ID: 1167234311

View in Genome Browser
Species Human (GRCh38)
Location 19:48304260-48304282
Sequence CAGATGGGCAGGGCCAGCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 826
Summary {0: 1, 1: 2, 2: 6, 3: 70, 4: 747}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167234301_1167234311 17 Left 1167234301 19:48304220-48304242 CCAGAGGTTGTGGGGGGTGAGGT 0: 1
1: 0
2: 2
3: 30
4: 347
Right 1167234311 19:48304260-48304282 CAGATGGGCAGGGCCAGCCTGGG 0: 1
1: 2
2: 6
3: 70
4: 747

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167234311 Original CRISPR CAGATGGGCAGGGCCAGCCT GGG Intronic
900115181 1:1025228-1025250 GAGCTGGGCAGGGCCGGGCTGGG - Intronic
900163349 1:1235048-1235070 CGGCTGGGGAGGGTCAGCCTGGG - Intergenic
900319429 1:2075255-2075277 CAGCTGTGCATGGCCAGCGTGGG - Intronic
900461559 1:2804480-2804502 CAGCTGGGGAGGAACAGCCTCGG - Intergenic
900555349 1:3277515-3277537 GAGAGGGTCGGGGCCAGCCTGGG - Intronic
901067915 1:6503205-6503227 CAGATGCTCAAGACCAGCCTGGG + Intronic
901195587 1:7438202-7438224 CAGCTGGGCAGGGCCTGGGTAGG + Intronic
901474490 1:9480181-9480203 CAGATGGGTGGGGCCAAGCTGGG + Intergenic
901774611 1:11551734-11551756 AAGATGGGAAGGGCCAGGCATGG + Intergenic
901905968 1:12411422-12411444 CAGGAGTTCAGGGCCAGCCTGGG + Intronic
902144959 1:14391024-14391046 CAGATGGGCAGGAACTGGCTTGG + Intergenic
902601867 1:17545384-17545406 CTGCTGGGCAGGGCCTGCTTTGG + Intronic
902626587 1:17680093-17680115 CAGATGGGCAGGGGCAGGGCAGG - Intronic
902962562 1:19975250-19975272 CAGAAGTTCAAGGCCAGCCTGGG - Intergenic
903101866 1:21036669-21036691 CAGGAGGTCAAGGCCAGCCTGGG + Intronic
903215838 1:21842897-21842919 TAGATGGGCTGGGCCAGTCCTGG + Exonic
903383202 1:22910599-22910621 AAGAGGGGCAGGGCCTGGCTGGG - Intronic
903704831 1:25278126-25278148 CAGATGGGCAGGGGCAGTGGAGG + Intronic
903722400 1:25415196-25415218 CAGATGGGCAGGGGCAGTGGAGG - Intronic
903820048 1:26095016-26095038 GGCAGGGGCAGGGCCAGCCTGGG + Intergenic
904024311 1:27492481-27492503 CAGAAGGGCAGAGACAGCCAAGG + Intergenic
904379526 1:30101640-30101662 CTTGTGGGCGGGGCCAGCCTGGG - Intergenic
904496142 1:30887844-30887866 GAGAAGAGCAGGGCCTGCCTTGG - Intronic
904767918 1:32864543-32864565 CAGCTGGGCAGAGCCAGACTTGG - Intronic
904966674 1:34379476-34379498 CAGATGGGCCTTGCCAGCCGTGG - Intergenic
905097284 1:35484362-35484384 CAGAAGTTCAAGGCCAGCCTAGG + Intronic
905140591 1:35840821-35840843 CAGAAGTTCAAGGCCAGCCTGGG - Intronic
905329930 1:37187426-37187448 CAGATGACCTGGGCCAGCCTGGG + Intergenic
905387104 1:37612754-37612776 CACATCTGCAGGGCCTGCCTAGG - Exonic
906057158 1:42926421-42926443 GAGAGGGGAAGGGCCAGTCTGGG - Exonic
906215069 1:44033877-44033899 GGGAAGGGCATGGCCAGCCTGGG + Intergenic
906625396 1:47320911-47320933 CAGAAGATCAAGGCCAGCCTGGG + Intergenic
906708194 1:47910066-47910088 CAGGAGGTCAAGGCCAGCCTGGG - Intronic
907289379 1:53403059-53403081 CAGCTGGGCCAGGCCAGCCCAGG + Intergenic
907333099 1:53684154-53684176 CAGATGGGCAGGGCATTCCTGGG + Intronic
908770667 1:67592827-67592849 CAGATGTGCAGAGCCACCATGGG + Intergenic
908786972 1:67744742-67744764 CAGATGGGAAGAGCGAGCTTTGG + Intronic
909663997 1:78113725-78113747 CAGAAGTTCAGGACCAGCCTGGG - Intronic
909941288 1:81614795-81614817 CAGATGTTCAAGACCAGCCTGGG + Intronic
910222708 1:84904383-84904405 CAGATGTTCAAGACCAGCCTGGG + Intergenic
910357524 1:86377335-86377357 CAGATACTCAGTGCCAGCCTGGG - Intronic
911013267 1:93304146-93304168 CAGAAGTTCAAGGCCAGCCTGGG - Intergenic
911150416 1:94592669-94592691 CTGATGGGAAGGGGCAGTCTTGG + Intergenic
912008701 1:104933567-104933589 CAGCAAGGCAGGGCCAGCCTAGG + Intergenic
912422708 1:109556250-109556272 CAGAAGTTCAAGGCCAGCCTGGG - Intronic
912505438 1:110152579-110152601 AAGGTGAGCAGGGCCAGGCTGGG + Intronic
912515957 1:110216686-110216708 CCCATGGGCAGTGTCAGCCTGGG + Intronic
912858434 1:113192197-113192219 CTGAGGGGCACAGCCAGCCTTGG + Intergenic
913613091 1:120527851-120527873 CAGGAGTTCAGGGCCAGCCTGGG - Intergenic
914578095 1:148994396-148994418 CAGGAGTTCAGGGCCAGCCTGGG + Intronic
914666633 1:149838202-149838224 AAGATGGCCAAGGCCAGCATGGG + Intergenic
914669134 1:149855594-149855616 AAGATGGCCAAGGCCAGCATGGG - Intronic
914819772 1:151092003-151092025 CAGGAGTGCAAGGCCAGCCTGGG - Intronic
915474186 1:156143325-156143347 CAGGAGTTCAGGGCCAGCCTGGG - Intergenic
915561659 1:156691573-156691595 CAAAAGGGCATGGCCAGCTTGGG - Intergenic
915755628 1:158256816-158256838 CAGATGGCCAGGGCCAGGACTGG - Exonic
915772464 1:158442241-158442263 CAGAAGTTCAAGGCCAGCCTGGG - Intergenic
915911972 1:159921016-159921038 CAGACGGGCAGAAGCAGCCTGGG + Intronic
916747804 1:167697772-167697794 CAGCTGGGCAGGGCCGGTCTGGG - Exonic
917195280 1:172457672-172457694 CAGCTGGCCAAGGCCAGCTTAGG - Intronic
917443919 1:175090903-175090925 CAGTTGGGAAGTTCCAGCCTGGG + Intronic
917481459 1:175415454-175415476 AGGATGTGCTGGGCCAGCCTGGG + Intronic
917741399 1:177964883-177964905 CAGCTGGCCAGGCCCATCCTGGG + Intronic
917968022 1:180190697-180190719 AAGATGGGGAGAGTCAGCCTTGG + Intronic
918056217 1:181023744-181023766 CAGGTGTTCAAGGCCAGCCTAGG - Intergenic
918070307 1:181129411-181129433 CCACTGGGCAGGGCCAGGCTGGG - Intergenic
919213193 1:194515174-194515196 CAGAAGTGCAAGACCAGCCTGGG + Intergenic
919448708 1:197743772-197743794 CAGGTGTTCAAGGCCAGCCTGGG + Intronic
919798275 1:201334770-201334792 CAGATGGGCAAGACCAAACTGGG + Intergenic
921199629 1:212792396-212792418 GAGATGCGCAGCGCCCGCCTCGG - Intronic
922453188 1:225753154-225753176 CAGAAGGTCAAGGCCAGCCTGGG - Intergenic
922471558 1:225880267-225880289 CTAATGGGCAGGGACAGGCTGGG - Intronic
922529460 1:226332789-226332811 CAGAAGTTCAAGGCCAGCCTGGG - Intergenic
922665127 1:227462086-227462108 CAGAAGTTCAAGGCCAGCCTGGG + Intergenic
922897399 1:229111096-229111118 CAGGAGGCCAGGACCAGCCTGGG + Intergenic
923215155 1:231842209-231842231 CAGAAGTTCAAGGCCAGCCTGGG - Intronic
923809548 1:237297966-237297988 CAGGTGTTCAGGACCAGCCTAGG - Intronic
924064183 1:240207268-240207290 CTGCTGGGCAAGGACAGCCTGGG + Exonic
924404702 1:243730621-243730643 CAGTGGAGCTGGGCCAGCCTGGG + Intronic
924802236 1:247335815-247335837 CATCTGGGCAGGGAGAGCCTGGG + Intergenic
1062842021 10:679409-679431 CAGATGGGCGCGGGGAGCCTGGG - Intronic
1062903891 10:1166711-1166733 CAGATGGTCAGGCTCAGGCTGGG + Intergenic
1063540787 10:6931804-6931826 CAGATGTTCAAGACCAGCCTGGG + Intergenic
1064153529 10:12885203-12885225 CAGGAGGTCAGGACCAGCCTGGG - Intergenic
1064255852 10:13742280-13742302 CGGAAGGGCAGAGCCAACCTGGG + Intronic
1064302595 10:14135998-14136020 CAGAGAGTCAGGGCCAACCTTGG - Intronic
1064336728 10:14450174-14450196 ATGGTGGGCAGGGCCAGCCCTGG - Intronic
1064402187 10:15030679-15030701 CAGGTGTTCAAGGCCAGCCTGGG + Intergenic
1064452434 10:15454651-15454673 CAGAAGTTCAAGGCCAGCCTGGG - Intergenic
1064463937 10:15561096-15561118 CAGGTGTTCAGGACCAGCCTTGG - Intronic
1064579382 10:16778632-16778654 CAGATGGGCCAGACCAGCCAGGG + Intronic
1064769409 10:18708450-18708472 CAAATGTTCAAGGCCAGCCTGGG + Intergenic
1066344531 10:34571100-34571122 CAGGAGTGCAAGGCCAGCCTGGG + Intronic
1066403487 10:35097362-35097384 CAGAAGTGCAAGACCAGCCTGGG + Intergenic
1066461438 10:35615799-35615821 CAGGAGGTCAGGACCAGCCTGGG + Intergenic
1066745472 10:38602020-38602042 GCGGTGGGCAGGGGCAGCCTGGG + Intergenic
1067257836 10:44661529-44661551 CTGATGGACAAGGCCAGCCCTGG - Intergenic
