ID: 1167234117

View in Genome Browser
Species Human (GRCh38)
Location 19:48303531-48303553
Sequence CCATCTGTGCTGGAGGAACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 251
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 227}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167234117_1167234123 -8 Left 1167234117 19:48303531-48303553 CCTTGTTCCTCCAGCACAGATGG 0: 1
1: 0
2: 0
3: 23
4: 227
Right 1167234123 19:48303546-48303568 ACAGATGGAGGAGTTCCCCAGGG 0: 1
1: 0
2: 0
3: 19
4: 197
1167234117_1167234124 4 Left 1167234117 19:48303531-48303553 CCTTGTTCCTCCAGCACAGATGG 0: 1
1: 0
2: 0
3: 23
4: 227
Right 1167234124 19:48303558-48303580 GTTCCCCAGGGCCAGAGCTGAGG 0: 1
1: 1
2: 4
3: 51
4: 415
1167234117_1167234122 -9 Left 1167234117 19:48303531-48303553 CCTTGTTCCTCCAGCACAGATGG 0: 1
1: 0
2: 0
3: 23
4: 227
Right 1167234122 19:48303545-48303567 CACAGATGGAGGAGTTCCCCAGG 0: 1
1: 0
2: 0
3: 16
4: 177
1167234117_1167234134 28 Left 1167234117 19:48303531-48303553 CCTTGTTCCTCCAGCACAGATGG 0: 1
1: 0
2: 0
3: 23
4: 227
Right 1167234134 19:48303582-48303604 CAGCCTGCACTGGACTCAGGGGG 0: 1
1: 0
2: 3
3: 23
4: 275
1167234117_1167234131 26 Left 1167234117 19:48303531-48303553 CCTTGTTCCTCCAGCACAGATGG 0: 1
1: 0
2: 0
3: 23
4: 227
Right 1167234131 19:48303580-48303602 GCCAGCCTGCACTGGACTCAGGG 0: 1
1: 1
2: 2
3: 24
4: 194
1167234117_1167234129 18 Left 1167234117 19:48303531-48303553 CCTTGTTCCTCCAGCACAGATGG 0: 1
1: 0
2: 0
3: 23
4: 227
Right 1167234129 19:48303572-48303594 GAGCTGAGGCCAGCCTGCACTGG 0: 1
1: 0
2: 0
3: 36
4: 258
1167234117_1167234130 25 Left 1167234117 19:48303531-48303553 CCTTGTTCCTCCAGCACAGATGG 0: 1
1: 0
2: 0
3: 23
4: 227
Right 1167234130 19:48303579-48303601 GGCCAGCCTGCACTGGACTCAGG 0: 1
1: 0
2: 2
3: 16
4: 226
1167234117_1167234133 27 Left 1167234117 19:48303531-48303553 CCTTGTTCCTCCAGCACAGATGG 0: 1
1: 0
2: 0
3: 23
4: 227
Right 1167234133 19:48303581-48303603 CCAGCCTGCACTGGACTCAGGGG 0: 1
1: 0
2: 5
3: 65
4: 287

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167234117 Original CRISPR CCATCTGTGCTGGAGGAACA AGG (reversed) Intronic
900395113 1:2450291-2450313 CCGCCTGTGCTGGAGGCCCACGG - Intronic
900796300 1:4710761-4710783 TTATCTGTGCTGGTGGAAGAGGG + Intronic
901326836 1:8371734-8371756 CAATCTGGGCTGGAGCAACAGGG + Intronic
904050007 1:27633301-27633323 CCATCTGTGAAGTGGGAACAGGG + Intronic
904482225 1:30801257-30801279 CCACCTTTGCTGGAGAACCAAGG + Intergenic
907326498 1:53641807-53641829 CCATCTGTGCTGCAAAAGCAAGG + Intronic
912841313 1:113041947-113041969 CCATCTCTGCTGGAGGGGAAAGG + Intergenic
915758614 1:158288031-158288053 GCATCTTTCCTGTAGGAACATGG + Intergenic
916169840 1:161993665-161993687 CCATCTGTGCTGGCGTACCTGGG + Intronic
920416840 1:205804551-205804573 CCATCTGCCCTGGAGCAACTTGG + Intronic
