ID: 1167234813

View in Genome Browser
Species Human (GRCh38)
Location 19:48307876-48307898
Sequence GAGGAGTCCCGGTTCTTTCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 90
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 81}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167234813_1167234819 3 Left 1167234813 19:48307876-48307898 CCTAGAAAGAACCGGGACTCCTC 0: 1
1: 0
2: 0
3: 8
4: 81
Right 1167234819 19:48307902-48307924 AAAATGGCCAACCCCAGGGATGG 0: 1
1: 0
2: 1
3: 24
4: 232
1167234813_1167234820 4 Left 1167234813 19:48307876-48307898 CCTAGAAAGAACCGGGACTCCTC 0: 1
1: 0
2: 0
3: 8
4: 81
Right 1167234820 19:48307903-48307925 AAATGGCCAACCCCAGGGATGGG 0: 1
1: 0
2: 0
3: 15
4: 155
1167234813_1167234818 -1 Left 1167234813 19:48307876-48307898 CCTAGAAAGAACCGGGACTCCTC 0: 1
1: 0
2: 0
3: 8
4: 81
Right 1167234818 19:48307898-48307920 CAGAAAAATGGCCAACCCCAGGG 0: 1
1: 0
2: 0
3: 20
4: 192
1167234813_1167234817 -2 Left 1167234813 19:48307876-48307898 CCTAGAAAGAACCGGGACTCCTC 0: 1
1: 0
2: 0
3: 8
4: 81
Right 1167234817 19:48307897-48307919 TCAGAAAAATGGCCAACCCCAGG 0: 1
1: 0
2: 3
3: 17
4: 184
1167234813_1167234825 15 Left 1167234813 19:48307876-48307898 CCTAGAAAGAACCGGGACTCCTC 0: 1
1: 0
2: 0
3: 8
4: 81
Right 1167234825 19:48307914-48307936 CCCAGGGATGGGGCAGAACAAGG 0: 1
1: 0
2: 8
3: 73
4: 500
1167234813_1167234821 5 Left 1167234813 19:48307876-48307898 CCTAGAAAGAACCGGGACTCCTC 0: 1
1: 0
2: 0
3: 8
4: 81
Right 1167234821 19:48307904-48307926 AATGGCCAACCCCAGGGATGGGG 0: 1
1: 0
2: 1
3: 10
4: 200

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167234813 Original CRISPR GAGGAGTCCCGGTTCTTTCT AGG (reversed) Intronic
921118890 1:212119521-212119543 CAGGAGCCCAGATTCTTTCTCGG - Intergenic
1070300088 10:75197214-75197236 GAGGAGTCCCGGGTTTTGCAGGG + Intergenic
1081238245 11:40672245-40672267 GAGGAGTGAGGGTTCTCTCTTGG + Intronic
1081708177 11:45198743-45198765 GAAGAGTCCTGGTTGATTCTGGG + Intronic
1081910156 11:46695272-46695294 GAGGAGTGCCAGTCCTTCCTGGG - Intronic
1081998313 11:47378290-47378312 GAGGAGTCCCGGTACTCACAGGG + Exonic
1083169299 11:60913401-60913423 GATGAGTCTGGGGTCTTTCTAGG + Intergenic
1083446452 11:62710791-62710813 GAGGAGCCTCAGTTCCTTCTTGG + Intronic
1084663008 11:70558121-70558143 AAGGAGGCCTGGGTCTTTCTGGG + Intronic
1086957884 11:92952811-92952833 TAGGAGTCCCTGTTTTTTCTGGG + Intergenic
1088747523 11:112816963-112816985 GAGGAACCCCAGTTCTCTCTAGG + Intergenic
1089808950 11:121115603-121115625 GAGGCCTCGGGGTTCTTTCTTGG + Intronic
1090169305 11:124584782-124584804 CAGGAGTCACTATTCTTTCTGGG + Intergenic
1091127876 11:133118197-133118219 TAGGAGGCCCTGTTCTTTCTGGG + Intronic