1068953497 10:62801849-62801871 CAGGTGTTCAAGGCCAGCCTAGG - Intergenic
1069715081 10:70515435-70515457 CAGCAGGGCAGAGCCAGGCTGGG - Intronic
1069783134 10:70969367-70969389 CAGATGGGCAGGGGCTCCTTGGG + Intergenic
1069832872 10:71291704-71291726 CACCTGCGCAGCGCCAGCCTCGG + Exonic
1069908679 10:71747018-71747040 CAGAGGGTGAGGGCCAGGCTGGG - Intronic
1069990420 10:72311934-72311956 CACATGGGCAGTGACTGCCTCGG + Intergenic
1070391036 10:75970699-75970721 AAGATGGGCAGGCCCAGTGTGGG + Intronic
1070624410 10:78039901-78039923 CAAGTGGGCAAGGCCATCCTGGG + Intronic
1070746592 10:78937377-78937399 GTCATGGGCAGAGCCAGCCTTGG - Intergenic
1070761386 10:79026529-79026551 GAGGTGGGCAGGGCCTGGCTGGG + Intergenic
1070825375 10:79387592-79387614 AAGCTGGTCAGGGCCAGCCTGGG + Intronic
1070907581 10:80087008-80087030 CAGGTGCTCAAGGCCAGCCTGGG - Intronic
1071358140 10:84818574-84818596 CAAGTGGGCATGGCCAGGCTGGG + Intergenic
1071454352 10:85833071-85833093 CAGCTGGGCAGGACCAGCAAGGG + Intronic
1071539572 10:86468404-86468426 CAGGTGTTCAGGACCAGCCTCGG - Intronic
1072124318 10:92431879-92431901 CAGAAGGTCAAGACCAGCCTGGG - Intergenic
1072547021 10:96447851-96447873 CTGATGGGCTGGGCAACCCTGGG - Intronic
1072637811 10:97188553-97188575 CAGGTGAGCAGGGACAGGCTTGG - Intronic
1072663168 10:97375165-97375187 CAGAAGTTCAAGGCCAGCCTGGG - Intronic
1072669804 10:97420986-97421008 CAGAAGTTCAAGGCCAGCCTGGG - Intronic
1073154500 10:101335713-101335735 CAGAAGCTCAAGGCCAGCCTGGG + Intergenic
1073159021 10:101373625-101373647 AAGATGGGCAGGGCCGGGCGCGG + Intronic
1073792541 10:106955020-106955042 CAGTGGCGCTGGGCCAGCCTAGG + Intronic
1074346460 10:112690943-112690965 CATATGCACAGGCCCAGCCTGGG - Intronic
1075091149 10:119444743-119444765 CAGATGGGCAAACCGAGCCTGGG + Intronic
1075781928 10:125022712-125022734 CTGGTCTGCAGGGCCAGCCTGGG + Intronic
1076235443 10:128860762-128860784 CAGGTGGGCAGGGACAGCTTAGG - Intergenic
1076690642 10:132222426-132222448 CAGGTGGGCAGGGACAACCAGGG - Intronic
1076870733 10:133192038-133192060 CAGATGGGCAGGATCAGTGTTGG + Intronic
1077093091 11:788361-788383 GAGAAGGGCAGGGTCGGCCTTGG + Exonic
1077094034 11:791868-791890 CAGCTGGGCAGGGCCGGTGTGGG - Exonic
1077103491 11:832371-832393 ACGAAGGGCAGGGCCGGCCTAGG - Intergenic
1077187217 11:1240742-1240764 CACAGGGGCAGGGCCAGCCCTGG + Intronic
1077424498 11:2467939-2467961 CTGATGGGCTGGCCCAGCGTGGG + Intronic
1077485994 11:2838714-2838736 CAGGTGGGCAGGGGAAGCCAGGG - Intronic
1078241235 11:9532335-9532357 CAGAAGTTCAAGGCCAGCCTGGG + Intergenic
1079215096 11:18502549-18502571 CAGGTGGGTAAGGACAGCCTGGG + Exonic
1080208438 11:29756951-29756973 CAGCAGGGCAGGTACAGCCTGGG - Intergenic
1080495990 11:32819667-32819689 CAGATGTTCAAGACCAGCCTTGG - Intergenic
1081429591 11:42961911-42961933 CTGATGTGCAATGCCAGCCTGGG - Intergenic
1081575783 11:44317852-44317874 CAGTTGGGCAGTGCCAGGCTGGG - Intergenic
1081685690 11:45041645-45041667 CAGAGGGGCAGGGACAGCAAAGG - Intergenic
1081874123 11:46397262-46397284 CAAATGGGCAAGGCCTGCCTCGG - Exonic
1081931662 11:46875743-46875765 AAGATGGGAAAGGCCTGCCTAGG - Intronic
1082180049 11:49106387-49106409 AAGATGGGCAGGGCCATACTGGG - Intergenic
1082739447 11:56894477-56894499 CAGATGAGCAGAGCCAGCAGAGG + Intergenic
1082778083 11:57263367-57263389 CAACTGGCCAGGGCCACCCTCGG + Intergenic
1082907104 11:58320358-58320380 CAGATGGGGAGGGCCAACCTGGG - Intergenic
1083175801 11:60949573-60949595 GAGATGGCCAGGGCTGGCCTGGG + Intronic
1083424717 11:62577274-62577296 GAGTTATGCAGGGCCAGCCTGGG + Exonic
1083461583 11:62816487-62816509 CAGAAGCTCAGGACCAGCCTAGG - Intronic
1083657814 11:64238142-64238164 CATATGGGCAGGGCCAGTGGGGG + Intronic
1083709810 11:64541052-64541074 CTCCTGGGCATGGCCAGCCTGGG + Intergenic
1084340005 11:68491556-68491578 CAGAAGTTCAGGACCAGCCTGGG - Intronic
1084347201 11:68561306-68561328 CAGGTGTTCAAGGCCAGCCTGGG - Intronic
1084395318 11:68905512-68905534 CAGACTGGCAGGGCGAGCCTGGG + Intronic
1084669148 11:70595159-70595181 CCGATGTGAGGGGCCAGCCTGGG - Intronic
1085013659 11:73158503-73158525 CAGAGGGGCAGGTCCAGCCCAGG + Intergenic
1085047881 11:73363841-73363863 TAGATAGGAAGGGCCACCCTGGG - Intronic
1085097306 11:73771821-73771843 CAGAAGTTCAAGGCCAGCCTGGG - Intergenic
1085172648 11:74462259-74462281 CAGCTGGGTCAGGCCAGCCTAGG + Intronic
1085640167 11:78188455-78188477 CAGATGGGAATGGCGAGGCTGGG + Intronic
1085645404 11:78219213-78219235 GAGATGGGAAGGGCCAGCTCTGG + Exonic
1085685331 11:78616656-78616678 CAGAGGTTCAGGACCAGCCTGGG - Intergenic
1086402424 11:86471753-86471775 CAGAAGTTCAAGGCCAGCCTGGG + Intronic
1086685442 11:89728540-89728562 AACATGGGCAGGGCCATACTGGG + Intergenic
1087266377 11:96066169-96066191 GTGATAGGAAGGGCCAGCCTTGG - Intronic
1088859440 11:113785990-113786012 CAGGAGTTCAGGGCCAGCCTGGG - Intergenic
1088899218 11:114102552-114102574 CGGAAGGGCAGGGGCAGCCGGGG - Intronic
1089215471 11:116832137-116832159 CTGATGGGCAGGGGCAGGATGGG - Intronic
1089374666 11:117986081-117986103 CAGGTGGCCAGGCACAGCCTCGG - Intergenic
1090347759 11:126084662-126084684 CGGATGGGCAGGAGCAGGCTGGG - Intergenic
1090479727 11:127057524-127057546 CAGAAGGGCATGGCAGGCCTAGG - Intergenic
1090668756 11:128931411-128931433 CAGAGGTTCAAGGCCAGCCTGGG + Intergenic
1091405950 12:209704-209726 CAGCTGGGCAGTGCCTACCTGGG - Intronic
1092040491 12:5379874-5379896 CAACTGGACAGGGCCAGGCTTGG + Intergenic
1092167970 12:6354684-6354706 CAGCTTTGCAGGGCCAGCCAGGG + Intronic
1092211056 12:6646777-6646799 CCGATGGTGAGGGCCAGACTAGG - Exonic
1092266452 12:6984791-6984813 CAGGAGGTCAAGGCCAGCCTGGG - Intronic
1092392612 12:8094672-8094694 CAGAAGTTCAAGGCCAGCCTGGG - Intronic
1092451117 12:8603186-8603208 CAGGTGTTCAAGGCCAGCCTGGG - Exonic
1092894843 12:13001336-13001358 CCGCTGGGCAGCGCCAGGCTCGG - Intergenic
1093558009 12:20500974-20500996 CAGGAGTTCAGGGCCAGCCTGGG - Intronic
1094525775 12:31229701-31229723 CGGTGGGGCATGGCCAGCCTGGG - Intergenic
1095400842 12:41813608-41813630 AAGATGGGCAGGGCCAGAACAGG + Intergenic
1095766970 12:45907128-45907150 CTGTTGGGCAGTGCCAGTCTTGG - Exonic
1096135707 12:49198586-49198608 CAGATGTTCGAGGCCAGCCTGGG - Intronic
1096606089 12:52767545-52767567 CACCTGGGCAGGGGCAGCCTAGG - Intergenic
1098359474 12:69640912-69640934 CAGGAGCTCAGGGCCAGCCTGGG + Intergenic
1098826629 12:75305673-75305695 CAGCTGTGCCGGGCCAGACTGGG - Intronic
1098838962 12:75455916-75455938 AAGATGGGCGGGGCCAGAATGGG - Intergenic
1100340526 12:93675234-93675256 CAGGAGTTCAGGGCCAGCCTGGG - Intergenic
1100480418 12:94972653-94972675 CAGAAGCTCAGGACCAGCCTGGG + Intronic
1100590454 12:96023422-96023444 CAGAAGTTCAAGGCCAGCCTGGG - Intronic
1101564475 12:105892668-105892690 CAGATGGGCAAGGGGAGTCTGGG - Intergenic
1101846564 12:108367717-108367739 CAGATGGGCAGCTCCGGCCATGG + Intergenic
1101951498 12:109179697-109179719 CAGAAGTTCAAGGCCAGCCTGGG - Intronic
1102050888 12:109861179-109861201 CAGGTGTGCAGGGTCACCCTGGG - Intronic
1102258409 12:111429109-111429131 CAGAAGGGCAGGGGCAGGCCAGG - Intronic
1102484508 12:113246836-113246858 CAGTTGGAGAGGGCCAGCCCCGG + Intronic
1102540890 12:113618282-113618304 CAGAAGATCAAGGCCAGCCTGGG + Intergenic
1102778199 12:115539410-115539432 CAGATGTTCAAGACCAGCCTGGG + Intergenic
1102942200 12:116953299-116953321 CAGAGGCTCAGGGCCAGGCTGGG + Intronic