923063912 1:230500861-230500883 CCACCTGAGCTGGAGCCACACGG - Intergenic
923155539 1:231275518-231275540 CCATGAGTGCTCAAGGAACAAGG + Intronic
923318235 1:232802890-232802912 CCATGTGTGGTGTAGAAACATGG + Intergenic
1064173948 10:13057839-13057861 TCATCTGGGCTGGAGTACCATGG - Intronic
1064691260 10:17920712-17920734 CCATTTGTGCTGCAGACACAGGG - Intergenic
1066586565 10:36943045-36943067 CCATCTTTGCTGGAACAGCATGG + Intergenic
1067669303 10:48305113-48305135 CCAGCTCTGCTGGAGGAGCAAGG - Intergenic
1067842844 10:49695524-49695546 GCACCTGTGCTGAAGGAGCAGGG + Intronic
1070935970 10:80295455-80295477 CCATCTATGCTGGGGGATCAAGG + Intergenic
1071235864 10:83647337-83647359 CCTGCTGTGCTGGAGGGCCAGGG - Intergenic
1072641542 10:97214822-97214844 CCATCTGGTGTGGAGGAAAAGGG - Intronic
1074290347 10:112133511-112133533 TCGTCTGTGCTGGGGGAAGAAGG - Intergenic
1074442669 10:113492558-113492580 CAATCTTTGCTGGATGGACATGG + Intergenic
1075935499 10:126337541-126337563 CCAGCTGTGCTGGCAGCACATGG + Intronic
1076352158 10:129824540-129824562 GCTTCTGTGCTCGAGGCACATGG - Intergenic
1077237885 11:1490963-1490985 CCCTCTCAGCTGGAAGAACACGG + Intronic
1080270222 11:30443384-30443406 CCATCTGTGCTGGGTGACCTTGG - Intronic
1083705611 11:64512232-64512254 CCCTGTTTCCTGGAGGAACAGGG - Intergenic
1084316070 11:68346642-68346664 CCATCTGCGCAGGAGGACCCAGG + Intronic
1084753346 11:71218845-71218867 CCAGCAGTGCTGGAAGAACGAGG - Intronic
1085828981 11:79879320-79879342 CCATCTGGCCTGGAGGAAGAGGG + Intergenic
1086599499 11:88615481-88615503 CCTTCTCTGGTGGAGGAAGAAGG - Intronic
1086927870 11:92660252-92660274 CCATTTGTGCTGCTGGGACAAGG + Intronic
1091945095 12:4532489-4532511 CTATCTGGGCTGGTGGTACAGGG - Intronic
1092168381 12:6357232-6357254 CCATCAGCGGTGGAGAAACACGG + Intronic
1092181692 12:6450979-6451001 CCTTCGTTGATGGAGGAACAGGG - Exonic
1095291566 12:40484909-40484931 CCATATCAGCTGGAGTAACAGGG + Exonic
1095733148 12:45527340-45527362 CCATTTTTGCAGGAGTAACATGG - Intergenic
1101579177 12:106026523-106026545 CTCTCTGTGATGGAGGAAGATGG - Intergenic
1101748281 12:107561041-107561063 CCAAGTGTGCTGGCGGAAGAAGG + Intronic
1102237937 12:111306414-111306436 CCCTCTGTCCTGGATGAAGATGG - Intronic
1102975930 12:117207298-117207320 GCAGCTGTGCTGGAGGAAAAGGG + Intergenic
1103120698 12:118376985-118377007 CCATCCGTGCTGGAGTAGCGGGG + Intronic
1103394818 12:120599426-120599448 CCAGCAATGCTGGAGGAAGAGGG - Intergenic
1103536763 12:121638805-121638827 CCATGAGGGCTGGAGGGACAGGG - Intronic
1103704830 12:122865854-122865876 CCATGTGTGCTGAAGGCCCAGGG - Exonic
1103997837 12:124841649-124841671 CCTGCTGTGTTGGAGGAAGAGGG - Intronic
1107527342 13:41246189-41246211 GCATCTGTGCAGGAGGAAGAAGG - Intronic
1107631569 13:42348465-42348487 CCCTCTGTGCTGGATGACTATGG + Intergenic
1109074378 13:57815619-57815641 CCTTGTGTGTTTGAGGAACAGGG + Intergenic