1102038253 12:109784233-109784255 GAGCAGTCCTGCTTCTTTCCGGG - Intronic
1102971539 12:117171621-117171643 GAGGAGGCCTGTTTCTTCCTTGG - Intronic
1105053951 12:133080439-133080461 GCGGGGTCGCGGTTGTTTCTGGG + Exonic
1106765902 13:32913724-32913746 GAAGTGTCCAGGTTCTTCCTGGG + Intergenic
1108182588 13:47855561-47855583 GAGCAGTCATGGTTCTTCCTGGG + Intergenic
1111175481 13:84589936-84589958 GAGGAGGCAAGGTTCCTTCTTGG - Intergenic
1111255675 13:85664237-85664259 GTGGACTCCTGTTTCTTTCTTGG + Intergenic
1113892967 13:113746079-113746101 CAGGAGTCTCTGTTGTTTCTGGG + Intergenic
1114679245 14:24470618-24470640 GATGAGTCCATGTTCTTTGTAGG - Intergenic
1114820809 14:26017234-26017256 GAGCAATCTCGGTTTTTTCTAGG - Intergenic
1119938055 14:78611097-78611119 ATGGAGGCCCGGTTGTTTCTTGG - Intronic
1120829754 14:88987425-88987447 CAGGAGTCCCTCTCCTTTCTTGG + Intergenic
1120832218 14:89007653-89007675 GAGGAGACCTGGTTCTGTCTTGG + Intergenic
1126891648 15:53211644-53211666 CAGGAGACTGGGTTCTTTCTAGG + Intergenic
1127860830 15:62993061-62993083 GAGGAGTTCCAATTCTTTCGAGG + Intergenic
1128384422 15:67137083-67137105 GAGGAGTCCTGGTTCCTTCAAGG + Intronic
1129337767 15:74863760-74863782 CAGGAATCAAGGTTCTTTCTTGG - Intronic
1130091004 15:80821412-80821434 GATGAGTACAGGTGCTTTCTAGG + Intronic
1132637614 16:960118-960140 AAGGAGCCCTGGTTCTTTTTAGG - Intronic
1132776009 16:1594565-1594587 GAGGAGCCACGGTTGTTTCCTGG + Intronic
1134259454 16:12639227-12639249 GAGGAGTCCTGTTGCTATCTCGG - Intergenic
1135244586 16:20844758-20844780 CAGGAGCCCCGCCTCTTTCTTGG + Exonic
1138148843 16:54636838-54636860 GAGGAGCCCCACTTCTTTCTGGG - Intergenic
1138555681 16:57770019-57770041 GAGGTGACCAGTTTCTTTCTCGG - Intronic
1142219043 16:88844013-88844035 GATGAGTACCGGTTTCTTCTTGG + Intronic
1142519147 17:492923-492945 GAGGAGTCTCAGTGCTTTCTGGG + Intergenic
1142889556 17:2933946-2933968 CAGGAGCCCCAGTTGTTTCTTGG + Intronic
1143191300 17:5042074-5042096 TAGGATTCCAGGTACTTTCTGGG - Intronic
1146240627 17:31219707-31219729 GGGGAGTCAAGTTTCTTTCTGGG - Intronic
1149441572 17:56678682-56678704 GAGGAGTGCCGGTGATTTCTGGG + Intergenic
1150173767 17:63028064-63028086 CAGAAGTCCCGGTTCTTTAGAGG + Intronic
1157200687 18:45656884-45656906 GATGAGTCTCGCTTCTTTCAAGG + Intronic
1167234813 19:48307876-48307898 GAGGAGTCCCGGTTCTTTCTAGG - Intronic
1167679932 19:50912856-50912878 GATGAGTCCCCGCTGTTTCTCGG - Intergenic
925363129 2:3293454-3293476 GAGCAGTCCGGGTTCTCCCTGGG - Intronic
942227743 2:173831829-173831851 GATGAGTCTCTGTCCTTTCTCGG + Intergenic
946383207 2:219363709-219363731 GAGGAGTCCCTATTATTCCTGGG + Intergenic
1172822737 20:37752289-37752311 TAAGAGTCCAGGTTCATTCTAGG + Intronic