1103496883 12:121369732-121369754 CAGTTGGTCTGGGGCAGCCTGGG + Intronic
1103609886 12:122116826-122116848 GGGCTGGGCCGGGCCAGCCTGGG + Intronic
1103814834 12:123646468-123646490 CAGGAGAGCAAGGCCAGCCTGGG - Intronic
1103888445 12:124220688-124220710 CAGATTGGCAAGGGCACCCTCGG + Intronic
1104120885 12:125798507-125798529 CAGATGTTCAAGACCAGCCTGGG - Intergenic
1104483082 12:129125709-129125731 CAGATGTTCAAGGCCAGCCTAGG - Intronic
1104560942 12:129843878-129843900 CAGGAGTTCAGGGCCAGCCTGGG + Intronic
1105002590 12:132700951-132700973 CTGGTGCCCAGGGCCAGCCTTGG + Intronic
1105319390 13:19303761-19303783 CAGAAGTTCAAGGCCAGCCTGGG + Intergenic
1106252147 13:27990318-27990340 CAGAAGGTCCAGGCCAGCCTGGG + Intergenic
1106294435 13:28397593-28397615 CAGAAGTTCAAGGCCAGCCTGGG - Intronic
1106771409 13:32964197-32964219 CAGGAGGTCAAGGCCAGCCTGGG - Intergenic
1107820167 13:44278506-44278528 CAGATGTGCAGAGCAAGCCTTGG + Intergenic
1110128631 13:71979128-71979150 AAGATGGGTGGGGCCAGACTGGG - Intergenic
1110178538 13:72587163-72587185 CAGGAGTTCAGGGCCAGCCTGGG - Intergenic
1110491855 13:76118638-76118660 AAGATGGGCAGGGTCAGACCAGG - Intergenic
1110638323 13:77791560-77791582 CAGATGGGCAGGGTCACACTGGG - Intergenic
1110915498 13:81015983-81016005 AAGATAGGCAGGGCTGGCCTAGG + Intergenic
1111990446 13:95111322-95111344 CAGATGTGCACTGCCAGCCTTGG + Intronic
1112489331 13:99847920-99847942 CTGAAGGGCAGGGGCAGCCCAGG - Intronic
1113215601 13:108037421-108037443 TAGATATTCAGGGCCAGCCTGGG + Intergenic
1113640392 13:111953041-111953063 GAGATGGGCCTGGCCAACCTGGG + Intergenic
1113837799 13:113340265-113340287 CAGGTGTTCAAGGCCAGCCTGGG + Intronic
1113901861 13:113802145-113802167 CAGATGGGCAGGTCTGGGCTGGG + Intronic
1113930652 13:113967261-113967283 CTGCCTGGCAGGGCCAGCCTGGG - Intergenic
1115354815 14:32436096-32436118 CAGATGGGCAGGCCCAGACTGGG + Intronic
1115386176 14:32799999-32800021 CAGATGTTCAAGACCAGCCTGGG + Intronic
1115664637 14:35534079-35534101 CTGATTGGCCGGGCCAGCCCGGG + Exonic
1116019381 14:39442023-39442045 CAGTGGGGCTGGGCCAGCCACGG + Intergenic
1116971577 14:51071592-51071614 CAGGAGTTCAGGGCCAGCCTGGG + Intronic
1117184928 14:53230116-53230138 CAGAAGTTCAAGGCCAGCCTGGG + Intergenic
1117698083 14:58386768-58386790 CAGGAGTTCAGGGCCAGCCTGGG + Intergenic
1119490693 14:75029936-75029958 CAGAAGTTCAGGACCAGCCTGGG + Intronic
1119559183 14:75576911-75576933 CAGATGTTCAGGTCCACCCTCGG + Intergenic
1119891469 14:78185670-78185692 CCCATGAGCAGAGCCAGCCTAGG - Intergenic
1120776141 14:88440002-88440024 CAGATGGGGAGACCCAGGCTGGG - Intronic
1120852110 14:89180665-89180687 GCGCTGGGCAGAGCCAGCCTGGG - Intronic
1120979881 14:90280152-90280174 CAGAAGTTCAAGGCCAGCCTGGG - Intronic
1121073811 14:91050167-91050189 CAGAAGTTCAAGGCCAGCCTGGG + Intronic
1121096591 14:91221662-91221684 CAGAGAGGCAGGAACAGCCTCGG + Intronic
1121434544 14:93910541-93910563 GGGAAGGGCAGGGTCAGCCTGGG - Intergenic
1121625573 14:95383418-95383440 GTGACGGGCAGAGCCAGCCTGGG + Intergenic
1122273370 14:100578264-100578286 GAGAGGGGGAGGCCCAGCCTAGG - Intronic
1122503611 14:102217972-102217994 CAGAGGGAGAAGGCCAGCCTTGG - Intronic
1122518120 14:102322771-102322793 CAGGAGTTCAGGGCCAGCCTGGG - Intronic
1122567550 14:102671601-102671623 CAGAAGTTCAAGGCCAGCCTGGG - Intronic
1122919094 14:104872662-104872684 CAGAAGGTCAGGGCCTGCCCAGG - Intronic
1122937209 14:104965771-104965793 CAGATGGGGAGGCCCAGTCCCGG + Intronic
1122984478 14:105205867-105205889 CAGCTGGGCTGGACCTGCCTGGG + Intergenic
1123130942 14:105984800-105984822 GAGATGTGCATGGCCTGCCTGGG + Intergenic
1123392006 15:19885768-19885790 CAGAAGTTCAGGACCAGCCTGGG - Intergenic
1123581170 15:21716021-21716043 GAGATGTGCATGGCCTGCCTGGG + Intergenic
1123617819 15:22158644-22158666 GAGATGTGCATGGCCTGCCTGGG + Intergenic
1123893913 15:24809385-24809407 CAAGTGGGCATGGCCAGCCTGGG - Intergenic
1124693696 15:31846030-31846052 CAGAGGGGCAGAGCCAGCCAAGG - Intronic
1125367389 15:38932597-38932619 CAGAGGAGCATGGCAAGCCTTGG + Intergenic
1125810573 15:42537168-42537190 CAGGTGTTCAGGACCAGCCTGGG + Intronic
1126595832 15:50383542-50383564 CAGATGTTCAAGACCAGCCTGGG + Intergenic
1127309593 15:57740338-57740360 CAAAGAGGCAGGGCCAGCCTGGG - Intronic
1127435228 15:58950653-58950675 CAGAAGGTCAAGACCAGCCTGGG - Intronic
1127497185 15:59524290-59524312 CCGATGTGCAGAGCCAGCCAGGG - Intergenic
1127497655 15:59527869-59527891 CAGATGAACAGGGCCAGGCGCGG + Intergenic
1128340141 15:66816857-66816879 CAGATGGCCTGAGCAAGCCTTGG + Intergenic
1128670697 15:69572770-69572792 CTAATTGGCAAGGCCAGCCTAGG - Intergenic
1128766191 15:70252607-70252629 CAGGTGTGCAGAGACAGCCTGGG + Intergenic
1129310389 15:74704168-74704190 CAGAAGTTCAAGGCCAGCCTGGG + Intergenic
1129699282 15:77758344-77758366 CAGATGGGGAGCGCCCGCCTTGG - Intronic
1130099529 15:80881954-80881976 CTGCAGGGCAGGTCCAGCCTTGG - Intronic
1130185294 15:81674777-81674799 CAGAGTGGCATGGGCAGCCTAGG + Intergenic
1130283146 15:82534314-82534336 CAGGAGTGCACGGCCAGCCTGGG + Intergenic
1130836350 15:87653759-87653781 GGGTTGGGCAGGGCAAGCCTTGG - Intergenic
1131287755 15:91075835-91075857 CAGATGGGCAAGGCCTGCAGAGG + Intergenic
1131695699 15:94875757-94875779 CAGCGGAGCAGGGCCAGCCCAGG - Intergenic
1132292572 15:100713769-100713791 CACCTGGGCAGGGCCGGCCAAGG - Intergenic
1132378454 15:101348320-101348342 CAGCAGGGCTGGGCCAGTCTGGG + Intronic
1132601033 16:773051-773073 CAGGTGGGCAGGGCTAGGCAGGG + Intronic
1132666897 16:1085140-1085162 CACATGGGCAGGGCCTGGCAGGG - Intergenic
1132941970 16:2512992-2513014 CAGTAGGGCAGCGCCAGCCCTGG + Intronic
1132980688 16:2737437-2737459 CAGCTGGGGAGGGCCTGGCTGGG - Intergenic
1133233902 16:4378936-4378958 CACGTGGGCAGGGCCTGCGTGGG + Intronic
1133460000 16:5979177-5979199 CAGGTGAGCAGGGGCATCCTTGG - Intergenic
1133941525 16:10313055-10313077 CAGAAGTTCAAGGCCAGCCTGGG + Intergenic
1134518832 16:14908549-14908571 CAGGAGGGCAGAGCCAGCCTGGG - Intronic
1134555096 16:15157675-15157697 CAGGAGGGCAGAGCCAGCCTGGG + Intergenic
1134629460 16:15746489-15746511 AAGATGGTCAAGGCCAGCTTTGG - Intronic
1134706503 16:16307204-16307226 CAGGAGGGCAGAGCCAGCCTGGG - Intergenic
1134961037 16:18404920-18404942 CAGGAGGGCAGAGCCAGCCTGGG + Intergenic
1134965339 16:18487523-18487545 CAGGAGGGCAGAGCCAGCCTGGG + Intronic
1135201317 16:20439959-20439981 CAGATGGGCACGCTCTGCCTGGG + Intronic
1135217791 16:20587905-20587927 CAGATGGGCACGCTCTGCCTGGG - Intergenic
1135347223 16:21699425-21699447 CAGAAGTGCAAGACCAGCCTGGG + Intronic
1135489311 16:22894688-22894710 CAGATGTTCAAGACCAGCCTGGG + Intronic
1135515941 16:23133865-23133887 CAGAAGTTCAAGGCCAGCCTGGG + Intronic
1135584204 16:23655751-23655773 CAGGAGGGCAAGACCAGCCTGGG - Intronic
1135746511 16:25021532-25021554 CAGATGTTCAAGACCAGCCTAGG + Intergenic
1136707613 16:32202299-32202321 CACCTGAGCAGGGTCAGCCTAGG - Intergenic
1136760297 16:32727111-32727133 CACCTGAGCAGGGTCAGCCTAGG + Intergenic
1136807807 16:33143275-33143297 CACCTGAGCAGGGTCAGCCTAGG - Intergenic
1137280689 16:46973829-46973851 CGGCTGGGCAGGGCCAACGTAGG + Intergenic
1137734948 16:50716806-50716828 CAGAGGGGAAGGGCAACCCTGGG + Intronic
1139373369 16:66481663-66481685 TAGATGGGCAGGGCCCTCCGTGG + Exonic
1139627934 16:68206772-68206794 CAGAAGATCAGGACCAGCCTGGG + Intronic
1139764540 16:69216022-69216044 CAGAAGTTCAGGACCAGCCTGGG - Intronic
