGGGCATGG - Intronic
1014291605 6:119564635-119564657 TTAAAACTTCTGGCTGGGCATGG - Intergenic
1014430094 6:121360066-121360088 ATAAAAAATATAGCTGGGCATGG - Intergenic
1015241809 6:131032854-131032876 AAAAAATTTAAGGCTGGGCACGG + Intronic
1015596223 6:134869991-134870013 GCAAAAATTATGGCCGGGCATGG + Intergenic
1015917477 6:138232214-138232236 GAAAAAGGTGGGGCTGGGCACGG + Intronic
1015953192 6:138574534-138574556 TAAAAATATCTGGCTGGGCACGG + Intronic
1016001207 6:139043426-139043448 GTAATAGGAAGGGCTGGGCACGG + Intergenic
1016237212 6:141882728-141882750 TTAAAATATTGGGCTGGGCATGG + Intergenic
1016263571 6:142205012-142205034 TAAAAATAAATGGCTGGGCACGG - Intronic
1016552369 6:145296193-145296215 GTCAAATGTATTGCTTGGCCTGG - Intergenic
1016715055 6:147216099-147216121 TAAAAATTCATGGCTGGGCACGG + Intronic
1016974848 6:149797392-149797414 GTAGGATATATGGCCGGGCATGG + Intronic
1016975126 6:149800173-149800195 GTAAGGTTTCTGGCTGGGCATGG + Intronic
1017466034 6:154694623-154694645 ATATAATTCATGGCTGGGCATGG + Intergenic
1017617158 6:156257788-156257810 AAAAAATGTCTGGCTGGGCGCGG + Intergenic
1018012489 6:159684325-159684347 GTAAAACATTTGGCTGGGCATGG + Intronic
1018144438 6:160870337-160870359 GTAAAACACTTGGCTGGGCATGG - Intergenic
1018171229 6:161144686-161144708 GTAACATTTTCGGCTGGGCACGG + Intronic
1018389204 6:163329899-163329921 GTAAAATGAATGGTGGGGCCAGG + Intergenic
1018492757 6:164312595-164312617 GTAAAATGTTTGGCTGGGCACGG + Intergenic
1018702639 6:166439396-166439418 GAAAAATATATGGCCGGGCACGG - Intronic
1018797807 6:167200857-167200879 GTAAAAAGTGTGGCTGGTGAGGG - Intergenic
1019416832 7:931695-931717 GTGAAATGTATGGCTGTGAACGG + Intronic
1019484393 7:1282554-1282576 GTAAAAACGATGGCTGGGCACGG - Intergenic
1020178829 7:5905491-5905513 GAAAGATGAAAGGCTGGGCACGG + Intronic
1020265650 7:6558194-6558216 GTAAAAGTTACAGCTGGGCACGG + Intergenic
1020304103 7:6819522-6819544 GAAAGATGAAAGGCTGGGCACGG - Intronic
1021395564 7:20143677-20143699 GCCAAATGTAGGGCTGGGCGTGG - Intronic
1021517937 7:21507459-21507481 GTGAGATGTATGGAGGGGCATGG + Intronic
1021713429 7:23439260-23439282 GTGACATGTTTGGCCGGGCACGG + Intronic
1022266085 7:28756260-28756282 GTACATTGAGTGGCTGGGCACGG + Intronic
1022448894 7:30495288-30495310 GAAAAATCTGGGGCTGGGCACGG - Intergenic
1022746870 7:33181385-33181407 ATAAAAGATTTGGCTGGGCATGG - Intronic
1022956878 7:35389253-35389275 GTCAAAAGGATGGCTGGGCAAGG + Intergenic
1023065400 7:36372812-36372834 GTAAAAATGATGGCTGGGCATGG + Intronic
1023257373 7:38325405-38325427 TTAAAATCTATGGTTGGGCTGGG - Intergenic
1023424460 7:40020800-40020822 TTAAAAAGTAGGGGTGGGCACGG + Intronic
1023846692 7:44124806-44124828 TTAAAATATAAGGCTGGGCGTGG - Intergenic
1024336946 7:48218391-48218413 GTAAGATTTCTGGCTGGTCATGG + Intronic
1024640439 7:51324078-51324100 ATAAAATGATTGGCCGGGCATGG - Intergenic
1024645162 7:51364773-51364795 GTATATTCTAAGGCTGGGCATGG + Intergenic
