ID: 1167237202

View in Genome Browser
Species Human (GRCh38)
Location 19:48322145-48322167
Sequence CCGAAGCCTGCGGTTTCCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 97
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 87}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167237196_1167237202 1 Left 1167237196 19:48322121-48322143 CCTCTCCCTGCAGGCTGGGTGTG 0: 1
1: 1
2: 6
3: 64
4: 462
Right 1167237202 19:48322145-48322167 CCGAAGCCTGCGGTTTCCTGTGG 0: 1
1: 0
2: 0
3: 9
4: 87
1167237192_1167237202 23 Left 1167237192 19:48322099-48322121 CCGGGCGGGCGGGCAGTGGGCGC 0: 1
1: 0
2: 2
3: 71
4: 702
Right 1167237202 19:48322145-48322167 CCGAAGCCTGCGGTTTCCTGTGG 0: 1
1: 0
2: 0
3: 9
4: 87
1167237191_1167237202 24 Left 1167237191 19:48322098-48322120 CCCGGGCGGGCGGGCAGTGGGCG 0: 1
1: 0
2: 6
3: 84
4: 592
Right 1167237202 19:48322145-48322167 CCGAAGCCTGCGGTTTCCTGTGG 0: 1
1: 0
2: 0
3: 9
4: 87
1167237198_1167237202 -5 Left 1167237198 19:48322127-48322149 CCTGCAGGCTGGGTGTGCCCGAA 0: 1
1: 0
2: 0
3: 9
4: 122
Right 1167237202 19:48322145-48322167 CCGAAGCCTGCGGTTTCCTGTGG 0: 1
1: 0
2: 0
3: 9
4: 87
1167237187_1167237202 28 Left 1167237187 19:48322094-48322116 CCTCCCCGGGCGGGCGGGCAGTG 0: 1
1: 0
2: 3
3: 17
4: 302
Right 1167237202 19:48322145-48322167 CCGAAGCCTGCGGTTTCCTGTGG 0: 1
1: 0
2: 0
3: 9
4: 87
1167237197_1167237202 -4 Left 1167237197 19:48322126-48322148 CCCTGCAGGCTGGGTGTGCCCGA 0: 1
1: 0
2: 1
3: 15
4: 161
Right 1167237202 19:48322145-48322167 CCGAAGCCTGCGGTTTCCTGTGG 0: 1
1: 0
2: 0
3: 9
4: 87
1167237190_1167237202 25 Left 1167237190 19:48322097-48322119 CCCCGGGCGGGCGGGCAGTGGGC 0: 1
1: 0
2: 3
3: 41
4: 295
Right 1167237202 19:48322145-48322167 CCGAAGCCTGCGGTTTCCTGTGG 0: 1
1: 0
2: 0
3: 9
4: 87

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167237202 Original CRISPR CCGAAGCCTGCGGTTTCCTG TGG Intronic
900308415 1:2022097-2022119 CCTGAGCTTGGGGTTTCCTGTGG - Intronic
903493072 1:23743872-23743894 CCCGAGCCAGCTGTTTCCTGCGG + Intronic
903586171 1:24416830-24416852 CAGAGGCCTGCGAGTTCCTGAGG + Intronic
906590952 1:47023780-47023802 CGAACGCCGGCGGTTTCCTGGGG - Exonic
907302720 1:53498647-53498669 ACGGGGCCTGGGGTTTCCTGGGG - Intergenic
907823596 1:57994224-57994246 CTGAAGCCTGCAGAATCCTGTGG + Intronic
907964555 1:59316588-59316610 ACAAAGTCTGTGGTTTCCTGTGG + Intronic
915574723 1:156767983-156768005 CTGAAGCCTGGGGTCTCCGGTGG - Exonic
917796826 1:178538721-178538743 CCTAAGCCTGGGGTGGCCTGAGG - Intronic
917846894 1:179026638-179026660 CCGGGGCCCGCGGTCTCCTGGGG + Intronic
920640951 1:207751845-207751867 CGGAAGCCTGAGGCGTCCTGCGG - Intergenic
920872544 1:209806149-209806171 GCGAAGGCTGCGGCGTCCTGGGG - Intronic
924561951 1:245164542-245164564 CCTATGCCTGCCGTTTCCTGTGG - Intronic
1067942844 10:50670538-50670560 CCGAAGCCTCAGGTTTCCATGGG + Intergenic
1071630985 10:87217728-87217750 CCGAAGCCTCAGGTTTCCATGGG + Intergenic