1140347360 16:74227285-74227307 CACCTGGACAGGACCAGCCTGGG + Intergenic
1140636951 16:76926082-76926104 CAGATGGGCAGGGGCAGTAATGG + Intergenic
1140942737 16:79737011-79737033 CAGAAGTTCAAGGCCAGCCTGGG + Intergenic
1141409207 16:83821082-83821104 CACCAGGGCCGGGCCAGCCTGGG - Intergenic
1141757097 16:85998512-85998534 CTCAGGGGCAGGGGCAGCCTGGG + Intergenic
1141948356 16:87325097-87325119 GTGTTGGGCATGGCCAGCCTGGG + Intronic
1142115237 16:88352937-88352959 CAGAGAGCCAGGCCCAGCCTGGG + Intergenic
1142229292 16:88892219-88892241 GAGTTGGGCAGGGACAGCCGGGG - Intronic
1142355609 16:89600203-89600225 CACATGGGCAGGGCCTGCCTGGG + Intergenic
1203062451 16_KI270728v1_random:987433-987455 CACCTGAGCAGGGTCAGCCTAGG + Intergenic
1203145421 16_KI270728v1_random:1795260-1795282 CAGGTGGGCAGGGCGGCCCTGGG - Intergenic
1142485737 17:246737-246759 GAGATGGTGAGGGCCTGCCTGGG + Intronic
1142796476 17:2311425-2311447 CAGAAGGTCAAGACCAGCCTGGG + Intronic
1143502492 17:7347416-7347438 CAGAGGGGCTAGGCCCGCCTGGG - Intronic
1144641943 17:16942327-16942349 AAGACGGGCAGTGCCAGCCCTGG - Intronic
1144666811 17:17107629-17107651 GGGATGTGCAGGACCAGCCTGGG - Intronic
1144768213 17:17744416-17744438 CAGTTTGTCAGGGGCAGCCTTGG + Intronic
1145232820 17:21186991-21187013 CAGGTCTGCAGGGCCAGCATGGG + Intronic
1146666170 17:34705403-34705425 CAGAAGTTCAAGGCCAGCCTAGG + Intergenic
1147140553 17:38458425-38458447 CAGGGAGGCAGTGCCAGCCTTGG + Intronic
1147553227 17:41460023-41460045 CAGAAGAGCAGGGCCAGCCCCGG - Exonic
1147629259 17:41919210-41919232 GAGATGGGCCGGGCTAGGCTGGG + Intronic
1147789869 17:43007055-43007077 GAGATGGGCAGGGTGAGGCTTGG - Intronic
1147941189 17:44049484-44049506 CAGAAGTTCAAGGCCAGCCTGGG - Intronic
1148077500 17:44947346-44947368 CAGATGTGCAGGCCCAGTCTAGG + Intronic
1148158581 17:45437220-45437242 CAGCAGGGCAGGGCCAGTCCTGG - Exonic
1148215971 17:45834192-45834214 CAGGTGGGAGGGGCCACCCTGGG - Intronic
1148324635 17:46776181-46776203 CTGCTGGGCAGTGCCTGCCTGGG + Intronic
1148873960 17:50675651-50675673 CAGATGGGGAGGGACAGGGTCGG + Exonic
1148896686 17:50843034-50843056 GAGATGGGCTGGGCCAGGCTAGG - Intergenic
1149598140 17:57875973-57875995 CAGAGAGGCAGGGCCACCCCGGG - Intronic
1149833958 17:59895529-59895551 CAGATGTTCAAGACCAGCCTGGG - Intronic
1150033494 17:61767481-61767503 CAGATGTTCAAGACCAGCCTGGG - Intronic
1150292110 17:63988054-63988076 ATGATGAGCAGGGCCAGGCTGGG + Intergenic
1150299150 17:64034174-64034196 CAGAAGTTCAAGGCCAGCCTGGG - Intergenic
1150363885 17:64563815-64563837 CAGGAGTTCAGGGCCAGCCTGGG - Intronic
1150390002 17:64784621-64784643 CAGCAGGGCAGGGCCAGTCCTGG - Intergenic
1150601296 17:66653149-66653171 TGGATGGGCAGGGGCTGCCTGGG + Intronic
1150757614 17:67929905-67929927 CAGGAGTACAGGGCCAGCCTGGG + Intronic
1150788112 17:68178915-68178937 CACTTGGGCAGGCCCAGCTTTGG + Intergenic
1150909720 17:69375315-69375337 CAGGAGTTCAGGGCCAGCCTGGG + Intergenic
1151388222 17:73768356-73768378 GAGATGGCCAGGGCTGGCCTTGG + Intergenic
1151722456 17:75865229-75865251 CAGGAGTTCAGGGCCAGCCTGGG - Intergenic
1151827621 17:76531881-76531903 CAGATAGACATGGCCAGACTTGG - Intronic
1152068975 17:78125894-78125916 CAGCTGGGCAGGGCCGGGCCGGG + Intronic
1152158365 17:78650121-78650143 CAGATGCGCAGGCCCTGCCTTGG + Intergenic
1152159444 17:78658298-78658320 CCTTTGGGCAGGGCTAGCCTCGG - Intergenic
1152333199 17:79685288-79685310 CAGATAGCCCGGGGCAGCCTCGG - Intergenic
1152458907 17:80431213-80431235 CTGAGGAGCAGGGCGAGCCTGGG + Intronic
1152574072 17:81132563-81132585 CAGATGGGTGGGGCCAGGCCGGG - Intronic
1152638131 17:81438566-81438588 CACAAGGGAAAGGCCAGCCTAGG + Intronic
1153603331 18:6805031-6805053 CAGAGGTTCAAGGCCAGCCTGGG - Intronic
1155182054 18:23356400-23356422 TAGATGCTCAGGGCCAGCTTGGG - Intronic
1156447830 18:37250106-37250128 GAGCTGGGCGGGGCCAGGCTGGG + Intronic
1157104607 18:44761994-44762016 TAGATGGCCAGGGTCAGCCAGGG - Intronic
1157809842 18:50687231-50687253 CAGGAGTTCAGGGCCAGCCTAGG - Intronic
1157852050 18:51063619-51063641 CAGGAGGTCAAGGCCAGCCTGGG - Intronic
1157855910 18:51105496-51105518 TAGAAGTTCAGGGCCAGCCTGGG - Intergenic
1157932907 18:51842741-51842763 GAGCTGAGCTGGGCCAGCCTGGG + Intergenic
1159014645 18:63091137-63091159 CAGCTGGGCAGGGCCCAGCTAGG + Intergenic
1159129588 18:64266002-64266024 CAGAAGTTCAAGGCCAGCCTGGG - Intergenic
1159529916 18:69642442-69642464 CAGAAGTTCAGGGCCAACCTAGG + Intronic
1160255339 18:77243597-77243619 AACAGGGGCAGGGCCAGCCTGGG - Intergenic
1160473244 18:79158499-79158521 CAGGTGGTCAAGACCAGCCTGGG - Intronic
1160780292 19:874667-874689 CAGGTGGTCAAGACCAGCCTGGG + Intronic
1161030528 19:2056062-2056084 CAGCAGGGCAGGGCCAGGCACGG - Intergenic
1161041566 19:2113301-2113323 CAGCTGGCCAGTGCCAGCCTCGG - Intronic
1161171571 19:2814852-2814874 CAGGAGGGCAAGGCCAGCCTGGG + Exonic
1161305171 19:3563522-3563544 CAGGTGGTCGGGACCAGCCTAGG - Intronic
1161313212 19:3606439-3606461 CAGCAGGGCAGGGCCAGCGCCGG + Intronic
1161321754 19:3644616-3644638 CAGATGGACACTGACAGCCTTGG + Intronic
1161366509 19:3882857-3882879 CAGAAGGTCAAGACCAGCCTGGG - Intronic
1161420324 19:4173103-4173125 AGGAGGGGCTGGGCCAGCCTGGG + Intergenic
1161439833 19:4284676-4284698 TAGAAAGGCAGGGCCAGCTTGGG - Intronic
1161621879 19:5302103-5302125 AGGCTGGGCACGGCCAGCCTTGG + Intronic
1162023877 19:7882486-7882508 CAGAAGTTCAGGACCAGCCTGGG + Intergenic
1162187223 19:8915047-8915069 GAGGTGGGCAGGGCTGGCCTTGG + Intronic
1162320140 19:9966729-9966751 CAGCTCGGCAGGGGCACCCTGGG + Exonic
1162354194 19:10171014-10171036 CAGGAGTTCAGGGCCAGCCTGGG - Intronic
1163051342 19:14686519-14686541 CAGAAGTGCAAGACCAGCCTGGG - Intronic
1163527969 19:17832765-17832787 AAGGTGGGCAGGGCCAGGGTGGG - Intronic
1163813490 19:19449156-19449178 CTATTGTGCAGGGCCAGCCTGGG - Intronic
1164462843 19:28463627-28463649 CAGCTGGGCAGGGCCTGACTTGG - Intergenic
1164486280 19:28658269-28658291 AAGATGGGCAGGGCCAAACTAGG - Intergenic
1164565319 19:29321807-29321829 CAGGAGTACAGGGCCAGCCTGGG - Intergenic
1164655991 19:29922376-29922398 CGGAAGTTCAGGGCCAGCCTGGG + Intergenic
1164883544 19:31758361-31758383 CAGAAGTTCAGGACCAGCCTGGG + Intergenic
1164892002 19:31831953-31831975 CTGATGGGCAGGCACAGCCCTGG + Intergenic
1164963228 19:32455166-32455188 CAGGTGTTCAAGGCCAGCCTAGG - Intronic
1165241292 19:34470438-34470460 CAGAAGTTCAAGGCCAGCCTGGG + Exonic
1165355582 19:35301907-35301929 GAGGTGGGCAGAGCCAGCCGTGG - Intronic
1165660347 19:37573616-37573638 CAGAAGTGCAAGACCAGCCTGGG + Intronic
1165695918 19:37900915-37900937 CAGAAGTTCAAGGCCAGCCTGGG + Intronic
1166089646 19:40500032-40500054 CAGAAGTTCAGGACCAGCCTGGG + Intronic
1166265820 19:41683648-41683670 CAGAAAGTCATGGCCAGCCTGGG + Intronic
1166288082 19:41844717-41844739 CTGGGGGGCGGGGCCAGCCTCGG + Intergenic
1166334194 19:42095633-42095655 CAGCTGAGCAGCCCCAGCCTGGG - Exonic
1166751149 19:45164517-45164539 CAGAAGGGCAGGTACAGCCTGGG + Intronic
1166827018 19:45616130-45616152 CAGGTGGGCAGGGCTAGACACGG + Intronic
1166876009 19:45897762-45897784 CAGGAGGGCAAGACCAGCCTGGG - Intronic
1166916504 19:46199099-46199121 CAGAGGGGCTGGGCCAGCAGAGG + Intergenic
1167234311 19:48304260-48304282 CAGATGGGCAGGGCCAGCCTGGG + Intronic
1167236930 19:48320944-48320966 CTGATGGGCAAGGCCAGGCGCGG + Intronic
1167324981 19:48818789-48818811 CAGAAGTTCAAGGCCAGCCTGGG + Intronic