1024927347 7:54631291-54631313 GCACAATCTATGGCTGGGCATGG + Intergenic
1024941263 7:54765533-54765555 TTAAAATGAGAGGCTGGGCATGG + Intergenic
1025087882 7:56038001-56038023 AGAAAATTTGTGGCTGGGCACGG - Intronic
1025277102 7:57592500-57592522 ACAAAAAATATGGCTGGGCATGG - Intergenic
1025700731 7:63817894-63817916 GAAAAAAGTGTGGCTGGTCATGG - Intergenic
1025729492 7:64097406-64097428 ATAAAAATTAAGGCTGGGCATGG - Intronic
1025767591 7:64470645-64470667 GAAGAATGTGTGGCCGGGCACGG + Intergenic
1025900000 7:65736364-65736386 AGAAAATTTGTGGCTGGGCACGG - Intergenic
1025957173 7:66191965-66191987 GTAAAAAACAAGGCTGGGCACGG + Intergenic
1026059773 7:67015670-67015692 ATGAAATTTTTGGCTGGGCATGG + Intronic
1026096047 7:67347301-67347323 TTAAAAAATAAGGCTGGGCACGG + Intergenic
1026170068 7:67946163-67946185 GAAAAAAGCATGGCTGGTCACGG - Intergenic
1026170722 7:67951683-67951705 TAAAATTTTATGGCTGGGCACGG - Intergenic
1026243171 7:68594882-68594904 TCAAAATAGATGGCTGGGCATGG + Intergenic
1026269428 7:68823469-68823491 TTAAAAATTAGGGCTGGGCATGG - Intergenic
1026622826 7:71965319-71965341 TTAAAAAGTGAGGCTGGGCATGG - Intronic
1026662540 7:72314703-72314725 TTAAAAAATATGGCCGGGCACGG - Intronic
1026865214 7:73819710-73819732 AAAAACTGTGTGGCTGGGCAAGG - Intronic
1026919639 7:74145656-74145678 AGAAAATGACTGGCTGGGCATGG - Intergenic
1026958912 7:74396265-74396287 TTAAAATGTCTTGCTGGCCAGGG + Intronic
1027216107 7:76185116-76185138 ATAAAATGTTTAGCTGGGTATGG - Intergenic
1027794520 7:82675544-82675566 GAAAAATGTGTGGTTTGGCATGG + Intergenic
1028186747 7:87795585-87795607 TTAAAAATAATGGCTGGGCATGG + Intronic
1028530197 7:91830157-91830179 TTAAAATGCCTGGCTGAGCACGG - Intronic
1028547468 7:92019715-92019737 GAGAAATGTAAGGCCGGGCATGG + Intronic
1028553142 7:92094139-92094161 ATAAAAATTTTGGCTGGGCATGG - Intronic
1028712011 7:93920496-93920518 GTAAAATGTATAGTAAGGCAGGG - Intergenic
1028823235 7:95237484-95237506 TAAAAAAATATGGCTGGGCATGG - Intronic
1028907153 7:96167806-96167828 AAAAAATGCATGGCTGGGCGGGG + Intronic
1029139415 7:98400188-98400210 GTAAAATGTGTAGCTGGTCAGGG + Intronic
1029146481 7:98449914-98449936 AAAAAATTTTTGGCTGGGCATGG - Intergenic
1029516588 7:101027276-101027298 ATAAAAATTAGGGCTGGGCATGG - Intronic
1029528005 7:101107256-101107278 ATAAAATGATTAGCTGGGCATGG - Intergenic
1029546967 7:101215790-101215812 GAAAAATGTGTGCCTGGGCGTGG - Intronic
1029567068 7:101346020-101346042 GTGATTAGTATGGCTGGGCATGG + Intergenic
1029628791 7:101737416-101737438 GAAAGAGGTTTGGCTGGGCATGG + Intergenic
1029724192 7:102391305-102391327 ATAAAATATTAGGCTGGGCAAGG + Intronic
1029933023 7:104393425-104393447 ACAAAATGTCAGGCTGGGCATGG + Intronic
1030004605 7:105104876-105104898 TTAAAAAGCTTGGCTGGGCACGG + Intronic
1030027051 7:105334545-105334567 GTATACAGTTTGGCTGGGCACGG + Intronic
1030167856 7:106572492-106572514 GAAAAGTGAAGGGCTGGGCATGG - Intergenic
1030652895 7:112134427-112134449 GTAAACTTAATGGCTGGGCACGG + Intronic
