ID: 1167234296

View in Genome Browser
Species Human (GRCh38)
Location 19:48304211-48304233
Sequence CGGGGTCAGCCAGAGGTTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 1, 2: 2, 3: 8, 4: 122}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167234289_1167234296 -3 Left 1167234289 19:48304191-48304213 CCTGGGGTCCTGGGGATGGGCGG 0: 1
1: 0
2: 2
3: 43
4: 393
Right 1167234296 19:48304211-48304233 CGGGGTCAGCCAGAGGTTGTGGG 0: 1
1: 1
2: 2
3: 8
4: 122

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167234296 Original CRISPR CGGGGTCAGCCAGAGGTTGT GGG Intronic
900149181 1:1170835-1170857 CGGTGACAGCCACAGGTTGGTGG + Intergenic
900544556 1:3221200-3221222 CGGAGTGAGGCAGAGGCTGTGGG - Intronic
901021594 1:6258774-6258796 CGGGGCTAGACAGAGCTTGTTGG - Intronic
901766389 1:11502517-11502539 CAGGGTCAGAGAGAGGTTGTGGG + Intronic
904300352 1:29549943-29549965 CTGGGTCAGTCAGAGGCTGGAGG + Intergenic
904457872 1:30658113-30658135 CTGGGTCAGTCAGAGGCTGGAGG - Intergenic
905972710 1:42153701-42153723 TGGGGGCAGCCAGATGTTGATGG + Intronic
907307550 1:53521747-53521769 TGGGGACAGCCAAGGGTTGTTGG - Intronic
907742981 1:57185065-57185087 AGGGGTGAGCAAGAGGTTGGTGG - Intronic
910453414 1:87370855-87370877 GGGGGACAGCCAGATGTTGGTGG + Intergenic
910809867 1:91225217-91225239 TGGGGTCAAACAGAGGTTTTGGG + Intergenic
912437330 1:109671007-109671029 GGGGCTGACCCAGAGGTTGTTGG + Intronic
912522559 1:110255800-110255822 AGGGGTCAGCCAGAAGATGGAGG + Intronic
914239854 1:145846173-145846195 CGGGGGTACCCAGAGGTTGGGGG - Exonic
915248050 1:154569814-154569836 CTGGGTCAGCCAGACATTGGTGG - Exonic
915728851 1:158038332-158038354 GGGGGTCAGTCAGTGGTGGTGGG + Intronic
916044090 1:160985770-160985792 AGGGGTCAGCAAAAGGTGGTGGG + Intergenic
917975245 1:180233846-180233868 CGGGGTTCGCCAGAGCTTGCCGG - Intronic
921572685 1:216797658-216797680 TGGGATCAGACAGGGGTTGTGGG + Intronic
922614087 1:226950970-226950992 CTGGGACATCCAGAGGCTGTGGG + Intronic
923064401 1:230504703-230504725 CGGGATGAGGCAGAGGTTATAGG + Intergenic
923256319 1:232224459-232224481 CAGGGTCATCCAGAGGTGGTGGG - Intergenic
924047965 1:240051921-240051943 CAGGGTCTGGGAGAGGTTGTGGG - Intronic
1065091013 10:22233776-22233798 CTGTGACTGCCAGAGGTTGTGGG + Intergenic
1068046073 10:51887855-51887877 AGGTGGTAGCCAGAGGTTGTGGG + Intronic
1068347065 10:55794990-55795012 CGGGACCTGCCAGAGGGTGTGGG + Intergenic
1075009776 10:118857723-118857745 AGGGACCAGCCTGAGGTTGTAGG - Intergenic
1077799602 11:5524866-5524888 CGGGTACAGGCAGAGGTTGGAGG - Intronic
1077926050 11:6682985-6683007 CGGGTTCAGCCCAAGGTTCTGGG + Intronic
1078763558 11:14272117-14272139 GGTGGTCAGATAGAGGTTGTTGG - Intergenic
1079710395 11:23676311-23676333 TGGGGCCTACCAGAGGTTGTAGG + Intergenic
1083898778 11:65633677-65633699 CGGGGCCAGCCAGAGGCGGGTGG + Intronic
1084796175 11:71505940-71505962 CGGGGCCTGCCAGAGGAGGTAGG + Intronic
1084938196 11:72598473-72598495 CGGGATGAGCCAGAGGCTGGGGG - Intronic
1090305991 11:125691723-125691745 CGGGGCCTGCCAGAGGGTGGGGG + Intergenic
1091797791 12:3307104-3307126 GGGTGGCAGCCAGAGGTGGTGGG + Intergenic
1091854729 12:3730312-3730334 GAGGGTCAGCAAGAGGTGGTGGG + Intronic
1101691374 12:107085648-107085670 CGGGGCCTGCCAGGGGTTGAGGG + Intronic
1102017205 12:109655810-109655832 CTGGGCCAGCCAGAGGATCTGGG + Intergenic