1167461497 19:49626825-49626847 CAGAAGTTCAAGGCCAGCCTGGG - Intergenic
1167466044 19:49651596-49651618 AAGAGGGACAGCGCCAGCCTGGG - Exonic
1167518860 19:49940106-49940128 CAGATGGGCAGGGCAATGCCAGG - Intronic
1167529302 19:50005017-50005039 CAGATAGGCAGGGCCAGGAAAGG - Intronic
1168645017 19:58054043-58054065 CACATGTGAATGGCCAGCCTCGG + Exonic
925257670 2:2503943-2503965 CAGATGGGCAGGGCTGGCTGCGG - Intergenic
925310832 2:2880477-2880499 CAGATGAGCTGGCCCAGCCCAGG + Intergenic
926171393 2:10555085-10555107 CAGTGGGCCAGGCCCAGCCTGGG + Intergenic
926551601 2:14308427-14308449 CAGGAGGTCAAGGCCAGCCTGGG + Intergenic
926722707 2:15973295-15973317 CAGATGCTCAGGGCCAGGCACGG - Intergenic
927246325 2:20959625-20959647 CATGTGGGCAGGGCCAGCTAGGG + Intergenic
927435260 2:23060941-23060963 CAGAGGGCCTGGGCCAACCTTGG + Intergenic
927678403 2:25123724-25123746 CAGCTTGGCAGGGCCTGCGTGGG - Intronic
927948964 2:27154705-27154727 CAGCTGGACAGGGCCAGGCAGGG + Exonic
928832730 2:35507800-35507822 CAGATGGGCTGAGCCAAGCTGGG - Intergenic
929235413 2:39600349-39600371 CAGATGGGCAGTGTCAGCCCTGG - Intergenic
929261296 2:39869377-39869399 CATATGGGCAGAGCCTGTCTTGG + Intergenic
929888167 2:45896873-45896895 CAGAAGTTCAAGGCCAGCCTGGG + Intronic
929998704 2:46846786-46846808 CAGAGGGGCAGCCCCAGCCCTGG + Intronic
931443464 2:62307533-62307555 CAGAAAGTCAGGACCAGCCTGGG + Intergenic
931570887 2:63668206-63668228 GAGATGGCCAGGGACAGCCAGGG - Intronic
931748259 2:65309291-65309313 CAGGAGGTCAGGACCAGCCTGGG + Intergenic
932586897 2:73036148-73036170 CAGATGAGCAGGGCCAGCCTGGG + Intronic
933955450 2:87358272-87358294 CAGAAGGCCAGGGCAAGGCTAGG - Intergenic
934188725 2:89766742-89766764 GTGGTGGGCAGGGGCAGCCTGGG - Intergenic
934273558 2:91562257-91562279 CAGAAGGCCAGGGCAAGGCTAGG + Intergenic
934307869 2:91841211-91841233 GCGGTGGGCAGGGGCAGCCTGGG + Intergenic
934559427 2:95304982-95305004 CAGGTCCCCAGGGCCAGCCTAGG + Intronic
934650538 2:96089124-96089146 CCGATGGGCAGAGCTACCCTGGG + Intergenic
934716508 2:96547631-96547653 CTGCTGGGCAGGGCCAGGGTAGG - Intronic
934751741 2:96798270-96798292 CTGATGGGCCTGGCCAGCCTAGG - Intronic
934936013 2:98465923-98465945 AAGGTGGGCAGGGCCAGCCTGGG - Intronic
936071665 2:109375408-109375430 CACTGGGGCAGGGTCAGCCTAGG - Intronic
937066403 2:119021042-119021064 GAGATGGGCATGGCCACCCCCGG - Intergenic
937326561 2:120993008-120993030 CAGGTGGACAGGGAAAGCCTGGG + Intergenic
937354984 2:121192650-121192672 GAGCTGGTCAGGGGCAGCCTTGG - Intergenic
938418348 2:131123329-131123351 CAGGTAGGCAAAGCCAGCCTTGG + Intronic
938421982 2:131153541-131153563 GAACTGGGCAGGGCCTGCCTGGG - Intronic
938610921 2:132946686-132946708 CAGAAGTTCAAGGCCAGCCTAGG + Intronic
940467091 2:154044891-154044913 TAGATAGTCAGGTCCAGCCTTGG + Intronic
940914999 2:159244714-159244736 CAGAAGTTCAGGACCAGCCTGGG + Intronic
943618839 2:190124499-190124521 CAGGAGCGCAAGGCCAGCCTGGG + Intronic
944124837 2:196281427-196281449 CAGAAGTTCAAGGCCAGCCTGGG + Intronic
945875859 2:215277790-215277812 CAGATGTTCAAGACCAGCCTGGG - Intergenic
946047245 2:216831434-216831456 CAGATTGGAGGAGCCAGCCTGGG + Intergenic
946222011 2:218235878-218235900 CAGAAGTTCAGGACCAGCCTGGG + Intronic
946433183 2:219636255-219636277 CAGATAGACAGAGCCAGGCTAGG + Intronic
946756435 2:222952331-222952353 CAGATGGTCAGTGCCATGCTTGG - Intergenic
947263481 2:228251484-228251506 CTGAAGGGCAGTGCCAGCCAAGG + Intergenic
947972860 2:234338543-234338565 CAGAGTGCCTGGGCCAGCCTGGG - Intergenic
948124198 2:235552896-235552918 CAGAGAGGCAGCGCCTGCCTTGG + Intronic
948277399 2:236719592-236719614 CAGATGGGAGTGGCCAGCCAGGG - Intergenic
948620811 2:239232905-239232927 CTGAGGGGAAGGGCCACCCTTGG - Intronic
948620829 2:239232958-239232980 CTGAGGGGAAGGGCCACCCTTGG - Intronic
948836377 2:240628044-240628066 CAGAAGTCCAGGGCCAGCCTTGG - Intronic
948871134 2:240798765-240798787 CACAGGGACAGGGACAGCCTCGG + Intronic
1168858852 20:1030284-1030306 GAGATGGGCTCTGCCAGCCTGGG - Intergenic
1169144611 20:3244285-3244307 CAGGTGTTCAGGACCAGCCTGGG - Intergenic
1169453254 20:5730258-5730280 CAGAAGTTCAAGGCCAGCCTGGG - Intergenic
1169896860 20:10513603-10513625 CAGGTGGGCAAGGGCATCCTTGG + Intronic
1170036029 20:11991142-11991164 CTGATGAGCAGTGTCAGCCTGGG + Intergenic
1170571130 20:17633365-17633387 CAGTGTGGCACGGCCAGCCTGGG + Intronic
1170583535 20:17716653-17716675 CAGGAGGTCAAGGCCAGCCTGGG + Intronic
1170700553 20:18699438-18699460 GACATGGGCAGGGGCAGCTTTGG + Intronic
1170873709 20:20231717-20231739 GAGCTGGGCAGGGCAAGGCTAGG + Intronic
1171009323 20:21499785-21499807 CAGAAGGACAGGCCCAGGCTAGG - Intergenic
1171463262 20:25310592-25310614 CAGAGGGCTAGGGCCAGGCTGGG + Intronic
1171977922 20:31607062-31607084 CAAGTTGGCAGGGCCAGGCTGGG + Intergenic
1172617900 20:36301334-36301356 CAGGAGTCCAGGGCCAGCCTGGG - Intergenic
1172640833 20:36439575-36439597 GAATTGGGCAGGGCCAGCCTCGG + Intronic
1172658438 20:36550462-36550484 CAGAGGGGCATGGACTGCCTGGG + Exonic
1172820652 20:37730766-37730788 CAGAAGTTCAGGTCCAGCCTAGG + Intronic
1173460109 20:43236401-43236423 CAGGTGTGAAGAGCCAGCCTCGG + Intergenic
1173500019 20:43546276-43546298 CTGTGGGGCAGGGCCAGGCTTGG + Intronic
1173645782 20:44632296-44632318 CAGGGAGGCAGGGCCAGGCTGGG + Intronic
1174112064 20:48204088-48204110 CTGATGGGCAGCGCTGGCCTTGG - Intergenic
1174134242 20:48367950-48367972 GAGCTGGGCAGAGCCCGCCTCGG - Intergenic
1174160418 20:48546537-48546559 CAGATGAACAGAGCCAGGCTGGG + Intergenic
1174339365 20:49886503-49886525 CAGAAGGACTGGGCCAGGCTGGG - Intronic
1174607584 20:51772276-51772298 CAGGAGGTCAAGGCCAGCCTGGG - Intergenic
1174642168 20:52054052-52054074 CAGATGTTCAAGACCAGCCTGGG - Intronic
1175112150 20:56656039-56656061 CAGGTGGTCAAGACCAGCCTGGG + Intergenic
1175120533 20:56712927-56712949 CAGGAGTTCAGGGCCAGCCTGGG + Intergenic
1175234554 20:57501178-57501200 CCGATGGGCCAGGCCCGCCTTGG + Intronic
1175515634 20:59568210-59568232 CAGGTGGGCGGGGCCTGCCATGG + Intergenic
1175655198 20:60763850-60763872 TAGGTCAGCAGGGCCAGCCTGGG + Intergenic
1175789866 20:61734520-61734542 CAGACGGGGAGGGACGGCCTTGG + Intronic
1175892379 20:62321444-62321466 CAGAGGGGTAGGGCCAGCAGAGG + Intronic
1175932705 20:62500286-62500308 CCGACGGGCAGGGGCAGCCCTGG - Intergenic
1176111454 20:63412658-63412680 GGGATGGTCAGGGACAGCCTGGG - Intronic
1176379390 21:6104300-6104322 CAGGTGGGACGGGCCACCCTGGG - Intergenic
1176968301 21:15236516-15236538 CAGATGGGAAGGGCCATCTCTGG + Intergenic
1177270727 21:18846108-18846130 CAGATGTTCAGGACCAACCTGGG + Intergenic
1177770152 21:25505042-25505064 CAGAAGTGCAAGACCAGCCTGGG + Intergenic
1177778604 21:25598390-25598412 CAGAAGTTCAAGGCCAGCCTAGG + Intronic
1178132773 21:29591838-29591860 CAGGTGTTCAAGGCCAGCCTGGG + Intronic
1178201271 21:30408896-30408918 AAGATGGGCAGGGCCAGACTTGG - Intronic
1178305867 21:31489587-31489609 CAGATGGGAGGGGCCACCCTGGG + Intronic
1178738154 21:35171441-35171463 CAGATGAGGAAGGCAAGCCTTGG + Intronic
1179588421 21:42388858-42388880 CAGATGGGAAGGGTCAGGGTTGG + Intronic
1179744083 21:43433937-43433959 CAGGTGGGACGGGCCACCCTGGG + Intergenic
1179820738 21:43935436-43935458 GAGGAGGGCAGGGCCAGCATAGG + Intronic
1179923805 21:44521723-44521745 CAGAGGAGCAGGCCCTGCCTGGG + Intronic
1180170033 21:46053313-46053335 CAGCTGGGCAGGGCCCGTCCTGG + Intergenic
1180534953 22:16388293-16388315 GTGGTGGGCAGGGGCAGCCTGGG + Intergenic
