ID: 1167230788

View in Genome Browser
Species Human (GRCh38)
Location 19:48281823-48281845
Sequence CCTTATAAGAAGAGGAAATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3138
Summary {0: 9, 1: 140, 2: 478, 3: 958, 4: 1553}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167230788_1167230793 -2 Left 1167230788 19:48281823-48281845 CCAGATTTCCTCTTCTTATAAGG 0: 9
1: 140
2: 478
3: 958
4: 1553
Right 1167230793 19:48281844-48281866 GGACACCAGTCACTGGATTAGGG 0: 7
1: 67
2: 212
3: 432
4: 824
1167230788_1167230792 -3 Left 1167230788 19:48281823-48281845 CCAGATTTCCTCTTCTTATAAGG 0: 9
1: 140
2: 478
3: 958
4: 1553
Right 1167230792 19:48281843-48281865 AGGACACCAGTCACTGGATTAGG 0: 8
1: 61
2: 152
3: 265
4: 374
1167230788_1167230791 -9 Left 1167230788 19:48281823-48281845 CCAGATTTCCTCTTCTTATAAGG 0: 9
1: 140
2: 478
3: 958
4: 1553
Right 1167230791 19:48281837-48281859 CTTATAAGGACACCAGTCACTGG 0: 15
1: 111
2: 283
3: 589
4: 893

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167230788 Original CRISPR CCTTATAAGAAGAGGAAATC TGG (reversed) Intronic
Too many off-targets to display for this crispr