ID: 1167237138

View in Genome Browser
Species Human (GRCh38)
Location 19:48321941-48321963
Sequence CAGCGCGCGGACGTGGTAGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 52
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 48}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167237138_1167237147 -8 Left 1167237138 19:48321941-48321963 CCGCCTACCACGTCCGCGCGCTG 0: 1
1: 0
2: 0
3: 3
4: 48
Right 1167237147 19:48321956-48321978 GCGCGCTGGAGGGCGGAAGTGGG 0: 1
1: 0
2: 0
3: 9
4: 141
1167237138_1167237151 24 Left 1167237138 19:48321941-48321963 CCGCCTACCACGTCCGCGCGCTG 0: 1
1: 0
2: 0
3: 3
4: 48
Right 1167237151 19:48321988-48322010 GGGCACTCCATACCGCCCCCCGG 0: 1
1: 0
2: 0
3: 4
4: 74
1167237138_1167237149 4 Left 1167237138 19:48321941-48321963 CCGCCTACCACGTCCGCGCGCTG 0: 1
1: 0
2: 0
3: 3
4: 48
Right 1167237149 19:48321968-48321990 GCGGAAGTGGGTGAGACCTCGGG 0: 1
1: 0
2: 0
3: 6
4: 117
1167237138_1167237146 -9 Left 1167237138 19:48321941-48321963 CCGCCTACCACGTCCGCGCGCTG 0: 1
1: 0
2: 0
3: 3
4: 48
Right 1167237146 19:48321955-48321977 CGCGCGCTGGAGGGCGGAAGTGG 0: 1
1: 0
2: 0
3: 35
4: 125
1167237138_1167237148 3 Left 1167237138 19:48321941-48321963 CCGCCTACCACGTCCGCGCGCTG 0: 1
1: 0
2: 0
3: 3
4: 48
Right 1167237148 19:48321967-48321989 GGCGGAAGTGGGTGAGACCTCGG 0: 1
1: 0
2: 0
3: 10
4: 197

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167237138 Original CRISPR CAGCGCGCGGACGTGGTAGG CGG (reversed) Intronic
902415677 1:16237273-16237295 CAGGCTGCGGACGTTGTAGGAGG - Intergenic
903501198 1:23800911-23800933 CAGCGCGCGCCCGCGGAAGGCGG + Intergenic
906614542 1:47225481-47225503 CAGCGCGCGGCCGGGGGCGGCGG + Exonic
919756669 1:201070345-201070367 CAGCCAGGGGACGTGGTCGGGGG + Exonic
920159838 1:203988106-203988128 CAGGGTGAGGACGTGGGAGGAGG + Intergenic
920528739 1:206686154-206686176 CCCCGCGCGGGCGTGGGAGGGGG - Intronic
1067344434 10:45427558-45427580 CTGCGCGCGGGCGCGGTCGGTGG + Intronic
1072755833 10:98020147-98020169 CAGCGTGTGGAAGTGGGAGGAGG - Intronic
1077029733 11:459645-459667 CAGAGCCCAGACGTGGGAGGAGG - Intronic
1090273488 11:125404006-125404028 CAGGGGGCGGAAGGGGTAGGGGG + Intronic
1105044052 12:132986817-132986839 CAGCGCGCGAACGTGGGCGTGGG + Exonic
1108689836 13:52850496-52850518 CCGCGTGGGGACGTGGAAGGAGG + Intergenic
1113807565 13:113118500-113118522 CAGCGCGATGTCGTGGTTGGTGG - Exonic
1124363168 15:29053743-29053765 CTGCGGGAGGACGTGGTGGGAGG + Intronic
1125329145 15:38565041-38565063 CAAGGCGCGGGCGTGGTAGCCGG - Intronic
