ID: 1167230788 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 19:48281823-48281845 |
| Sequence | CCTTATAAGAAGAGGAAATC TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 3138 | |||
| Summary | {0: 9, 1: 140, 2: 478, 3: 958, 4: 1553} |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1167230788_1167230793 | -2 | Left | 1167230788 | 19:48281823-48281845 | CCAGATTTCCTCTTCTTATAAGG | 0: 9 1: 140 2: 478 3: 958 4: 1553 |
||
| Right | 1167230793 | 19:48281844-48281866 | GGACACCAGTCACTGGATTAGGG | 0: 7 1: 67 2: 212 3: 432 4: 824 |
||||
| 1167230788_1167230792 | -3 | Left | 1167230788 | 19:48281823-48281845 | CCAGATTTCCTCTTCTTATAAGG | 0: 9 1: 140 2: 478 3: 958 4: 1553 |
||
| Right | 1167230792 | 19:48281843-48281865 | AGGACACCAGTCACTGGATTAGG | 0: 8 1: 61 2: 152 3: 265 4: 374 |
||||
| 1167230788_1167230791 | -9 | Left | 1167230788 | 19:48281823-48281845 | CCAGATTTCCTCTTCTTATAAGG | 0: 9 1: 140 2: 478 3: 958 4: 1553 |
||
| Right | 1167230791 | 19:48281837-48281859 | CTTATAAGGACACCAGTCACTGG | 0: 15 1: 111 2: 283 3: 589 4: 893 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1167230788 | Original CRISPR | CCTTATAAGAAGAGGAAATC TGG (reversed) | Intronic | ||
| Too many off-targets to display for this crispr | |||||