1109643060 13:65217441-65217463 CCAACTATGCTGTATGAACAAGG + Intergenic
1110291533 13:73813279-73813301 CCATTTGTGCTGGAGAGAAAAGG + Exonic
1110817818 13:79880950-79880972 CCATGGGTGTTGGAGGAAGATGG + Intergenic
1111002609 13:82205340-82205362 CCCTCTGTGCTCTTGGAACAAGG + Intergenic
1111919337 13:94394196-94394218 CCTTCTGTTCTGGAAGAGCATGG - Intronic
1112466411 13:99649150-99649172 GCATCTGTGCTGGGGGGAGATGG - Intronic
1112530359 13:100196368-100196390 CCATCAGTGTAGGAGAAACAAGG + Intronic
1112798268 13:103081490-103081512 ACATCTATGCTGGAGGATCAAGG - Intergenic
1112977443 13:105338388-105338410 ACATCTGTGCTGGATGTGCAAGG - Intergenic
1113092226 13:106627997-106628019 TCATTTGTGCTGGTGGAACTAGG + Intergenic
1114330347 14:21630640-21630662 CCATCCATGCTGGAGGAACCAGG - Intergenic
1115018929 14:28651043-28651065 CCACGTGTGCTGGAGGTAAAGGG - Intergenic
1116734462 14:48671253-48671275 CCAGCTGTGCTGGTGGATCCAGG - Intergenic
1116774091 14:49159801-49159823 CCATCTTTGCTGATGGATCAGGG + Intergenic
1119266367 14:73265144-73265166 CCAGCTGTGGTGGAGGGGCAGGG + Intronic
1120509233 14:85393696-85393718 CAATCTGTGTTGGAGGAAGGAGG - Intergenic
1121276436 14:92671255-92671277 CCAGCTGTGCTGGAGGATGTGGG + Intronic
1121698263 14:95930449-95930471 CCAACTTTTCTGGAGGAAAATGG - Intergenic
1122198852 14:100109680-100109702 CTATCTGTGATTGAGGGACATGG + Intronic
1126958501 15:53962506-53962528 CCATGTGTGCTGCAAGAACAGGG - Intergenic
1127478154 15:59354265-59354287 CCACCTGTGCTAGAGGAATCTGG - Intronic
1127853854 15:62938774-62938796 CCATGTGTGCTGCAGCATCAGGG + Intergenic
1128576478 15:68779493-68779515 CCATCTGTGAAGGGGGAAAAGGG + Exonic
1129257944 15:74344786-74344808 GCATTTGTGCTGTAGGAGCAAGG - Intronic
1129753262 15:78080616-78080638 TCATCTGTGCTGGGTGACCAGGG - Intronic
1131969171 15:97875177-97875199 CCATCTGTGCTGGGAATACAGGG + Intergenic
1132600635 16:771058-771080 CCCTCTGTCCTGGGGGAACAGGG + Intronic
1133791659 16:9013689-9013711 CCATCTGGGCAGTAGGAATAAGG + Intergenic
1134071855 16:11265187-11265209 ACATTTGGGCTGAAGGAACAGGG - Intronic
1135924637 16:26682502-26682524 CCACCTATCCTGGAGAAACAAGG + Intergenic
1137693485 16:50446001-50446023 CCATCTTTGCTGGGTGACCATGG + Intergenic
1138163416 16:54777245-54777267 CCATCAGTGCTGGGGGAAGATGG + Intergenic
1138426718 16:56939065-56939087 CCTTCTGTGCTTGTGGTACATGG + Intronic
1138461047 16:57147795-57147817 CCAGCTGGGCTGGAGGAAGTTGG - Exonic
1139350441 16:66331653-66331675 CCATGTGTCATGGAGGAACCTGG + Intergenic
1139778645 16:69332726-69332748 CTATCTGAGCTGGTGGAAAAAGG + Exonic
1139959001 16:70706995-70707017 CCAGCTGTGGGGCAGGAACAAGG - Intronic
1141033224 16:80607409-80607431 CGCTCTGTGCTTGAGAAACAGGG - Intronic
1141336098 16:83156775-83156797 ACATCTGTGCTGAATGAATACGG - Intronic
1143287608 17:5801911-5801933 CCAGCTCTTCAGGAGGAACATGG + Intronic