1114453680 14:22842291-22842313 CTGGGTCAGGCAGAGGTGGCTGG + Intronic
1114547390 14:23512897-23512919 GGGGGTCTGGCAGAGGTTGGGGG + Intergenic
1114552291 14:23539739-23539761 CTTGGTCAGCCAGAGGTGGGAGG - Intronic
1115294822 14:31813688-31813710 CAGGGTCTGTCAGAGGTTGGGGG - Intronic
1118724631 14:68620331-68620353 AGGGGTCACGCAGAGGCTGTAGG - Intronic
1119854075 14:77886326-77886348 AGGGATCAGACAGAGGATGTGGG - Intronic
1119910609 14:78346181-78346203 AGAGATCAGCCAGAGGTTGTAGG - Intronic
1121019958 14:90573733-90573755 AGGGGTCAGCCAGGGCTTGGCGG - Intronic
1121234025 14:92379492-92379514 CGGCTTCAGCCCGAGTTTGTTGG + Intronic
1122830273 14:104392561-104392583 CGGGGACAGTCAGGGGCTGTGGG - Intergenic
1127784420 15:62343255-62343277 CGGCAGCAGCCAGAGGGTGTGGG - Intergenic
1129520098 15:76180417-76180439 CAGGGTAAGCCTGGGGTTGTGGG + Intronic
1131890451 15:96966328-96966350 CGGGGTCTGTCAGGGGTTTTGGG + Intergenic
1132718531 16:1304317-1304339 TGGGGCCAGCCAGAGGCTGAGGG + Intergenic
1137223271 16:46477103-46477125 CTTGGTCAGCCTGAGGTGGTGGG - Intergenic
1137271757 16:46906932-46906954 CGTGGTCAGGTAGATGTTGTCGG - Exonic
1140999475 16:80295080-80295102 AGGGATCAGACAGAGGTCGTGGG - Intergenic
1144508600 17:15855957-15855979 TGGTGGCTGCCAGAGGTTGTGGG - Intergenic
1144812266 17:18008050-18008072 CAGGGTCAGCCCGAGGGTCTGGG - Intronic
1145172722 17:20673597-20673619 TGGTGGCTGCCAGAGGTTGTGGG - Intergenic
1151893717 17:76966429-76966451 TGGGGTAAGCCAGAGGCTGAGGG + Intergenic
1153615550 18:6929964-6929986 CGGGGTCAGCCTGCGGTGGAGGG - Intergenic
1159967242 18:74607179-74607201 CGGAGTCACCCAGAGGGTTTGGG + Intronic
1160851568 19:1195333-1195355 TGGGGTCAGCGAGGGGTTCTAGG + Intronic
1160851992 19:1197147-1197169 TGGGGTCAGCGAGGGGTTCTAGG + Intronic
1162129007 19:8513953-8513975 CGGGGTCGGCCGGAGGCTGTAGG + Intronic
1165328082 19:35125753-35125775 GGAGTTCAGCCAGAGGTGGTGGG - Intronic
1167234296 19:48304211-48304233 CGGGGTCAGCCAGAGGTTGTGGG + Intronic
1167525269 19:49979639-49979661 GCTGGTCAGCCAGAGGTTGGAGG - Intronic
1168287094 19:55340438-55340460 AGGGGTCAGGGAGAGGTTCTAGG - Intronic
928914686 2:36458295-36458317 CGGGGCGAGGCAGAGGTTGAGGG + Intronic
930054057 2:47238487-47238509 GGGGGGCAGTCAGAGGGTGTTGG + Intergenic
931837048 2:66110050-66110072 TGGGATCCGCCAGAGGTTGTGGG - Intergenic
938075071 2:128327594-128327616 CAGGGCCAGCCAGAGTCTGTAGG + Intergenic
938137088 2:128768307-128768329 AGGGGTCAGCCAGAGTTTGAAGG - Intergenic
942597328 2:177603563-177603585 CGCAGTCAGCCAGAGATTTTAGG - Intergenic
945945887 2:215995187-215995209 CATGGGCAGCCAGAGGTAGTGGG + Intronic
947593595 2:231397892-231397914 CGGGTTCTTCCAGAAGTTGTTGG - Exonic
948761028 2:240191107-240191129 AGGGGTCACCCAGGGGTTCTAGG + Intergenic
948870912 2:240797601-240797623 CGGGGTCGGCCATGGGTTGCTGG - Intronic
1171276667 20:23861925-23861947 CGGGGCCTGCCAGAGGGTGGGGG - Intergenic
1171322209 20:24256260-24256282 CGGTGTCAGCCTGAGATTCTGGG - Intergenic
1171360577 20:24583866-24583888 TGGGGCCTGCCAGAGGTTGGAGG + Intronic
1171449642 20:25226537-25226559 TGGGGTCAGCCCGAGGTGGGCGG - Exonic
1175703457 20:61157543-61157565 CGGGGTCAGGCAGAGTCAGTGGG - Intergenic
1179173198 21:38989022-38989044 CGGGGTCAGCCAGCGTCTGCAGG + Intergenic
1180666889 22:17520577-17520599 CGGGGTCTGTCAGAGGGTGGGGG - Intronic