1030918829 7:115353508-115353530 GTAAAATTCTGGGCTGGGCATGG + Intergenic
1031494123 7:122425269-122425291 AAAAAATGTATGGCTGAGTATGG - Intronic
1031615569 7:123875373-123875395 ATAAGATTTATGGCGGGGCACGG + Intronic
1031716717 7:125117436-125117458 AGAATATGTATGACTGGGCATGG + Intergenic
1031730743 7:125298033-125298055 TTTAAATGTGTGGCTGGGCACGG + Intergenic
1032015190 7:128375285-128375307 ATAAAGTGTTAGGCTGGGCATGG + Intergenic
1032057537 7:128695832-128695854 AAATAATATATGGCTGGGCATGG - Intergenic
1032148986 7:129411467-129411489 GAATCATTTATGGCTGGGCACGG + Intronic
1032199085 7:129806449-129806471 TTAAAAATAATGGCTGGGCAGGG + Intergenic
1032403789 7:131641527-131641549 CTAAGATGTGTGGCCGGGCACGG - Intergenic
1032593766 7:133218295-133218317 GAAAAACTTAGGGCTGGGCACGG + Intergenic
1032617258 7:133487416-133487438 GCCAAATTTATGGCTGCGCATGG + Intronic
1033316921 7:140305095-140305117 GAAAAAAATATGGCTGGGCATGG - Intronic
1033381385 7:140823112-140823134 GTAAAACGTTAGGCTGGACACGG - Intronic
1033388935 7:140907549-140907571 GGAAAAAAAATGGCTGGGCACGG - Intronic
1033796454 7:144850975-144850997 GAAAAATGGAGGGCTGGGCGTGG - Intergenic
1034140337 7:148809862-148809884 GTAGAATGTAAGGCTGTGTAGGG - Intronic
1034149404 7:148902164-148902186 GTAAAAAAGCTGGCTGGGCATGG - Intergenic
1034178390 7:149118515-149118537 GTAAAATGAATGAATGGGCCGGG + Intronic
1035130832 7:156651502-156651524 ATTAAAAATATGGCTGGGCATGG - Intronic
1035196493 7:157225656-157225678 CTGAAATGTGAGGCTGGGCATGG + Intronic
1035416953 7:158697309-158697331 TAAAAATAGATGGCTGGGCATGG + Intronic
1035602112 8:902866-902888 GGAAAGTGTGTGGGTGGGCAGGG + Intergenic
1035602164 8:902994-903016 GGAAAGTGTGTGGGTGGGCAGGG + Intergenic
1036925315 8:12899206-12899228 GAAATATAAATGGCTGGGCATGG - Intergenic
1037108960 8:15142898-15142920 GTAGCATTTTTGGCTGGGCACGG - Intronic
1037316546 8:17604821-17604843 AGAAAATGCATGGCTGGGCATGG + Intronic
1037384565 8:18324412-18324434 AAAAAATATTTGGCTGGGCACGG + Intergenic
1037396216 8:18446808-18446830 TAAAAACGTCTGGCTGGGCACGG - Intergenic
1037721351 8:21447054-21447076 GCAAAATGTAAGGCTGGAGACGG + Intergenic
1037909215 8:22733764-22733786 GTGAAATGTAGGGGTGGGGATGG + Intronic
1037946322 8:22991720-22991742 GTAAGGGGGATGGCTGGGCAGGG + Intronic
1039046703 8:33457057-33457079 TTAAAAGGTTTGGCCGGGCATGG - Intronic
1039049502 8:33480054-33480076 GGGAAATATTTGGCTGGGCACGG - Intronic
1039336044 8:36590583-36590605 TTAAAATTCTTGGCTGGGCATGG + Intergenic
1039390225 8:37174348-37174370 GAAAAAGGAAGGGCTGGGCATGG - Intergenic
1039479932 8:37865057-37865079 ATAAAATGTAAGGCTGGGTGTGG - Intronic
1039935468 8:42040441-42040463 GAAAAATTGGTGGCTGGGCATGG + Intronic
1039942318 8:42101867-42101889 GTAAACTGCCTGGCCGGGCACGG + Intergenic
1040028922 8:42806662-42806684 AAAACAAGTATGGCTGGGCATGG - Intergenic
1040100683 8:43500485-43500507 GAAACATTTAAGGCTGGGCACGG + Intergenic