1143705666 17:8696337-8696359 CCCCCTGTGCTAGAGGGACAGGG + Intergenic
1144021498 17:11242595-11242617 CCATCTGTGCTTGGTCAACATGG - Intronic
1149244211 17:54686129-54686151 ACATCTGTTCTGGAAGAATAAGG - Intergenic
1150436233 17:65156436-65156458 TCACCTGTGCAGGAGGAACAAGG - Intronic
1153277081 18:3378049-3378071 CTATCTGAGCTGAAGGAATAAGG - Intergenic
1154092637 18:11379356-11379378 CATTCTGGGCTGGAGAAACAAGG - Intergenic
1154270163 18:12911846-12911868 CCGTCTGAGCTGGAGGACCGCGG + Intronic
1155746682 18:29362738-29362760 CCACCTGTGATAGAGGAACCTGG + Intergenic
1157145958 18:45162774-45162796 CCAGCTGTGCTACAGGATCAGGG + Intergenic
1158351713 18:56571134-56571156 TCATCTGTAATGTAGGAACAAGG + Intergenic
1158606236 18:58898758-58898780 CCATCTGTGCTGGGGAAATCAGG + Intronic
1159136180 18:64339313-64339335 CACTCTGTTCTGGAGGAAAAAGG + Intergenic
1159995749 18:74962418-74962440 TCCTCTGTGCTGGAGAAACAGGG - Intronic
1160486320 18:79296304-79296326 CCTTCTGGGCTGCAGTAACATGG - Intronic
1160835559 19:1123037-1123059 CGATCTTGGCTGGAGGAGCAAGG + Exonic
1161503913 19:4633762-4633784 ACATCTTTGCAGGAGGCACAGGG - Intergenic
1162681694 19:12348633-12348655 TCATCTGTGTTGGATGAACCAGG - Intergenic
1163490015 19:17611935-17611957 CCACCTGTGCTGGCGGCACCAGG + Intronic
1164877252 19:31700199-31700221 AGATGTGTGCTGGAGGAAGATGG + Intergenic
1165012059 19:32855945-32855967 CTATCTGGGCTGGTGGTACAGGG - Intronic
1165225945 19:34355162-34355184 TCACCTGTGCTGGAGCATCAAGG - Exonic
1166723013 19:45008454-45008476 GCATCTGTGCTGGATGAACCTGG - Intronic
1167234117 19:48303531-48303553 CCATCTGTGCTGGAGGAACAAGG - Intronic
1168578432 19:57533499-57533521 CCCTCTCTGCTGGAAGCACAAGG + Intronic
926386243 2:12338344-12338366 GCATCTGAGCTGGAGACACAGGG + Intergenic
928805070 2:35140615-35140637 GCTTCTGTGCTGGTGGACCATGG - Intergenic
929022741 2:37569580-37569602 CCAGCTGTGCCAGAGGCACATGG + Intergenic
929580630 2:43079823-43079845 CCAGATGGGCTGGAGGAGCATGG - Intergenic
930277958 2:49335744-49335766 CCTGCTCTGCTGGAGGAACAGGG + Intergenic
933194349 2:79371626-79371648 CCTACTTTGCAGGAGGAACATGG + Intronic
935113543 2:100113828-100113850 CCTTCTCTGCTAGGGGAACATGG - Intronic
936934636 2:117827285-117827307 GCACCTGTGCTGTGGGAACAAGG - Intronic
939597935 2:144150674-144150696 TCATCTAGGCAGGAGGAACATGG - Intronic
940890793 2:159033493-159033515 CCATCTGTACTAGAGCAACCTGG - Intronic
941315035 2:163981476-163981498 AAATCTGTTCTGGAGGTACATGG - Intergenic
943271259 2:185808393-185808415 TCATCTTTGCTTGAGGAACTTGG - Exonic
943777979 2:191788145-191788167 CCAGCTATACTGGAGGAAAAGGG + Intergenic
945456752 2:210059330-210059352 CCAGCTGTGCTGGCGGAAGTGGG - Intronic
945506997 2:210653856-210653878 TAATCTGTGCTGTAAGAACAAGG - Intronic
946114246 2:217447572-217447594 CCATCTGTGCTGTGGGTATAGGG - Intronic