1127753407 15:62067915-62067937 CAGCGCGCAGAAGCCGTAGGCGG - Exonic
1127763653 15:62164676-62164698 CAGCGCGCAGAAGCCGTAGGTGG + Exonic
1132481106 16:166502-166524 CAGCGCGCAGCCGGGGTGGGGGG + Intronic
1132512867 16:352795-352817 CAGCGCGGGGACGAGGTAAAGGG + Intergenic
1132608414 16:803074-803096 CAGCGCCCGGATGTGTTTGGGGG - Intergenic
1133332881 16:4987519-4987541 CAGTGAGCGGCCGTGGTGGGGGG - Intronic
1136913092 16:34159906-34159928 CAGCGCGGGGCGGTGGGAGGGGG - Intergenic
1137644103 16:50059260-50059282 CAGCGGGAGGACGTGGTGTGTGG + Intergenic
1142688589 17:1591708-1591730 CACCGCGGGGACGGGGTGGGGGG + Intronic
1158756540 18:60332188-60332210 CAGTGCCTGGACGTGGCAGGGGG - Intergenic
1160890851 19:1378059-1378081 CAGCGTGCGGGCATGGGAGGCGG - Exonic
1161608811 19:5229658-5229680 CAGCGCGCCGCCGCGGAAGGTGG - Exonic
1167237138 19:48321941-48321963 CAGCGCGCGGACGTGGTAGGCGG - Intronic
1168072950 19:53962953-53962975 CAGAGCGCGGCCATGGTCGGCGG - Intergenic
926311951 2:11681648-11681670 CAGCACGGGGACGTGGTAGAAGG - Intronic
935032477 2:99336190-99336212 CAGCACCCGGACGTGGTGGTCGG + Intronic
948645269 2:239400552-239400574 CCGCGCGCGGCCGTGGGAGGCGG - Exonic
1169486794 20:6041289-6041311 CAGCACGCACACGCGGTAGGTGG + Exonic
1171767873 20:29300259-29300281 CAGCGCGGGGCGGTGGGAGGGGG + Intergenic
1180845043 22:18976247-18976269 CAGTGCGTGGATGTGGAAGGTGG + Intergenic
1180880636 22:19201328-19201350 CAGCACCCGGACGTGGAAGGAGG - Exonic
1181056425 22:20262497-20262519 CAGTGCGTGGATGTGGAAGGTGG - Intronic
1183984286 22:41561131-41561153 CAGAGCGCGGACGCCGCAGGAGG + Exonic
1185053445 22:48565629-48565651 CAGAGCTCTAACGTGGTAGGTGG - Intronic
968298067 3:197592579-197592601 CAGCGCACGCACGAGGTGGGAGG - Intergenic
968922758 4:3531134-3531156 CAGCCTGCGGAGGTGGGAGGTGG - Intronic
976198939 4:82561257-82561279 CGGCGGGAGGCCGTGGTAGGTGG - Intronic
989368147 5:40679391-40679413 CGCCCAGCGGACGTGGTAGGTGG - Intergenic
1004324762 6:14664798-14664820 CAGGGGACGGATGTGGTAGGAGG - Intergenic
1019423646 7:963164-963186 CAGCGGGGGCAGGTGGTAGGAGG + Intronic
1024550985 7:50562212-50562234 CAGGGCGGGGACCTGGCAGGTGG + Intronic
1028985628 7:97006458-97006480 GAGCGGGCGGGCGGGGTAGGGGG - Intronic
1039843277 8:41308584-41308606 CGGCTCGCGCACGTGGGAGGAGG + Intronic
1061990015 9:134153723-134153745 CAGCGCGTGCACGTGCTTGGGGG + Intronic
1196668920 X:118345839-118345861 GAGCGCGCGGCCGACGTAGGTGG - Intergenic
1198424097 X:136497471-136497493 CAGCGCGCGCGCGCGGTGGGCGG + Intronic
1200239603 X:154486732-154486754 CGGGGCGCGGACGGGGCAGGAGG - Intergenic