ID: 1167238061

View in Genome Browser
Species Human (GRCh38)
Location 19:48326820-48326842
Sequence CTGCAGTGGAAGCCTGGGGA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 537
Summary {0: 1, 1: 0, 2: 5, 3: 47, 4: 484}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167238061_1167238067 -2 Left 1167238061 19:48326820-48326842 CCCTCCCCAGGCTTCCACTGCAG 0: 1
1: 0
2: 5
3: 47
4: 484
Right 1167238067 19:48326841-48326863 AGCCATGTCACTCCTCTTGCTGG 0: 1
1: 0
2: 0
3: 11
4: 141
1167238061_1167238069 1 Left 1167238061 19:48326820-48326842 CCCTCCCCAGGCTTCCACTGCAG 0: 1
1: 0
2: 5
3: 47
4: 484
Right 1167238069 19:48326844-48326866 CATGTCACTCCTCTTGCTGGTGG 0: 1
1: 0
2: 1
3: 12
4: 140

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167238061 Original CRISPR CTGCAGTGGAAGCCTGGGGA GGG (reversed) Exonic
900203822 1:1422635-1422657 CTGCGGTGGAACCCGGGAGACGG - Intergenic
900536425 1:3179912-3179934 ATCCGGTGGCAGCCTGGGGAAGG - Intronic
900623819 1:3599152-3599174 CTGCGGGGCCAGCCTGGGGAGGG + Intronic
900688381 1:3963787-3963809 ATGCAGTGAAAGCGTGGGAAAGG + Intergenic
900710589 1:4110954-4110976 CTGGCGTGGGAGCCTGTGGAGGG + Intergenic
900740077 1:4325758-4325780 CTGCAGGGGCAGCCTGAGGCTGG - Intergenic
900805204 1:4763075-4763097 CTGCAGCTGAAGCCTTGGGTTGG - Intronic
901115531 1:6840829-6840851 GTGAAGTGGAAGCCAGGAGAAGG + Intronic
901838528 1:11939327-11939349 CTTCAGTTCAAGCCTGGGGTGGG + Intronic
902256625 1:15193263-15193285 AGGCAGTGGCAGCCTGGAGAGGG - Intronic
902289463 1:15427049-15427071 CTGCAGGGGAGGCCTGAGGCTGG + Intronic
902441180 1:16431162-16431184 CTGGGGAGGAAGCCTGGGCAGGG + Intronic
902451597 1:16499756-16499778 CTGACGTGCAATCCTGGGGAAGG + Intergenic
902575012 1:17372227-17372249 CTGCGGTGCAGGCCTGAGGATGG + Exonic
903127898 1:21260199-21260221 CTGGAGTGGAAGCCAGGGGGCGG + Intronic
903652337 1:24929801-24929823 CCGCAGGGGAAGGCCGGGGAGGG + Exonic
903848266 1:26291132-26291154 CTGGGGTGGAGGCCTGTGGAGGG - Intronic
904344144 1:29857125-29857147 CAGCTGTGGAGGCCTGGGGTTGG + Intergenic
904629416 1:31829905-31829927 CTGCTGGGGAAGGGTGGGGAGGG + Intergenic
904672282 1:32174767-32174789 CTTCCCTGGCAGCCTGGGGAAGG + Exonic
904873533 1:33636339-33636361 AGGTGGTGGAAGCCTGGGGATGG - Exonic
904914573 1:33960607-33960629 CTGCAGTGGAAGCCTGTGCCAGG + Intronic
905986756 1:42292005-42292027 CAGGAGTGGGAGCCAGGGGATGG + Intronic
907336342 1:53702237-53702259 CTGGAGAGGCAGCCTGGTGAGGG - Intronic
907556690 1:55350383-55350405 GTGAAGGGGAAGGCTGGGGAAGG + Intergenic
907722017 1:56981002-56981024 CTGCACAGGAAGCATGGGGCTGG + Intergenic
910666162 1:89727827-89727849 CAGCAGTGGGAAACTGGGGAAGG + Intronic
910803884 1:91171487-91171509 CTGCTTGGGGAGCCTGGGGATGG - Intergenic
912498919 1:110108954-110108976 CTGCAGAGGGAGCAGGGGGATGG - Intergenic
912823074 1:112882865-112882887 CTGCAGGGGAAGTCTGGACAGGG - Intergenic
913237701 1:116799046-116799068 CTGCATTGGGAGCCTTGGGTGGG + Intergenic
913338688 1:117734449-117734471 CTCCAGAGCAAGCCTGGGGGCGG - Intergenic
913565896 1:120071598-120071620 CGGCAGTGGAAGACAGTGGAGGG - Intergenic
913632237 1:120721955-120721977 CGGCAGTGGAAGACAGTGGAGGG + Intergenic