946167412 2:217873458-217873480 CTAACTGTGCTGTGGGAACAGGG + Intronic
948337435 2:237221500-237221522 GAGCCTGTGCTGGAGGAACAGGG - Intergenic
948371094 2:237489382-237489404 ACATCTGTGCTGTAGCCACAAGG - Intronic
1170617612 20:17967068-17967090 CCAATTTTGCTGGAGGATCAGGG + Intronic
1172270195 20:33650711-33650733 CCATCTGTCCTGCCTGAACAGGG + Intergenic
1173871107 20:46342723-46342745 CCATCTGTCCTTGAGTCACAGGG - Intergenic
1174249415 20:49207330-49207352 CCTTCTGTCCTGGAGGAGCCAGG + Intergenic
1176250872 20:64119261-64119283 CCAGCCATGCTGGAGGAACTGGG - Intergenic
1178902257 21:36606880-36606902 CCATTGGTGCTGGAGGAGCTCGG - Intergenic
1179284564 21:39966453-39966475 CCATGTGTCATGGAGGAACCCGG - Intergenic
1183024662 22:35055703-35055725 TCATATGTGCTGAAGGATCAGGG - Intergenic
1183600034 22:38834636-38834658 CCATGTGTGCCGCAGCAACATGG + Intronic
1183751545 22:39723767-39723789 CCAGCTGAGCAGGAGGAAGACGG + Intergenic
1183796862 22:40126185-40126207 GCCTCTGTGCAGCAGGAACAGGG - Intronic
1184951330 22:47844521-47844543 CCTCCTGTGCAGGAGGGACAGGG + Intergenic
952340435 3:32441151-32441173 GCATCTGACATGGAGGAACATGG + Intronic
952776181 3:37048647-37048669 GCATGTGTGCTGGAGGGAAAGGG + Intronic
953359417 3:42281733-42281755 CCATCAAGGCTGGTGGAACAGGG - Intergenic
953429785 3:42829672-42829694 CCAACTGTGCTATAGGAAGAAGG - Intronic
953651466 3:44809069-44809091 GCATCTATGCTGCGGGAACAGGG - Intronic
953864538 3:46572878-46572900 CCTTCTTTGCTGGGGGAAGAGGG + Intronic
954373876 3:50184242-50184264 CCAGCTGTGCAGGAGGGAGACGG + Intronic
954420963 3:50418813-50418835 CCAGCTGTGAGGGAGAAACAGGG - Intronic
954465307 3:50651031-50651053 TGATCTGTGATGGAAGAACATGG + Intergenic
954624863 3:52016820-52016842 GCATCTGAGCTGGAGGAGGAGGG + Intergenic
955832837 3:63022997-63023019 CCACTGGTGCTGGAGCAACAGGG + Intergenic
956156442 3:66303345-66303367 CTAACTGTGTTGGAGGAACTGGG + Intronic
956267833 3:67417709-67417731 CTTTCTCTGCTGGAGGAAAAGGG - Intronic
957476608 3:80733749-80733771 CCATCTGTGCAGGATGATAAAGG - Intergenic
958549640 3:95595676-95595698 CCAGCTGTGCTGGGGGACCCGGG + Intergenic
961500398 3:127328523-127328545 CCCTCTGTGCAGGAGAAAAAGGG - Intergenic
961614607 3:128168898-128168920 CCATCTGAGCTTAAGGAATAAGG - Intronic
962185842 3:133258567-133258589 CCCTCTGAGCTGCAGGGACAGGG - Intronic
962255159 3:133865485-133865507 CCATCTGGGGTGGGGGAAGAGGG + Intronic
966341776 3:178933166-178933188 CCATGTCTTCTGCAGGAACATGG + Intergenic
966932508 3:184685104-184685126 CCAACTGTGCTCCAGGAACAGGG + Intergenic
969260181 4:6028405-6028427 CCATCTCTGCTGGAGGTGTAGGG - Intronic
970135869 4:12923185-12923207 CAATCTGTTCTGGAGGACCATGG - Intergenic
972148886 4:36064563-36064585 CCACCTGAGCTGCAGGACCAGGG - Intronic
972361081 4:38325921-38325943 CAATCTGTGCTGGCTGAACTAGG + Intergenic
974633047 4:64520029-64520051 CAATCTGTGCTCTAGCAACAGGG - Intergenic