1040455440 8:47593174-47593196 GTAAAAAACCTGGCTGGGCATGG - Intronic
1040599286 8:48868771-48868793 TTAAAACTTATGGCCGGGCAAGG - Intergenic
1041246099 8:55889734-55889756 GTCAAAAGTAAGGCAGGGCAGGG + Intronic
1041246232 8:55891017-55891039 TTCCATTGTATGGCTGGGCACGG - Intronic
1041453851 8:58036325-58036347 ATAAAATGTCTGGCTGAGCCTGG - Intronic
1041689315 8:60673643-60673665 GTAATAAGTGAGGCTGGGCATGG - Intergenic
1041794059 8:61727822-61727844 AAAAAATGCAAGGCTGGGCATGG - Intergenic
1042025211 8:64415646-64415668 TTAAAAGATAAGGCTGGGCATGG - Intergenic
1042061069 8:64818366-64818388 GTGAAGTGTAAGGCCGGGCATGG - Intergenic
1042179572 8:66072780-66072802 TTAAAATTTATTGCTGGGCTTGG - Intronic
1042529857 8:69803696-69803718 CTAAAGTGTATGGCTGGGTGTGG + Intronic
1042543409 8:69929521-69929543 GTAAAATGTTAGACTGGGCGTGG + Intergenic
1042599295 8:70482242-70482264 GTAAAAAGATTAGCTGGGCATGG - Intergenic
1042671662 8:71270828-71270850 GTAGATTTTATGGCTGGGCGTGG + Intronic
1043167423 8:76921789-76921811 AAAAAATTTTTGGCTGGGCATGG + Intergenic
1043239428 8:77914138-77914160 GTAAAATCTATGGCTGGGAAGGG + Intergenic
1043389473 8:79778155-79778177 GTAAAAATATTGGCTGGGCATGG - Intergenic
1043416697 8:80058505-80058527 TAAAAATATATGGCTGGGCATGG + Intronic
1043460887 8:80458923-80458945 CAAGAATGAATGGCTGGGCATGG + Intergenic
1043667403 8:82833519-82833541 ATAATATTTGTGGCTGGGCACGG + Intergenic
1044131973 8:88534640-88534662 ATATTATGTATGGCTGGGCGTGG + Intergenic
1044666202 8:94636812-94636834 TAAAAATGTAAGGCCGGGCATGG - Intergenic
1045147701 8:99365803-99365825 GAAAATTGGAGGGCTGGGCATGG - Intronic
1045279542 8:100737994-100738016 ATAAAGTTTTTGGCTGGGCACGG - Intergenic
1045524835 8:102932785-102932807 GGAAGAGGAATGGCTGGGCACGG - Intronic
1045527704 8:102955679-102955701 TTAAAATGAGGGGCTGGGCATGG + Intronic
1045532511 8:102998274-102998296 AGAAAATGTGTGGCTGGGCACGG - Intergenic
1045742464 8:105377464-105377486 GAAAAATGAATGACTGGGCTGGG + Intronic
1045983804 8:108223925-108223947 ATAAAAAGTATGGCCAGGCACGG + Intronic
1046852604 8:118992407-118992429 GTAAAATGGTTGGCAGGACATGG + Intergenic
1047021456 8:120779212-120779234 ATAAACTGTAAGGCTGGGCGTGG + Intronic
1047094254 8:121607149-121607171 GTAAATTTGAAGGCTGGGCATGG - Intergenic
1047232139 8:123006720-123006742 GAAACATGCATGGGTGGGCACGG - Intergenic
1047274979 8:123398970-123398992 ATACTATTTATGGCTGGGCACGG + Intronic
1047396714 8:124506870-124506892 CTAAAAATCATGGCTGGGCAAGG + Intronic
1047963743 8:130030057-130030079 GTGACTTTTATGGCTGGGCATGG - Intergenic
1048507926 8:135037198-135037220 TTAAAATGCAAGGCTGGGCACGG - Intergenic
1048643495 8:136390978-136391000 GAAAAATGTATGGGTTAGCATGG - Intergenic
1049935137 9:494169-494191 TTAAAATGTATTGCTGGGTGCGG - Intronic
1050435445 9:5605180-5605202 ATAAAAAATATGGCTAGGCATGG + Intergenic
1050468044 9:5952368-5952390 GTAAAATGTGTTGCTGACCATGG - Intronic
1051201738 9:14633891-14633913 GCAAAATGTTTGGGTGGGGATGG - Intronic