1180717617 22:17882433-17882455 GAGATGCGGAGGGCCAGCCATGG + Intronic
1181080068 22:20408012-20408034 GGGCTGGGCAGGGCCACCCTGGG + Exonic
1181543738 22:23588681-23588703 CAGAGGGGCTGGGCCTGCCCAGG - Intergenic
1181795988 22:25311089-25311111 CAGGTGGGCAGAGCCAGAGTTGG + Intergenic
1182299123 22:29328289-29328311 CAGAGGGGCAGAGCTAGGCTGGG - Exonic
1182881698 22:33739232-33739254 CACACCGGCAGGACCAGCCTGGG + Intronic
1182959968 22:34462856-34462878 AAGAAGGGCAGGGGCATCCTGGG - Intergenic
1183145365 22:35985832-35985854 CAGAAGTTCAAGGCCAGCCTGGG + Intronic
1183346948 22:37313227-37313249 CCCATGGGCAGGGCCAGAGTGGG - Intronic
1183363961 22:37397492-37397514 CCTGTGGGCAGGGCCAGCATGGG - Intronic
1183454710 22:37916155-37916177 CTGGTGGGCAGGGGCAGCCCTGG + Intronic
1183649095 22:39144250-39144272 CACATGGGAAGGGGCAGCCCAGG - Intronic
1183724138 22:39579023-39579045 CAGAAGGGCAGGGCCCACGTAGG - Intronic
1183739704 22:39662874-39662896 CAGGTGGGCAGGGCCAGGCCTGG + Exonic
1183830934 22:40418072-40418094 CACTAGGGCAGGCCCAGCCTGGG + Intronic
1183832242 22:40424427-40424449 CAGATGAGCAGGGACAGGCCTGG + Intronic
1183894774 22:40959600-40959622 CAGAAGTGCAAGACCAGCCTGGG + Intronic
1183987901 22:41579395-41579417 CAGAGGGACGGGGCCGGCCTGGG - Intronic
1184234764 22:43177157-43177179 CAGGTGTGTAGGACCAGCCTGGG + Intronic
1184236954 22:43187523-43187545 CCGATGCGCAGGGCCTGCCCGGG - Intergenic
1184340704 22:43884359-43884381 CAGGTGGGCAGGGCCATGCCAGG - Intronic
1184416647 22:44355745-44355767 CAGAGGGGCAAGGACATCCTAGG + Intergenic
1185028620 22:48429854-48429876 CAGCTGGGAAGGGCCGGCCAGGG + Intergenic
1185297226 22:50060392-50060414 CAGGTGGGCAGTGACCGCCTGGG + Exonic
1185329913 22:50247870-50247892 CAGGTGGGCAGGGCTGGCCTGGG - Exonic
950143487 3:10631646-10631668 GACTTGTGCAGGGCCAGCCTGGG - Intronic
950187783 3:10956054-10956076 CAGTTGGGCAGGGCCAGTGATGG + Intergenic
950308745 3:11937371-11937393 CAGCAGTTCAGGGCCAGCCTGGG - Intergenic
950564129 3:13755470-13755492 CAGAAGTTCAAGGCCAGCCTGGG - Intergenic
950629924 3:14275582-14275604 CAGCTGAGTGGGGCCAGCCTGGG + Intergenic
950747038 3:15099005-15099027 CAGAGGGTCAGGCCCAGTCTGGG - Intronic
950873522 3:16249655-16249677 CAGAGGTGCAGGGACAGGCTGGG + Intergenic
950992892 3:17459687-17459709 CAGGAGTTCAGGGCCAGCCTGGG + Intronic
951261243 3:20512138-20512160 AAGATAGGCAGGGCCAGATTAGG + Intergenic
951556380 3:23924690-23924712 CTTATGAGCAGGGCCAGGCTTGG - Intronic
951779595 3:26347484-26347506 CAGATTCGCGGGGCCAGCCAGGG + Intergenic
952073477 3:29668391-29668413 CAAAATGGCAGGGCCAGCCTAGG - Intronic
952794497 3:37226927-37226949 CAGAAGTTCAAGGCCAGCCTGGG + Intergenic
953020786 3:39111891-39111913 CAGATGGGGAGGGCCAGGCCTGG - Intronic
953021859 3:39119678-39119700 CAGAGGGGCAGTGCCAGCTCTGG + Intronic
953109456 3:39919475-39919497 CAGATGGACAGGGCAAGGCAAGG - Intronic
953318398 3:41949942-41949964 CAGAAGTTCAGGACCAGCCTGGG - Intronic
953717245 3:45326066-45326088 CTCATGCCCAGGGCCAGCCTGGG - Intergenic
953889860 3:46743680-46743702 CAGATGGTCATGCCCAGCCCAGG + Intronic
953930545 3:47003681-47003703 GAGATGGGGAGGGGCTGCCTAGG - Intronic
954120152 3:48493218-48493240 CAGGAGGTCAGGACCAGCCTGGG + Intronic
954361439 3:50124807-50124829 CAGAGAGGCAGGGTCTGCCTGGG - Intergenic
954442946 3:50531612-50531634 GGGATGGGCAGCACCAGCCTTGG - Intergenic
954461430 3:50629202-50629224 CAGAGGGGCACAGCCAGACTGGG - Intronic
954675271 3:52312013-52312035 AGGATGGGCAGGGCCTGCCCTGG - Intergenic
956082787 3:65577548-65577570 CAGCTGTGCAGGGCCAGGATTGG - Intronic
956859322 3:73306946-73306968 CAGATGGGAAAGCCAAGCCTAGG + Intergenic
956892402 3:73625114-73625136 CAGAAGGGACGGGCCAGCCCAGG + Intergenic
959266667 3:104149261-104149283 CAGAAGTTCAAGGCCAGCCTAGG - Intergenic
960114848 3:113883935-113883957 CAGGAGTTCAGGGCCAGCCTGGG + Intronic
960135472 3:114099760-114099782 CAGAAGTTCAAGGCCAGCCTGGG + Intergenic
961346228 3:126265123-126265145 CAGAAAGACAGGCCCAGCCTAGG + Intergenic
961451606 3:127004723-127004745 CAGGTGGGCAGGGGCAGGCGGGG + Intronic
964017972 3:151971262-151971284 AAGATAGGCAGGGCCTGACTAGG - Intergenic
964601795 3:158509573-158509595 CAGAGGTTCAAGGCCAGCCTGGG + Intronic
966459888 3:180165300-180165322 TAGATGGGCAGTGCCAGACTGGG + Intergenic
967034777 3:185639957-185639979 CAGGAGGGCAGGATCAGCCTTGG - Intergenic
967803496 3:193691003-193691025 CAGGTGTTCAGGACCAGCCTGGG + Intronic
967945677 3:194802039-194802061 CAGAGGAGCAGGGGCTGCCTGGG - Intergenic
968153997 3:196363310-196363332 CAGAAGTGCAAGACCAGCCTGGG - Intronic
968228253 3:196989378-196989400 CAGAGGGTCAGGGCACGCCTCGG + Intronic
968547905 4:1207979-1208001 GAGAGGCCCAGGGCCAGCCTGGG + Intronic
968758011 4:2426852-2426874 CAGATGAGAAGGGTCAGCCCTGG + Intronic
968804266 4:2762333-2762355 CACATGGGCTGGGCCAGGCAAGG - Intergenic
968926904 4:3553551-3553573 CAGAAGTTCAAGGCCAGCCTGGG + Intergenic
968938162 4:3624399-3624421 GGGATGGGGAGGGGCAGCCTGGG + Intergenic
968938181 4:3624452-3624474 GGGATGGGGAGGGGCAGCCTGGG + Intergenic
969178222 4:5416307-5416329 CAGATGGGCATGGATAGGCTGGG - Intronic
969527732 4:7712549-7712571 CACGTGTGCAGGGCCAGGCTCGG + Intronic
969535687 4:7755066-7755088 CAGGTGGCCAGGGCCTGGCTGGG + Intergenic
970594404 4:17586746-17586768 CAGAAGTTCAAGGCCAGCCTAGG + Intronic
971287223 4:25302285-25302307 CAGGTGTTCAAGGCCAGCCTGGG - Intergenic
971729682 4:30361347-30361369 TAGAGGAGCAAGGCCAGCCTTGG + Intergenic
973318347 4:48784030-48784052 CAGAAGTTCAAGGCCAGCCTGGG + Intergenic
974761759 4:66285494-66285516 CGGCAGGTCAGGGCCAGCCTAGG - Intergenic
975130023 4:70823659-70823681 CAGAAGTTCAAGGCCAGCCTGGG + Intronic
975619638 4:76283132-76283154 GAGCTGGGCTGGGCCAGACTTGG + Intronic
975850888 4:78571217-78571239 CAGGAGTTCAGGGCCAGCCTGGG - Intronic
979504882 4:121484888-121484910 AAGATGAGCAGGGACAGACTGGG + Intergenic
980075312 4:128287843-128287865 CAGATGGGCGGGGCCGGCCGTGG - Exonic
980576418 4:134688138-134688160 CAAGTGGGCAAGGCCAGGCTGGG + Intergenic
980843849 4:138300385-138300407 CAGAAGAGCAAGGCTAGCCTGGG - Intergenic
980902296 4:138916514-138916536 CAGATGGCCAGTGGCAGCCGAGG - Intergenic
981198082 4:141943560-141943582 ATGATGGGCAGGTCCAGACTAGG - Intergenic
981511837 4:145566300-145566322 CAAGTGGGCATGGCCAGGCTGGG - Intergenic
981580607 4:146245305-146245327 CAGCTGGGCAGGGCTGGGCTGGG - Intergenic
981598985 4:146463530-146463552 CAGAAGTTCAAGGCCAGCCTGGG + Intronic
981679653 4:147381900-147381922 ATGATGGGCAGGGCCAGGCCAGG - Intergenic
981700156 4:147599205-147599227 CAGAAGTTCAAGGCCAGCCTGGG + Intergenic
981779147 4:148405933-148405955 CAGACGGTCAAGACCAGCCTGGG + Intronic
982843689 4:160223721-160223743 AAGATGGGCAGGGCTGGACTGGG + Intergenic
983094000 4:163540811-163540833 CAGGTGTTCAGGACCAGCCTGGG + Intronic
983880851 4:172930871-172930893 CAGGTGGTCACGACCAGCCTGGG - Intronic
984171706 4:176367966-176367988 CAAATGGGTGGGGCCAGACTGGG + Intergenic
984745431 4:183211268-183211290 CAGATGTTCAAGACCAGCCTGGG + Intronic
984792274 4:183625806-183625828 CAGCTGGGCCAGGCCAGCCTGGG - Intergenic
985551606 5:535961-535983 CACCTGGGCAGGGCGAGCCAGGG + Intergenic
985647252 5:1090788-1090810 CGGAAGGGCATGGCCGGCCTTGG + Intronic
985712129 5:1435506-1435528 CAGATTGGCAGGGCCACCATGGG + Intronic
985810202 5:2077752-2077774 CTGATGGGCAGGGTCAGCGAAGG + Intergenic