977048809 4:92100929-92100951 CCTTCTGTACTGGAAGAAAAAGG - Intergenic
978792169 4:112674166-112674188 CCATTTGTGCTGGTAAAACATGG - Intergenic
982778019 4:159461887-159461909 CTATCTGTCATGGAGTAACAAGG + Intergenic
984786581 4:183572840-183572862 CCTGCTGTGTTGGAGAAACATGG - Intergenic
985546413 5:511677-511699 CCAGCACTGCTGGAGGCACAGGG + Intronic
985720770 5:1487482-1487504 GCATCTGAGCTGGAGGAGGATGG + Intronic
987860255 5:23477179-23477201 CCTTCTGTGTTGTGGGAACATGG + Intergenic
989533364 5:42534852-42534874 CCATCCTTGCAGGAGCAACATGG + Intronic
991701890 5:69323844-69323866 CACTCTGTCCTGGAGGCACAAGG - Intronic
992268765 5:75044468-75044490 TCATCTGTGAAAGAGGAACAAGG + Intergenic
992821883 5:80505794-80505816 TCATCTGGGCTGGAGGGAAATGG + Intronic
993113381 5:83687657-83687679 GCATATGTGCTGGAGATACAAGG - Intronic
994133747 5:96261661-96261683 ACATCTGTGCTGTACAAACAAGG + Intergenic
994410607 5:99403092-99403114 CCATGTGTGTTGCAGGAACCTGG + Intergenic
994483225 5:100362177-100362199 CCATGTGTGTTGCAGGAACCTGG - Intergenic
998885592 5:146690804-146690826 CCTTCTGTACTGAAGGTACAGGG - Intronic
1001601944 5:172934662-172934684 GCATGTGGGATGGAGGAACATGG - Intronic
1002640869 5:180630097-180630119 CGAGCTTTGCTGGAGGGACAAGG + Exonic
1006255638 6:32830086-32830108 CCACCTGTGCAGCAGGGACAGGG + Exonic
1006830362 6:36964506-36964528 CCATCCATCCTGGAGGCACAAGG + Exonic
1007121947 6:39389588-39389610 CCATCCCTGATGGAGGAGCAAGG - Intronic
1008585652 6:52946334-52946356 CCATCTGGGCTGGTGGCACGGGG + Intergenic
1008880629 6:56377363-56377385 CCATCACTGCTGGAGGAAGGGGG - Intronic
1010421116 6:75677070-75677092 CCATATTTGCCGGAGGATCAAGG - Exonic
1013006098 6:106074927-106074949 CCATCTTTGATGCAGGACCAAGG - Intergenic
1015330189 6:131968836-131968858 CCATGTGCTCTGGAGGAAGAAGG + Intergenic
1015804012 6:137090338-137090360 CCATCTGTGCACCAGGAAGAGGG + Intergenic
1016657349 6:146536650-146536672 CCATCTCAGCTGAAAGAACAAGG - Intergenic
1016932423 6:149424404-149424426 CCACCTGTGCTGGGGAAACCAGG + Intergenic
1017678649 6:156841091-156841113 CCACATGTGGTGGAAGAACAGGG + Intronic
1017711190 6:157169843-157169865 CCATATGTGCTGCTGGAACCAGG + Intronic
1018276887 6:162142270-162142292 CCATCTGTGCTGCATGAGCCAGG - Intronic
1018894761 6:168006022-168006044 CCTTCAGTGCAGGAGGAAGAGGG + Intronic
1019666890 7:2256481-2256503 CCATCTGCTCTGGAGGAAGCCGG + Intronic
1022041431 7:26585648-26585670 CCATCTGTGGGGGAGGACTAAGG - Intergenic
1022526208 7:31039032-31039054 CCATCTGTGGAGGTGGAACACGG + Intergenic
1022799461 7:33761838-33761860 CCCGCTGTGCTGGAGGCAAATGG + Intergenic
1023134790 7:37040667-37040689 CCATCAGTGAAGGAGGAACAGGG + Intronic
1024239434 7:47422996-47423018 CCGGGTGTGTTGGAGGAACATGG - Intronic
1024246216 7:47472289-47472311 CCATCTGTAGGGGAGGTACAGGG - Intronic