1071901511 10:90125354-90125376 CTGTTGCCTGCGTTTTCCTGTGG + Intergenic
1075068032 10:119302793-119302815 CAGAGGCCTGGGGTTCCCTGGGG + Intronic
1076022979 10:127089520-127089542 CAGAATCCTCCGTTTTCCTGAGG - Intronic
1084981153 11:72829426-72829448 CCGAAGCCTGAAGCTTCCTTCGG + Exonic
1088756501 11:112889679-112889701 CCTGAGCCTGGGCTTTCCTGAGG + Intergenic
1089988282 11:122834147-122834169 CAGAAGCCTGAGGTGTCTTGGGG + Intergenic
1091311860 11:134580543-134580565 CTGAGGCCTGCGGGTTGCTGTGG + Intergenic
1093503605 12:19839023-19839045 CTGAAGCCTGTGATTTCTTGAGG + Intergenic
1096448518 12:51717047-51717069 CCTGAGCCTGTGGTTTCCTCAGG - Intronic
1096782638 12:53999930-53999952 CCGCGACCTGCGATTTCCTGGGG - Intronic
1101589804 12:106115707-106115729 GCTCAGCCTGCGGTTTCTTGGGG - Intronic
1107393764 13:39994900-39994922 CCCAAGCCTGCAGCTTGCTGAGG + Intergenic
1113887132 13:113666913-113666935 CTCAAGCCTGCTGTTTCCTTGGG - Intergenic
1114604885 14:23988646-23988668 CCAAAGTCTGCGGGTTCCTGCGG + Intronic
1114610333 14:24036193-24036215 CCAAAGGCTGCGGGTTCCTGCGG + Intergenic
1117211349 14:53503708-53503730 CCAAAGTCTGTGGTTTCCTCAGG + Intergenic
1119405446 14:74395943-74395965 CTGGAGCCAGAGGTTTCCTGTGG - Intergenic
1124479293 15:30063840-30063862 GCAAAGACTGAGGTTTCCTGAGG + Intergenic
1125580083 15:40779180-40779202 CGGTGGCCTGTGGTTTCCTGTGG - Intronic
1132405299 15:101538383-101538405 CCCCAACCTGGGGTTTCCTGGGG - Intergenic
1132725260 16:1335646-1335668 AGGAAGCCTGGGGTTTCCAGGGG + Intronic
1133916596 16:10114540-10114562 CCGGTGCCTGCGGGTTTCTGGGG - Intronic
1142670678 17:1486105-1486127 CCGAGGCCTGCGGGTCCCAGAGG + Intronic
1146972221 17:37082517-37082539 CCAAAGCATGGGGTTTCCTGTGG - Intergenic
1151139266 17:71976087-71976109 CCCAAGCCTGCAGTTTCATGCGG + Intergenic
1151323703 17:73366278-73366300 CGGAAGCCTCGGGTTCCCTGGGG + Intronic
1153773343 18:8432842-8432864 CCGAAGCATCCGCTTTCCTGCGG - Intergenic
1155366640 18:25055770-25055792 CCAAAGCCTTTGGTTCCCTGAGG - Intergenic
1157574095 18:48732243-48732265 CCGAATCCTGAGGTCTCCCGTGG - Intronic
1159577167 18:70193359-70193381 CCGAGGGCTGCTGCTTCCTGGGG + Exonic
1159944571 18:74434733-74434755 CCGAAGCCCGCCCTTTCCTTTGG + Exonic
1164903285 19:31946494-31946516 CTGAAGCCTGATGTGTCCTGAGG - Intergenic
1166943465 19:46383223-46383245 CAGAAGCCTGCGGCTGCCTCCGG + Intronic
1167237202 19:48322145-48322167 CCGAAGCCTGCGGTTTCCTGTGG + Intronic
925143274 2:1564556-1564578 TTGGAGCCTGCGGTTTCCTGCGG + Intergenic
934054392 2:88239917-88239939 CCTGAGCCTGCGGTTTCACGTGG + Intergenic
939987784 2:148849040-148849062 CCCAAGCCTGTGCTTTCCTCTGG + Intergenic
942191109 2:173471384-173471406 CAGAAGCCTGCAGTCTACTGTGG + Intergenic
948303024 2:236922592-236922614 CCTAGGCCTGGGGTTACCTGAGG + Intergenic
1170797986 20:19566393-19566415 CCACACCCTGCTGTTTCCTGTGG + Intronic