987367340 5:17160784-17160806 CAGAAGCTCAAGGCCAGCCTAGG - Intronic
988493679 5:31726672-31726694 AGGGTGGGCAGGGCCGGCCTGGG + Intronic
989014938 5:36919405-36919427 CAGGTGTTCAAGGCCAGCCTGGG - Intronic
989338598 5:40348858-40348880 CAGATGTGGAGGGCCAGGGTGGG - Intergenic
989707077 5:44347404-44347426 GAGGTGGGCAGAGCCAGACTAGG - Intronic
990768974 5:59221421-59221443 CAGGAGTTCAGGGCCAGCCTGGG + Intronic
991775960 5:70086105-70086127 CAGGTGTTCAAGGCCAGCCTGGG - Intergenic
991855248 5:70961559-70961581 CAGGTGTTCAAGGCCAGCCTGGG - Intergenic
991869254 5:71094337-71094359 CAGGTGTTCAAGGCCAGCCTGGG - Intergenic
992250186 5:74868214-74868236 CAGAAGTTCAGGACCAGCCTGGG - Intergenic
993151911 5:84173108-84173130 CAGACATGCATGGCCAGCCTAGG - Intronic
994386715 5:99141906-99141928 CTCCTGGGCAGGTCCAGCCTTGG + Intergenic
995147260 5:108800559-108800581 CAGAAGGTCAAGGTCAGCCTGGG - Intronic
995765066 5:115605444-115605466 CAAAAGGCCAGGGCCAGTCTCGG - Intronic
996553458 5:124753377-124753399 CAGAAGTGCAAGACCAGCCTGGG + Intergenic
996713681 5:126568721-126568743 AACTTGGGCAGGACCAGCCTAGG + Intronic
997009768 5:129862319-129862341 CAGGAGTTCAGGGCCAGCCTGGG + Intergenic
997206855 5:132055240-132055262 GAGAGGGGAAGGGCCGGCCTGGG - Intergenic
997507278 5:134427368-134427390 CAGAAGTCCAAGGCCAGCCTAGG + Intergenic
997697555 5:135873484-135873506 CACAAAGGAAGGGCCAGCCTGGG - Intronic
997754842 5:136386610-136386632 CACATGGGCTGGGCCAGCTCAGG + Intronic
997916260 5:137928776-137928798 CAGAAGTTCAAGGCCAGCCTGGG - Intronic
998415296 5:141941587-141941609 CCCATCAGCAGGGCCAGCCTGGG + Exonic
998461763 5:142314921-142314943 CCGGTGGTCAGGGCCAGGCTAGG + Exonic
998551428 5:143081296-143081318 AAGATGGGAAGGAACAGCCTGGG + Intronic
999286266 5:150396147-150396169 CAGATGGGGAGAGCAAGGCTTGG - Intronic
999910596 5:156194165-156194187 CATAAGTTCAGGGCCAGCCTGGG + Intronic
999985245 5:156997864-156997886 CAGAAGTTCAGGACCAGCCTGGG + Intergenic
1001643876 5:173265553-173265575 CAGTTCGGCAGGGTCAGCCCTGG - Intergenic
1002049777 5:176563973-176563995 CAGAAGTTCAAGGCCAGCCTGGG + Intronic
1002304682 5:178276194-178276216 CAGGAGGACAGGGCCAGCCCTGG - Intronic
1002556566 5:180046243-180046265 CAGAACTCCAGGGCCAGCCTCGG + Intronic
1003250190 6:4421272-4421294 CAGATGTTCAGGAGCAGCCTGGG + Intergenic
1003366343 6:5478528-5478550 CAGATGGGGAGCTCCAGCCAGGG - Intronic
1004194193 6:13488645-13488667 CAGAGGTGCGGGGCCAGCCTTGG - Intergenic
1005297487 6:24440677-24440699 CAGAAGTTCATGGCCAGCCTCGG + Intronic
1006193099 6:32221306-32221328 CAGGTGAGCAGTGCCAGCTTCGG - Exonic
1006375582 6:33670022-33670044 GAGATGAGAAGAGCCAGCCTTGG - Intronic
1006405706 6:33843602-33843624 GAGATGGGCAGGAACAGCCGAGG - Intergenic
1006709825 6:36058688-36058710 CAGAAGGTCAAGACCAGCCTGGG + Intronic
1006995556 6:38256730-38256752 CAGTGGGGCAGAGCCTGCCTGGG - Intronic
1007636030 6:43300345-43300367 GATAGGGGCAGGGCCAGCATGGG + Intronic
1007809724 6:44477182-44477204 CAGGTGGCCAGGGACAGCATCGG + Intergenic
1007810957 6:44485384-44485406 CAGAAGTTCAAGGCCAGCCTGGG - Intergenic
1009427320 6:63528514-63528536 CAGGTGTTCAAGGCCAGCCTGGG + Intronic
1009849665 6:69179975-69179997 CAGATGGGCAGGGCCAGACTGGG + Intronic
1009976924 6:70681208-70681230 CAGAAGTTCAAGGCCAGCCTTGG + Intronic
1010148107 6:72695850-72695872 CAGAAGCTCAAGGCCAGCCTGGG + Intronic
1011585111 6:88916262-88916284 CAGAAGTTCAGGACCAGCCTGGG + Intronic
1012118941 6:95339724-95339746 ATGAAGGGCAGGGCCAGACTGGG + Intergenic
1012461672 6:99469689-99469711 CAGAAGCTCAAGGCCAGCCTGGG - Intronic
1014075343 6:117228797-117228819 CAGATGTTCAAGACCAGCCTTGG - Intergenic
1014130297 6:117823384-117823406 CCCAAGGGCAGAGCCAGCCTGGG - Intergenic
1014817676 6:125953265-125953287 TGGAGGGGCAGGGCCAGCCCAGG + Intergenic
1015059088 6:128940741-128940763 CAGAAGTTCAAGGCCAGCCTGGG + Intronic
1015125628 6:129751117-129751139 CAGATGCTCAAGACCAGCCTGGG - Intergenic
1015360291 6:132331998-132332020 CAGAGGTGCAGTGCCAGACTGGG + Intronic
1018705447 6:166460656-166460678 CAGCAGGGCAGGGCCAGGCTGGG + Intronic
1018831395 6:167446400-167446422 CAGATGGGCTGAGCTGGCCTAGG + Intergenic
1019008575 6:168824068-168824090 CACAGGGGCAGGCCCAGCCATGG - Intergenic
1019355114 7:574369-574391 CAGCTGGGTAGGGCCAGACAGGG + Intronic
1019454391 7:1117880-1117902 CAGGAGTTCAGGGCCAGCCTGGG - Intronic
1019600671 7:1882127-1882149 GAGATGAGGAGGGGCAGCCTTGG + Intronic
1019669610 7:2270416-2270438 CAGGGGTTCAGGGCCAGCCTGGG + Intronic
1019790015 7:3005715-3005737 CAGGTGTTCAAGGCCAGCCTAGG - Intronic
1019993898 7:4711087-4711109 CAGCTGTGCAGGGCCAAGCTGGG + Intronic
1020051892 7:5087111-5087133 CAGAGGTTCAAGGCCAGCCTGGG + Intergenic
1020216155 7:6192427-6192449 CAGGTGTTCAAGGCCAGCCTGGG - Intronic
1020217745 7:6207739-6207761 CAGATGTTCAAGACCAGCCTGGG + Intronic
1021307092 7:19045600-19045622 AAGATGGGCAGGGCCAGACCAGG - Intronic
1021645402 7:22784718-22784740 CAGATGTCCAAGACCAGCCTTGG + Intergenic
1021787363 7:24165122-24165144 CAGTGGGGCTGGGCCAGCCCAGG - Intergenic
1022277652 7:28871683-28871705 CAGATGGGGAGTGTCAGCCTGGG - Intergenic
1022968740 7:35497916-35497938 CAGAAGTTCAAGGCCAGCCTGGG + Intergenic
1023042380 7:36183000-36183022 CAGGTGAGCAGGGCCAGCCTGGG + Intronic
1023290189 7:38660209-38660231 AAGATGGGCAGGGCCAGACCAGG - Intergenic
1023497595 7:40815190-40815212 AAGATGGGCAGGGCTAGACCAGG + Intronic
1023862322 7:44224215-44224237 CCGCAGGGCAGGGGCAGCCTAGG - Intronic
1024548054 7:50538863-50538885 CTGCTGGGCAGGGCTGGCCTGGG - Intronic
1024828580 7:53421332-53421354 CAGGCGGCCAAGGCCAGCCTTGG - Intergenic
1025008378 7:55373882-55373904 CAGTTGGCTAGGGCCAGACTAGG + Intronic
1025974048 7:66355607-66355629 TAGCTGGGCAGGGCCAGGCGTGG + Intronic
1026104960 7:67413575-67413597 GAGCTGGGCAGGGCCAGCTGTGG + Intergenic
1026131753 7:67626765-67626787 CAGAAGTTCAAGGCCAGCCTGGG - Intergenic
1026148982 7:67772188-67772210 CAGAAGGGCACGGCCAGCTTGGG - Intergenic
1026338120 7:69412176-69412198 CAGAAGTTCGGGGCCAGCCTGGG + Intergenic
1026398650 7:69985969-69985991 CAGAAGTTCAGGACCAGCCTGGG - Intronic
1026450586 7:70525828-70525850 GAGATGGGCACCTCCAGCCTTGG + Intronic
1026467251 7:70664860-70664882 CAGGAGGTCAAGGCCAGCCTGGG + Intronic
1026485214 7:70812360-70812382 CAGGTGTTCAGGACCAGCCTGGG - Intergenic
1026778367 7:73246485-73246507 CAGAAGCTCAAGGCCAGCCTGGG + Intergenic
1026975745 7:74496951-74496973 CAGGTGTTCAAGGCCAGCCTGGG + Intronic
1027019224 7:74799874-74799896 CAGAAGCTCAAGGCCAGCCTGGG + Intronic
1027068804 7:75146065-75146087 CAGAAGCTCAAGGCCAGCCTGGG - Intronic
1027190684 7:75994169-75994191 CACACGGGCGGGCCCAGCCTTGG - Intronic
1027370708 7:77506730-77506752 CAGAAGTTCAAGGCCAGCCTGGG - Intergenic
1027808920 7:82867189-82867211 CAGAAGGTCAAGGCTAGCCTGGG + Intronic
1028168688 7:87569122-87569144 CAGAAGTTCAAGGCCAGCCTGGG + Intronic
1029194064 7:98792133-98792155 CAGATGTTCAAGACCAGCCTGGG - Intergenic
1030026449 7:105328970-105328992 CAGGTGTTCAAGGCCAGCCTGGG + Intronic
1030692477 7:112550263-112550285 CAGGAGTTCAGGGCCAGCCTGGG - Intergenic
1034123013 7:148644394-148644416 CAGAAGGTCAGGACCAGCCCGGG + Intergenic
1034272388 7:149809498-149809520 CAGAGGGGCAGTGGCAGCCAGGG - Intergenic
1034453513 7:151150938-151150960 CAGAAGCTCAAGGCCAGCCTGGG - Intronic
1034533716 7:151713782-151713804 CAGAAGTTCAAGGCCAGCCTGGG - Intronic