1051265059 9:15302030-15302052 GTTAAGTGTAAGGTTGGGCACGG + Intronic
1051391784 9:16572936-16572958 ATATAATTTATGGCCGGGCACGG + Intronic
1051657854 9:19399944-19399966 ACAAGATCTATGGCTGGGCATGG + Intergenic
1051885177 9:21885194-21885216 ATAAAATCTCTGGGTGGGCATGG - Intronic
1052298928 9:26931749-26931771 GAAAGATGTAGGGCTGGGCACGG + Intronic
1052719974 9:32162588-32162610 ATAAACTACATGGCTGGGCATGG - Intergenic
1052869525 9:33490142-33490164 AAAAAATTTAGGGCTGGGCAAGG - Intergenic
1052924666 9:34004810-34004832 GTAAATTTTAAGGCTGGGCACGG + Intronic
1053209336 9:36214264-36214286 ATAGAAAGCATGGCTGGGCATGG - Intronic
1053213693 9:36253566-36253588 GTAAGATTTGTGGCTGGGCGCGG - Intronic
1053260502 9:36659304-36659326 TAAAAAAGTATGGCCGGGCACGG - Intronic
1053261371 9:36668059-36668081 GTAAAATGCAGGTCTGGGCATGG - Intronic
1053352288 9:37421650-37421672 TTTAAATGTATGGCTGGGCGCGG - Intergenic
1053504686 9:38631489-38631511 ATTATATGTATAGCTGGGCACGG - Intergenic
1053580429 9:39398534-39398556 ATATTAAGTATGGCTGGGCATGG + Intergenic
1053641104 9:40081110-40081132 AGAAAATTTGTGGCTGGGCACGG + Intergenic
1053765034 9:41384359-41384381 AGAAAATTTGTGGCTGGGCACGG - Intergenic
1053844929 9:42226612-42226634 ATATTAAGTATGGCTGGGCATGG + Intergenic
1054102016 9:60957339-60957361 ATATTAAGTATGGCTGGGCATGG + Intergenic
1054321846 9:63677405-63677427 AGAAAATTTGTGGCTGGGCACGG + Intergenic
1054543649 9:66295521-66295543 AGAAAATTTGTGGCTGGGCACGG - Intergenic
1054726376 9:68655403-68655425 TTAAACTGTGGGGCTGGGCATGG - Intergenic
1054783901 9:69192026-69192048 TTAAAACATACGGCTGGGCATGG - Intronic
1054890950 9:70251061-70251083 GTAAAAACTGTGGGTGGGCACGG - Intergenic
1055021287 9:71672987-71673009 GTAAGATGTTAGGCTGGGCATGG + Intergenic
1055064531 9:72105322-72105344 TTAAAAGGAATGGCTGGGCACGG + Intergenic
1055286389 9:74732901-74732923 GTAAAAAATCTGGCTGGGCGCGG + Intronic
1055612448 9:78037076-78037098 TTAAAATGCTGGGCTGGGCATGG + Intergenic
1056007485 9:82287534-82287556 AAAAGATATATGGCTGGGCATGG + Intergenic
1056375925 9:86010950-86010972 TTAAAATTATTGGCTGGGCATGG + Intronic
1056524919 9:87433974-87433996 GTAAAATGTGTGGCAGGAGAAGG + Intergenic
1056640716 9:88368219-88368241 GTGAGATATAAGGCTGGGCATGG + Intergenic
1057152071 9:92805162-92805184 GTGAAATGTTTTGCTGGGAAAGG + Intergenic
1057334707 9:94146764-94146786 GTAAAATGTATGGGTGTGGCTGG - Intergenic
1057342468 9:94214866-94214888 ATAATATGTGGGGCTGGGCATGG - Intergenic
1057774049 9:97991111-97991133 AAAAAAAGTTTGGCTGGGCACGG - Intronic
1057900003 9:98941373-98941395 GCAAAATTGAAGGCTGGGCATGG + Intergenic
1058127781 9:101215434-101215456 ATAAAAAATTTGGCTGGGCATGG - Intronic
1058278922 9:103086102-103086124 TTAAAATTAATGGCTGGGCATGG - Intergenic
1058282144 9:103128843-103128865 TAAAAATGCATGGCTGGGCTTGG - Intergenic
1058306350 9:103446062-103446084 TTAAAATGTATGGCTTGTCTTGG - Intergenic