1173641923 20:44609458-44609480 GAGGAGCCGCAGTTCCTTCTTGG - Intronic
1175592036 20:60200798-60200820 GAGGTGTCCAGGTTCTCACTGGG - Intergenic
949626844 3:5876852-5876874 GAGGAGTTCCTGTTGCTTCTAGG + Intergenic
950427166 3:12930668-12930690 GAAAAGTCCCGGGTATTTCTTGG - Intronic
950464129 3:13143309-13143331 CAGAAGTCCCGCTCCTTTCTGGG + Intergenic
950528943 3:13541308-13541330 AAGGAGTCCTGGGTCTCTCTGGG + Intergenic
951900121 3:27648791-27648813 GAAGAGTCCCAGTTGTTTATTGG - Intergenic
952921056 3:38284176-38284198 GAGGAGTCCCCTTTCCCTCTTGG - Intronic
957774677 3:84741791-84741813 TAGGAGTACCTGTTCTTTCAGGG - Intergenic
964761184 3:160136299-160136321 GAGGAGTCCTTGCTCTTTGTTGG + Intergenic
967275666 3:187772194-187772216 GTGGAGTCCTGGTTCTCTCCAGG - Intergenic
967536096 3:190604992-190605014 GAGGACTCCCAGTTCGTTCTAGG - Intronic
968637931 4:1691955-1691977 GAGGAGACCCAGCTCTTTCAGGG - Intergenic
968894911 4:3393893-3393915 GAGGAGAACCTGCTCTTTCTGGG - Intronic
970425288 4:15940215-15940237 GTGGACTCCGGGGTCTTTCTGGG + Intergenic
979706597 4:123727210-123727232 GAGGAGTTCATGTTCTTTGTAGG + Intergenic
985182772 4:187282749-187282771 GTGGAGGCTCAGTTCTTTCTGGG + Intergenic
986224846 5:5803031-5803053 GAGGAGGTCCTGTTCTTCCTTGG + Intergenic
987421113 5:17720792-17720814 GAGGAGATCCTGCTCTTTCTGGG + Intergenic
987634243 5:20519299-20519321 GATGAGTTCCTGTTCTTTGTAGG + Intronic
999941519 5:156548139-156548161 GAGGATTCCTGGTGGTTTCTGGG - Intronic
1002527579 5:179823513-179823535 GAGGAGTCCATGTTCACTCTAGG + Intronic
1008378763 6:50820223-50820245 GAGGGGTCGCGTGTCTTTCTCGG - Intronic
1010321810 6:74519360-74519382 GAGAAGTCCAGCCTCTTTCTAGG + Intergenic
1011179054 6:84598684-84598706 GAGGAGTGCTGGCTCTTTCAGGG + Intergenic
1011895590 6:92220749-92220771 AAGGACACCCTGTTCTTTCTAGG + Intergenic
1033973924 7:147075943-147075965 GATGAGTTCAGGTTCTTTGTAGG - Intronic
1040680539 8:49803210-49803232 GAGGAGTCCTCATTCCTTCTGGG + Intergenic
1045327599 8:101128039-101128061 GAGGAGTCTCAGTTCCTCCTCGG + Intergenic
1049941242 9:548294-548316 GAAGAGTCCCAGCTTTTTCTTGG + Intronic
1056650711 9:88458850-88458872 GAGGAGGCCAGTTTTTTTCTTGG + Intronic
1057366006 9:94421832-94421854 TAGGAGTCCAGGGTTTTTCTTGG - Intronic
1057657329 9:96966233-96966255 TAGGAGTCCAGGGTTTTTCTTGG + Intronic
1062514804 9:136927309-136927331 GAGGCGTTCCGGTTCTCTTTGGG + Intronic
1191830852 X:65414563-65414585 GGGGAGTCCCTGTGGTTTCTTGG + Intronic
1192241962 X:69339074-69339096 GATGAGTTCATGTTCTTTCTAGG - Intergenic
1195416998 X:104631150-104631172 GATGAGTTCATGTTCTTTCTAGG - Intronic
1197026524 X:121756484-121756506 GAAGAGTTTCTGTTCTTTCTGGG + Intergenic