1036808096 8:11848842-11848864 CAGCTCTGCCGGGCCAGCCTTGG + Intronic
1038479333 8:27890979-27891001 TGGATGGGCAGGGCCAGTCCAGG + Intronic
1038577320 8:28716510-28716532 CGGATGGGCAGGGACAGCTTGGG - Exonic
1038580207 8:28741660-28741682 CAGAAGTTCAAGGCCAGCCTGGG - Intronic
1039003475 8:33007755-33007777 CAGATGTTCTAGGCCAGCCTGGG + Intergenic
1039142123 8:34402101-34402123 CAGGAGGTCAAGGCCAGCCTGGG - Intergenic
1039183735 8:34893708-34893730 AAGATGGGCAAGGACAGCTTGGG + Intergenic
1039300804 8:36206739-36206761 CAGAAGCTCAAGGCCAGCCTAGG - Intergenic
1039909757 8:41816636-41816658 CAGAAGGGCAAGACCAGCCTGGG - Intronic
1040033474 8:42846348-42846370 CAGGTGTTCAAGGCCAGCCTGGG + Intergenic
1040339496 8:46433293-46433315 CAGCTGGCCAGGGACAGCCCTGG - Intergenic
1041228592 8:55726609-55726631 CAGAAGTTCAAGGCCAGCCTAGG + Intronic
1041252245 8:55945876-55945898 CAGATGGGCAGTCCCAGGCTGGG + Intronic
1041343618 8:56872052-56872074 CAGAAGTTCAGGACCAGCCTGGG - Intergenic
1041632943 8:60108647-60108669 CAGATCAGCAGAGCAAGCCTGGG + Intergenic
1042119836 8:65474855-65474877 CAGATGTTCAAGACCAGCCTGGG + Intergenic
1042146388 8:65734491-65734513 CATGTGGGCAGGGACAGCCTTGG - Intronic
1042264223 8:66892110-66892132 GCGATGGGCTGGGCCAGCCCAGG - Intronic
1042337862 8:67647382-67647404 CAGAAGTTCAAGGCCAGCCTGGG - Intronic
1042692865 8:71522816-71522838 TAGAAGCTCAGGGCCAGCCTGGG - Intronic
1042813343 8:72850427-72850449 CAGGAGTTCAGGGCCAGCCTGGG - Intronic
1043414322 8:80032493-80032515 CAGAAGTTTAGGGCCAGCCTGGG + Intronic
1044567656 8:93682463-93682485 CAGAAGTTCAAGGCCAGCCTGGG + Intergenic
1044937510 8:97307478-97307500 CAGATGGGCTGAGTAAGCCTAGG + Intergenic
1045560948 8:103262011-103262033 CAGAAGTTCAAGGCCAGCCTGGG + Intergenic
1046071492 8:109260407-109260429 CAGGAGGTCAGGACCAGCCTAGG - Intronic
1046073079 8:109282150-109282172 AAGATGGGCAGGACGAGACTGGG - Intronic
1046628212 8:116597852-116597874 CAGATGGGCAGTTCCAGCTTTGG + Intergenic
1047244610 8:123129746-123129768 CAGGAGGTCAAGGCCAGCCTGGG + Intronic
1047760371 8:127949882-127949904 CCGCTGGGCAGGGCCGGCTTGGG - Intergenic
1048242921 8:132762010-132762032 GAGCTGGGCAGGGCTAGCCTGGG - Intergenic
1048370759 8:133774082-133774104 CAGCTGGGCAGTGCCAGCCCAGG + Intergenic
1048655170 8:136528157-136528179 CAGAAGTTCAAGGCCAGCCTGGG - Intergenic
1048709313 8:137190400-137190422 CAGATGGGCTTGGCCAGGCGCGG + Intergenic
1048865726 8:138760269-138760291 CAGAAGGGCCGGGCCTGCCCTGG + Exonic
1049351212 8:142165753-142165775 GAGTCCGGCAGGGCCAGCCTGGG - Intergenic
1049403287 8:142440420-142440442 CAGCTGGAGAGGGCCAGCCTCGG + Intergenic
1049409293 8:142465247-142465269 CAGGTGTGCAGGGCCAGCCCGGG + Intronic
1049422930 8:142524859-142524881 CAGATGAGCTGCGGCAGCCTGGG + Intronic
1049443026 8:142617791-142617813 GAGATCAGCAGGGCCAGCCTGGG - Intergenic
1049766053 8:144355719-144355741 CAGAAGGGCTGGGCCAGGCTAGG + Intronic
1049847594 8:144810576-144810598 ACGAAGGTCAGGGCCAGCCTGGG + Intronic
1050295258 9:4197621-4197643 AAGATGGGCAGGGCAGGACTGGG - Intronic
1051233620 9:14977307-14977329 CAGATGTTCAAGACCAGCCTGGG + Intergenic
1053029353 9:34760781-34760803 CAGAAGGTCAAGACCAGCCTGGG + Intergenic
1053274271 9:36771392-36771414 CAGGAGGGCAGGGCCAGGCTGGG - Intergenic
1053290963 9:36879451-36879473 CAGAGGGACAGGGACAGCCCCGG - Intronic
1053355203 9:37439608-37439630 CAGATGTTGAGGGCCAGTCTAGG - Exonic
1053906257 9:42847412-42847434 CAGAAGTTCAGGACCAGCCTGGG - Intergenic
1054453009 9:65413306-65413328 GGGATGGGGAGGGGCAGCCTGGG - Intergenic
1054463155 9:65477229-65477251 CAGAAGTTCAAGGCCAGCCTGGG - Intergenic
1054509970 9:65964492-65964514 CACATGGGAAGGGCCAGGCACGG + Intergenic
1057808614 9:98240406-98240428 CAGATGGGGAAGGCAAGACTGGG - Intronic
1057850669 9:98564747-98564769 CAGATGGGCAAGGACTGTCTGGG + Intronic
1057896895 9:98916469-98916491 CAGAAGTTCAAGGCCAGCCTGGG - Intergenic
1059965615 9:119610607-119610629 CATATGGGGAGGGCTAGACTTGG - Intergenic
1060488097 9:124062365-124062387 CAGATGGGGAGGCTGAGCCTTGG + Intergenic
1060828615 9:126700320-126700342 CAGATGAGCAGGGCCTGGCAGGG + Exonic
1060949882 9:127594818-127594840 CAACAGGGCAGGGCCAGACTCGG + Intergenic
1061001569 9:127905640-127905662 AGGAAGGGCAGGGCCAGCCCAGG + Intergenic
1061067243 9:128286159-128286181 GAGAGGGGCTGGGGCAGCCTAGG - Intronic
1061088342 9:128412183-128412205 CCAATGGGTAGGGGCAGCCTGGG - Intronic
1061397735 9:130352743-130352765 CAGATGGGAGAGGCCAGCATGGG - Intronic
1061477280 9:130876627-130876649 CAGAAGTTCAAGGCCAGCCTGGG - Intronic
1061712724 9:132498961-132498983 CAGATGGGGAGGGCCAAGCAGGG + Intronic
1061811789 9:133166618-133166640 CAGCAGCTCAGGGCCAGCCTGGG + Intergenic
1061824122 9:133247263-133247285 CAGAGGGGCACATCCAGCCTGGG + Intergenic
1061927851 9:133814844-133814866 CAGATGGGAAAGCCCAGCCCGGG + Intronic
1062059270 9:134486260-134486282 CAAAGGCGCTGGGCCAGCCTGGG - Intergenic
1062168450 9:135121024-135121046 CAGATAGGAAGGGCTCGCCTGGG + Intronic
1062391858 9:136337075-136337097 GAGTGGGGCAGGGCCAGCCCAGG + Intronic
1062549439 9:137079179-137079201 GTGAGGGGCGGGGCCAGCCTCGG - Intronic
1062601849 9:137321912-137321934 CACCTGGGCATGGCCAGTCTGGG - Intronic
1062732686 9:138118692-138118714 CTGATGGGGAGCCCCAGCCTGGG + Exonic
1185468908 X:371034-371056 CAGGCGGGGAGGGCCAGGCTAGG + Intronic
1185534729 X:851898-851920 CAGAAGTTCAAGGCCAGCCTGGG + Intergenic
1185892296 X:3832505-3832527 CAGGAGTTCAGGGCCAGCCTGGG + Intronic
1185897404 X:3870924-3870946 CAGGAGTTCAGGGCCAGCCTGGG + Intergenic
1185902523 X:3909356-3909378 CAGGAGTTCAGGGCCAGCCTGGG + Intergenic
1186412807 X:9358661-9358683 CAGAAGTGCAAGGTCAGCCTGGG + Intergenic
1188137123 X:26504501-26504523 CTGATGGTCAAGGACAGCCTGGG + Intergenic
1188392580 X:29639615-29639637 AAGAAGGGCAGGAACAGCCTTGG + Intronic
1189514206 X:41694956-41694978 AAGCTGGGCAGGGCCAGCAGTGG + Intronic
1189709404 X:43794163-43794185 CAAAATGGCAGGGCCAGGCTTGG - Intronic
1190063235 X:47224010-47224032 CAGAAGGGCAGAGGGAGCCTTGG - Intronic
1190191464 X:48280547-48280569 CAGGAGGTCAGGACCAGCCTGGG - Intergenic
1190194832 X:48307832-48307854 CAGAAGGTCAAGACCAGCCTGGG - Intergenic
1191713655 X:64178805-64178827 CATATGTGCAGGGCCTGCATGGG + Intergenic
1192560512 X:72124984-72125006 GAGATGGGCAGGGCCCACCTGGG - Intergenic
1192769603 X:74173629-74173651 CAGAAGTTCAAGGCCAGCCTGGG + Intergenic
1193031934 X:76907680-76907702 AAGATGGGCAGGGCTGGACTGGG - Intergenic
1194068225 X:89288119-89288141 CAGATGGGCAGGGAGACCCATGG + Intergenic
1196065346 X:111458130-111458152 CAGAGGGGATGGGCCAGCCAGGG + Intergenic
1196343642 X:114626167-114626189 CATATGGGACTGGCCAGCCTAGG + Intronic
1196607217 X:117670968-117670990 AAGATGGGTAGGGCCAGGCGCGG - Intergenic
1196901963 X:120392608-120392630 CAGGAGGTCAAGGCCAGCCTGGG + Intergenic
1197242539 X:124135470-124135492 CAGGAGTTCAGGGCCAGCCTGGG - Intronic
1198487862 X:137106410-137106432 CAGCTGCGAAGGGCCATCCTGGG + Intergenic
1199286980 X:146064726-146064748 CAGGAGTTCAGGGCCAGCCTGGG + Intergenic
1200111074 X:153741145-153741167 GTGGTGGGCAGGGGCAGCCTGGG + Intronic
1200363725 X:155638244-155638266 CAGATGTTCAAGACCAGCCTGGG + Intronic
1200722367 Y:6622289-6622311 CAGATGGGCAGGGAGACCCATGG + Intergenic
1200768600 Y:7102953-7102975 CAGAAATGCAGGACCAGCCTGGG + Intergenic
1201406382 Y:13654200-13654222 CAGATGTAAATGGCCAGCCTGGG + Intergenic