1027516018 7:79142830-79142852 GCTTCTCTGCTGGTGGAACAGGG - Intronic
1027998962 7:85466774-85466796 CCAGCTGTGCAGGAGGTGCAAGG + Intergenic
1028163384 7:87510691-87510713 CAATCTTTGCTACAGGAACATGG + Intronic
1030547639 7:110917576-110917598 CTATTTTTGCTGGAGGAGCATGG - Intronic
1031577341 7:123430756-123430778 CCAACAGTGATGGAGGGACAGGG + Intergenic
1031788905 7:126074123-126074145 CCAACTATGATGGAGTAACAGGG - Intergenic
1031875020 7:127129954-127129976 CCATGTGTGAGGGAGGAACCTGG + Intronic
1033318114 7:140315374-140315396 CCCTCTGTGAGGGAGGAACAAGG + Intronic
1034804264 7:154075107-154075129 CCATTTGTGCAGGAGGAAGGTGG - Intronic
1035330534 7:158094207-158094229 ACCCCTGTGCTGGGGGAACAAGG - Intronic
1036612987 8:10366012-10366034 CTATCTGTCCTGAAGGAGCAGGG - Intronic
1038276109 8:26122237-26122259 CTGTGTGTGCTGGAGGGACATGG - Intergenic
1041019832 8:53627404-53627426 CCATCTGTGAACAAGGAACAGGG + Intergenic
1042163755 8:65924563-65924585 ACAGCTGTGATGGAGGCACAAGG - Intergenic
1043097272 8:75991251-75991273 GCACCTGTGCTGGAATAACAGGG - Intergenic
1047609270 8:126505140-126505162 CCACATATGCTGGAGGAAAAAGG - Intergenic
1050054021 9:1632847-1632869 CCATCTGTGTAAGGGGAACAGGG - Intergenic
1053054907 9:34988488-34988510 CCATCTGTGCTCGAGGGAGCGGG - Intergenic
1053297021 9:36922481-36922503 CCAGCTGTGCTGGGGTAACGTGG - Intronic
1056928228 9:90853030-90853052 CCACTTGTGCTGGATGCACAAGG + Intronic
1057351744 9:94304416-94304438 CATTCGGTGCTGAAGGAACAGGG - Intergenic
1059450912 9:114370993-114371015 TCAGCTGAGATGGAGGAACAGGG + Intronic
1059883826 9:118722173-118722195 CCATCTGTGCCCAAGCAACAGGG + Intergenic
1060530534 9:124344894-124344916 CCCTCCGTGGTGGAGGAGCAGGG + Intronic
1060944491 9:127561917-127561939 ACTTCTGTGCTGGAGGAAGAAGG - Intronic
1061294866 9:129671591-129671613 CCATCTGTGGGATAGGAACAAGG + Intronic
1185876090 X:3703483-3703505 CCATCAGTGCTGGAGGGGGAAGG + Intronic
1192935046 X:75850448-75850470 CCATGTGTGTGGGAGGACCAAGG - Intergenic
1195486853 X:105418461-105418483 ACATCTGTGCTGGATGCTCACGG - Intronic
1195683172 X:107563850-107563872 GCACCTTTGCTGCAGGAACAAGG + Intronic
1195687513 X:107600289-107600311 CAATCAGACCTGGAGGAACAGGG - Exonic
1195790567 X:108580403-108580425 ACATCTATGTTGGAGCAACATGG - Intronic
1197163589 X:123351178-123351200 CCATCTGTTATAGATGAACAAGG - Intronic
1197970124 X:132106707-132106729 TCATGTCTTCTGGAGGAACATGG + Intronic
1198098688 X:133404989-133405011 CCAACAGTGCTGGATCAACAAGG - Intronic
1199143514 X:144337420-144337442 CCAAATGAGCTGGAGGAAAAGGG - Intergenic
1200175721 X:154114937-154114959 CCATATGTGCTGGATGGAGAGGG - Intergenic
1200789493 Y:7286939-7286961 CCATCAGTGCTGGAGGGAGAAGG - Intergenic
1201342691 Y:12951584-12951606 ACATCTGGGATGGAGGAACTGGG - Intergenic
1201453916 Y:14147374-14147396 CCACATGTCCTGGAGGAACATGG - Intergenic