1058398467 9:104584762-104584784 AAGAAATGTATGGCTGGGGAAGG + Intergenic
1058439702 9:104995321-104995343 ATAAAAATTAGGGCTGGGCACGG + Intergenic
1058696451 9:107563238-107563260 GAAAGAAATATGGCTGGGCATGG + Intergenic
1059031446 9:110702031-110702053 ATCATAGGTATGGCTGGGCATGG - Intronic
1059153403 9:111969018-111969040 ATAAAAGTTAAGGCTGGGCATGG + Intergenic
1059227610 9:112686786-112686808 GAAAACTTTTTGGCTGGGCACGG - Exonic
1059321469 9:113473675-113473697 GTAAACAGGTTGGCTGGGCATGG - Intronic
1059788158 9:117609771-117609793 GTGACATATATGGCTGGGCACGG + Intergenic
1059890456 9:118796211-118796233 ATAAAATAATTGGCTGGGCACGG - Intergenic
1060132679 9:121119782-121119804 GAAAGATGAAGGGCTGGGCATGG - Intronic
1060617315 9:125029410-125029432 TTAAAATGTATGGCCAGGCATGG - Intronic
1061236831 9:129348135-129348157 TTACAATTTTTGGCTGGGCACGG + Intergenic
1061560893 9:131402268-131402290 GTAAAATGGTTGGCAGGGCAAGG - Intronic
1061567104 9:131448258-131448280 ATAAAAAGGAAGGCTGGGCACGG + Intronic
1202788879 9_KI270719v1_random:64185-64207 AGAAAATTTGTGGCTGGGCACGG + Intergenic
1185552257 X:992568-992590 TAAAAATGTAAGGCCGGGCATGG + Intergenic
1185555203 X:1015798-1015820 GCAAACTGGAAGGCTGGGCACGG - Intergenic
1185773558 X:2784290-2784312 TTAAAATGTGTGGCTGGGCATGG + Intronic
1186461341 X:9750851-9750873 CAGAAATGTATGGCCGGGCACGG - Intronic
1186795262 X:13041461-13041483 TTAAAGTCTGTGGCTGGGCACGG - Intronic
1186969047 X:14820055-14820077 GTGAAATGTAAGGCTGGAGAAGG - Intergenic
1187339314 X:18407229-18407251 GTAAAGATTAGGGCTGGGCATGG + Intergenic
1187499888 X:19831124-19831146 AGAAAATGTTTGGCAGGGCATGG + Intronic
1187505122 X:19873378-19873400 GTAAAAACCCTGGCTGGGCATGG + Intronic
1187683793 X:21795953-21795975 AGAAAATGTGGGGCTGGGCACGG - Intergenic
1187727962 X:22223452-22223474 TTAGAGTGAATGGCTGGGCATGG + Intronic
1187893086 X:23955512-23955534 ATAAAATTTGGGGCTGGGCACGG - Intergenic
1187928565 X:24273274-24273296 ATAAAATTCACGGCTGGGCACGG + Intergenic
1188125965 X:26369111-26369133 TTAAAAACTATGGCTGGGAATGG - Intergenic
1188166077 X:26865891-26865913 GTAAAATGTATATCTGAGAAAGG + Intergenic
1188335012 X:28920922-28920944 CTAAAATGTATTACTGGGCTGGG - Intronic
1188550635 X:31360962-31360984 TTAAAAGGTGGGGCTGGGCATGG + Intronic
1188656747 X:32706798-32706820 GTAAAAACTATGGCTGGGCATGG + Intronic
1188948488 X:36338175-36338197 GTATTATGGAAGGCTGGGCACGG - Intronic
1189030035 X:37441058-37441080 TTAAAATAGATGGCCGGGCATGG - Intronic
1189258899 X:39663348-39663370 TAATAATTTATGGCTGGGCACGG + Intergenic
1189488467 X:41450974-41450996 GCAAAAATTATGGCTGGGCGTGG - Intronic
1189738119 X:44092018-44092040 GCTACATTTATGGCTGGGCATGG - Intergenic
1190012922 X:46800876-46800898 ATAAAATTTCTGGCTGGGCACGG + Intergenic
1190427041 X:50343410-50343432 GTAAAAAGTAAAGCCGGGCATGG + Intronic
1190501679 X:51085304-51085326 TTAAATTTTGTGGCTGGGCACGG + Intergenic
1190513461 X:51197402-51197424 AAAAAATCTTTGGCTGGGCATGG + Intergenic