1184233160 22:43169243-43169265 CTGGGACAGCCAGAGGGTGGCGG - Intronic
1185263566 22:49885169-49885191 CGGCGCCATCCAGAAGTTGTCGG + Exonic
949668060 3:6364545-6364567 AGGGGCCAGCCAGAGGGTGAGGG + Intergenic
949870764 3:8586427-8586449 AGGGTTCAGCCAGAGGCTTTTGG + Intergenic
953143916 3:40255262-40255284 TGGTGGCTGCCAGAGGTTGTGGG + Intronic
953980666 3:47411342-47411364 CGGGGTCAGCTGGGGGATGTGGG + Exonic
954154126 3:48675453-48675475 CTGGTTCAGCCAGAGGTGTTGGG - Intronic
957169727 3:76722613-76722635 TGGGGCCAGCCTGAGGGTGTAGG - Intronic
961825864 3:129598716-129598738 GGGTGTGAGCCAGAGGGTGTCGG - Intronic
962358496 3:134715269-134715291 TGGGGTCAGCCAGAGGTTGAAGG + Intronic
962446184 3:135467938-135467960 CTAGGTCAGACAGAGGTTGAGGG - Intergenic
965724923 3:171705047-171705069 GGAGGTGAGCCAGAGCTTGTCGG - Intronic
966727385 3:183119754-183119776 TGGGGTCAGCCAAAGCATGTTGG + Intergenic
972066880 4:34957764-34957786 CCGGGGGAGGCAGAGGTTGTGGG + Intergenic
975267164 4:72383556-72383578 AGGGGTCAGCCAGAGGTTGTTGG - Intronic
975619808 4:76285016-76285038 AGGGGCCAGCCAGAGGGTGGAGG - Intronic
977690702 4:99906328-99906350 AGAGGTCAGCCAGGGGTGGTTGG - Intronic
984126939 4:175822830-175822852 CGGGGCCTGCCAGAGGCTGGGGG - Intronic
985509913 5:307606-307628 TGGGGCCAGCCTGAGGCTGTTGG + Intronic
985842467 5:2318787-2318809 CAGGGCCAGCCAGGGGTTGGGGG - Intergenic
988785540 5:34563130-34563152 CTGGGTAATCTAGAGGTTGTGGG + Intergenic
988794521 5:34640225-34640247 TGGAGTCAGCTAGAGATTGTTGG - Intergenic
990064507 5:51696195-51696217 TGGGTTCAGACAGTGGTTGTTGG + Intergenic
990350553 5:54911529-54911551 GGGGGTCAGGCAGAGGCAGTGGG - Intergenic
990417102 5:55597156-55597178 GGAGGTCAGCCAGGGGTTGGTGG - Intergenic
1001912855 5:175535286-175535308 CGGGGCCAGTCAGGGGGTGTGGG - Intergenic
1002928973 6:1620516-1620538 CGGGGTCAGGCCGCGGTCGTCGG + Intergenic
1003128802 6:3377718-3377740 CTGGGCCAGGCAGAGGCTGTAGG + Intronic
1018757080 6:166859295-166859317 ATGGGTCAGCCAGACCTTGTGGG + Intronic
1020086879 7:5315252-5315274 CGGGGTCAGCCACCTGGTGTCGG - Intronic
1020695148 7:11404672-11404694 CTGGCTCAGCAAAAGGTTGTTGG + Intronic
1022770937 7:33472115-33472137 CGAAGTAAGCCAGAGGGTGTAGG + Intronic
1031574988 7:123404381-123404403 CGGGGCCTGCCAGGGGGTGTGGG + Intergenic
1034588753 7:152120484-152120506 GAGGGTCAGCCAGAGGCTGTCGG + Intronic
1046446298 8:114324933-114324955 CGGGGCCTGCCAGAGGGTGGGGG + Intergenic
1051300291 9:15643419-15643441 AAGGGTCCCCCAGAGGTTGTAGG - Intronic
1056422923 9:86447187-86447209 AGGGGTCAACCTGAGGCTGTAGG + Intergenic
1059806432 9:117806014-117806036 CGGGGTCTGTCAGAGGGTGGGGG - Intergenic
1060522574 9:124302005-124302027 CAGGGTGTGGCAGAGGTTGTTGG - Exonic
1060911831 9:127357374-127357396 CAGGGTAAGCCAGCGGTTGTGGG + Exonic
1061205732 9:129162201-129162223 CGGGGAGAAGCAGAGGTTGTAGG + Intergenic
1061806945 9:133141997-133142019 CGGTGCCAGCCAGAGTGTGTGGG - Intronic
1061834945 9:133322687-133322709 CAGGGTCAGCCAGAAGCAGTGGG - Intergenic
1062597121 9:137304410-137304432 CGGGGTCAGGCAGAGGTGGTGGG + Intergenic
1186433101 X:9521322-9521344 CAGGGAAAGCCAGAGGTGGTGGG + Intronic
1187051587 X:15701748-15701770 TGGGGTCAGCCAGTAGTTGCAGG - Intronic
1193238877 X:79142998-79143020 CGGGGTCTGGCAGATGATGTGGG - Intergenic
1201970807 Y:19792548-19792570 TGGGGTCAGTCAGGGGTTGAGGG - Intergenic