1172353190 20:34260020-34260042 CCCAGGCCTGGGGTCTCCTGGGG + Intronic
1172362765 20:34325704-34325726 CCCAAGCCTGCTGTCTCCTCGGG + Intergenic
1176009890 20:62887600-62887622 CCGAGGCCTGCGGCTTCACGCGG + Intronic
1176112850 20:63418393-63418415 CCTCAGCCTCCTGTTTCCTGCGG - Intronic
1176290926 21:5044234-5044256 CAGAAGCCTGGGGATTCCGGAGG + Intergenic
1178472530 21:32906132-32906154 GCAAAGACTGAGGTTTCCTGAGG + Intergenic
1179866329 21:44219407-44219429 CAGAAGCCTGGGGATTCCGGAGG - Intergenic
1180157548 21:45985527-45985549 CCGAAGCATGCGCTTTCTCGGGG + Intronic
1185015747 22:48341619-48341641 CCCAAGGCTGCGGTTTCCACCGG - Intergenic
961645185 3:128389086-128389108 AGGCAGCCTGCGGTGTCCTGTGG + Intronic
964535512 3:157716848-157716870 CCCAAGGCTGCGGTGGCCTGAGG + Intergenic
966865857 3:184258952-184258974 TCAAAGCCTGCAGTCTCCTGTGG - Intronic
967792151 3:193561123-193561145 CCCAAGCCTGAGGTCCCCTGTGG - Intronic
969391530 4:6894658-6894680 CCGCAGCCTGGGGATTGCTGTGG - Intergenic
981567510 4:146116130-146116152 CTAAAGCCTCCAGTTTCCTGGGG + Intergenic
982018066 4:151175212-151175234 CCAAAGCCTACTGTTTCCTCAGG - Exonic
983136014 4:164081521-164081543 CCGAAGCCTGGGAACTCCTGGGG + Intronic
985829906 5:2220640-2220662 TTGAAGCCTGAGGTTTGCTGCGG - Intergenic
985889050 5:2701594-2701616 CCGAAGCATGAAGTGTCCTGTGG - Intergenic
986569680 5:9152196-9152218 CACAGGCCTGCGGCTTCCTGTGG + Intronic
988003972 5:25384253-25384275 CCGAATACTGCGCTTTTCTGAGG - Intergenic
1007707168 6:43798074-43798096 CCTCAGACTGCGGTTCCCTGAGG - Intergenic
1012011083 6:93786577-93786599 CAGAAGCCTGCGGTTCCCACAGG - Intergenic
1017104439 6:150874599-150874621 CTGAAGCCTGGGGGCTCCTGTGG + Intronic
1018213389 6:161503830-161503852 TAGAAGCCTGTGGATTCCTGGGG - Intronic
1019409246 7:899474-899496 CGGAAGCCTTCCGTTTGCTGTGG + Exonic
1022533355 7:31080694-31080716 CCGGAGCCTGGGATCTCCTGAGG - Intronic
1033486138 7:141790816-141790838 CCGAATGCTGCTGTTTCCTTGGG - Exonic
1041089435 8:54288384-54288406 CCGAAGCCAGAGGTCCCCTGGGG - Intergenic
1049616379 8:143577450-143577472 CCCAAGACGGCGGTTACCTGGGG + Intronic
1051235395 9:14993507-14993529 CCGGGGTCTGCGGTTTGCTGCGG + Intergenic
1057102865 9:92379796-92379818 CCGAAGCCTGCATTTTTTTGTGG + Exonic
1057913108 9:99035344-99035366 CCAGAGCCTTCGGTATCCTGGGG - Exonic
1059251824 9:112892638-112892660 CAGAAGCCTGGGGGTTCCTAGGG - Intergenic
1061260419 9:129477514-129477536 CCACAGGCTGCGGTTTCCAGAGG + Intergenic
1062682468 9:137789144-137789166 CCGCAGCCTCCCGTTTCCTGTGG + Intronic
1186638944 X:11434550-11434572 CTGAAGCCAGGGGTTTCTTGAGG - Intronic
1187181535 X:16947219-16947241 CCGAGGCCTCCGGGTCCCTGGGG - Intronic
1187533478 X:20116700-20116722 CCGAGGGCTTCGGGTTCCTGTGG - Intronic
1190429702 X:50367439-50367461 TAGAAGCCTGTGCTTTCCTGTGG - Exonic
1191022511 X:55877800-55877822 CAGAAGCCTGGGGTTTGCTGTGG + Intergenic
1198113491 X:133523169-133523191 CTGAAGTCTACGGTTTCATGTGG + Intergenic