1190821860 X:53980920-53980942 GAAAGATGTCTGGCTGGGCCTGG + Intronic
1190851122 X:54243101-54243123 TTTATATGTGTGGCTGGGCATGG - Intronic
1191968377 X:66786173-66786195 AAAAGATTTATGGCTGGGCATGG + Intergenic
1192463656 X:71339715-71339737 TTAAAAATTATGGCCGGGCATGG + Intergenic
1192629134 X:72761423-72761445 TCAAAAGGTAGGGCTGGGCACGG - Intergenic
1192652576 X:72959391-72959413 TCAAAAGGTAGGGCTGGGCACGG + Intergenic
1193161697 X:78236101-78236123 ATAAAAAGTAGGGCCGGGCACGG - Intergenic
1194093354 X:89604191-89604213 ATATAATGCCTGGCTGGGCATGG + Intergenic
1194236494 X:91390632-91390654 TCAAAACTTATGGCTGGGCACGG + Intergenic
1195085033 X:101405921-101405943 AAAAAAAGTAAGGCTGGGCACGG + Intronic
1195676087 X:107507833-107507855 GTAAAATGAGTGACTGGGGATGG - Intergenic
1196188970 X:112775044-112775066 GTAAAATGGATAGCTGGGGTTGG - Exonic
1196402459 X:115330611-115330633 GTAAGATGTAGGGCCGGACACGG - Intergenic
1196537663 X:116866737-116866759 GAAAAATTTATGGCCAGGCACGG - Intergenic
1196640236 X:118051248-118051270 ATAAAATTTATGGCCGGGTACGG + Intronic
1196782636 X:119397363-119397385 GTAAAATGTATGGCCGGGCGCGG - Intergenic
1196803488 X:119564204-119564226 GAAAAATCTAAGGCTGGGCGCGG + Intronic
1197219597 X:123898642-123898664 ATAAAAGATAAGGCTGGGCATGG - Intronic
1197250293 X:124209103-124209125 GAAAAATTCCTGGCTGGGCATGG + Intronic
1197691091 X:129501901-129501923 TAAAAATGTTTGGCCGGGCAGGG - Intronic
1197870792 X:131060504-131060526 GTGAACTGTGTGGCTGTGCATGG - Intronic
1198201756 X:134427598-134427620 GTAAAATGTATGACTTTGTATGG + Exonic
1198395324 X:136213845-136213867 TGAAAATGCCTGGCTGGGCACGG + Intronic
1198825537 X:140694754-140694776 GAAAAATGCTTGGCTGGGCACGG + Intergenic
1198871273 X:141179095-141179117 GTTAAATGTAAGGTTGGGCGTGG + Intergenic
1199241038 X:145547979-145548001 GAAAAAATTAGGGCTGGGCACGG + Intergenic
1199264133 X:145810565-145810587 ATAACAATTATGGCTGGGCACGG + Intergenic
1199294892 X:146145892-146145914 GTAGAATGTGTGGCTGGGCCCGG - Intergenic
1199729035 X:150612691-150612713 TTAAAAAATTTGGCTGGGCATGG + Intronic
1199827166 X:151511846-151511868 AGAAAATATTTGGCTGGGCACGG + Intergenic
1199869414 X:151884211-151884233 TTATAAAGTCTGGCTGGGCACGG + Intergenic
1200240763 X:154492126-154492148 GTATATTATTTGGCTGGGCACGG - Intergenic
1200745204 Y:6898073-6898095 ATGAAAAATATGGCTGGGCACGG - Intergenic
1201273347 Y:12276940-12276962 ATCCAATGTTTGGCTGGGCATGG - Intergenic
1201504500 Y:14682710-14682732 GTAAAATTTTAGGCTGGGCATGG + Intronic
1201609998 Y:15830526-15830548 GTAAGATTGTTGGCTGGGCATGG - Intergenic
1201734787 Y:17246748-17246770 GTAAGATGTATGGGTGGGAGGGG - Intergenic
1201780762 Y:17719911-17719933 TTAAAATTCATGGCCGGGCATGG + Intergenic
1201820791 Y:18186079-18186101 TTAAAATTCATGGCCGGGCATGG - Intergenic
1201953912 Y:19599472-19599494 TTAAAAGGTAAGGCTGGGCATGG - Intergenic
1202588496 Y:26457099-26457121 AAAAAATTTTTGGCTGGGCATGG - Intergenic