914286482 1:146230962-146230984 CGGCAGTGGAAGACAGTGGAGGG - Intergenic
914547513 1:148681704-148681726 CGGCAGTGGAAGACAGTGGAGGG - Intergenic
914618999 1:149388649-149388671 CGGCAGTGGAAGACAGTGGAGGG + Intergenic
915473322 1:156138479-156138501 CTGCAGTGGGAGCCCTGGGAAGG - Exonic
915515652 1:156410959-156410981 GTGCTGTGGAGGCATGGGGAAGG - Intronic
915568700 1:156732081-156732103 CTGCTGGGGATGCCTGGGGAAGG + Exonic
915660805 1:157403560-157403582 CTGCAGGGGAGGCCTTGGGCTGG + Intergenic
915716076 1:157946470-157946492 CTGCAGTGCCAGCCTAGGCATGG - Intergenic
916854609 1:168736994-168737016 CTTCAGTGGAATCCTGGAGGTGG + Intergenic
917794315 1:178521764-178521786 CTCCAGTGGAGGCCTGGGGTTGG - Intronic
918324254 1:183394714-183394736 CTGCAGTGGAAGGCTAGAGGAGG - Intronic
920108129 1:203568924-203568946 CTGAGGAGGCAGCCTGGGGAAGG - Intergenic
920228023 1:204451952-204451974 CTGTAGTTGCAGCCTGGGGCAGG - Intronic
920364532 1:205441063-205441085 CTGCAGGGAAAGGCAGGGGAGGG + Intronic
920409855 1:205750435-205750457 CTGGAGTGGAAACCAGGGGGCGG - Intergenic
920863880 1:209735226-209735248 CTGCATTGGAAGTTTGGAGAGGG + Intergenic
922145819 1:222943123-222943145 CTGCAGGGCCAGCCTCGGGATGG - Exonic
922765008 1:228152058-228152080 CTGCAGTGGAGTGCAGGGGAAGG + Intronic
923335542 1:232966770-232966792 CTGAAGTGGAAGCCTGTGAGGGG + Intronic
924436870 1:244049436-244049458 CTGCAGTGGCGCCCGGGGGAGGG + Intronic
924501719 1:244644530-244644552 CTGCAGTGGGAGACTTGTGAGGG - Intergenic
1063114899 10:3066806-3066828 CTGCAGAGGAAACCTGGGGGCGG + Intronic
1063612803 10:7577013-7577035 CTGCAGTGGAAGCACAGGGAGGG + Intronic
1064035275 10:11909121-11909143 CTGCAGTGGAAGCGGCGTGAGGG - Intergenic
1064955089 10:20899377-20899399 CTGCACTGCAAGCCTGATGAAGG - Intronic
1065214654 10:23438718-23438740 CTGCAGTGGATGCTGCGGGATGG - Intergenic
1066351500 10:34641342-34641364 CTGCCGGGGAAGCCTGGAGGAGG + Intronic
1066659030 10:37721368-37721390 CTGCAGAGGCATCCTGGGGAGGG + Intergenic
1067043451 10:42970610-42970632 CTGCAGAGGCTTCCTGGGGAGGG + Intergenic
1067432046 10:46251345-46251367 CTGCATCCGGAGCCTGGGGATGG + Intergenic
1067578081 10:47420324-47420346 CTGCATCCGGAGCCTGGGGACGG - Intergenic
1067655768 10:48190165-48190187 CTGCAGTTGAAGTCTGAGGTGGG - Intronic
1069562216 10:69438856-69438878 TTTCAGGGGAAGCCTGGGGAAGG + Intergenic
1069593443 10:69655781-69655803 GTGCAGTGTACGCGTGGGGAAGG + Intergenic
1069947340 10:71997137-71997159 CTGCAGTGGAAGAGTGGGGAGGG - Intronic
1070698014 10:78577434-78577456 CTGAGTTGGAAGCCTGGGCAAGG + Intergenic
1070721598 10:78760888-78760910 CTGCAGTAGAAGCCCCGGCACGG - Intergenic
1070801449 10:79246678-79246700 CTGCAGCCGAGGCTTGGGGAAGG - Intronic
1071018750 10:81028129-81028151 ATGCAGAGGAAGAGTGGGGAGGG - Intergenic
1071256584 10:83877255-83877277 CTGCAGTGGAGGGATGGGGGAGG - Intergenic
1071385554 10:85116631-85116653 CATCAGTGGTTGCCTGGGGATGG - Intergenic
1071525396 10:86355298-86355320 CTCCAGTGGAGGCATGGGGAAGG + Intronic
1071550181 10:86560654-86560676 CTGCAGTGGGGAGCTGGGGAGGG - Intergenic
1072797645 10:98368185-98368207 GTGCAGTGCCAGCCTGTGGAAGG - Intergenic
1074096303 10:110316367-110316389 CTGCAGTAGAAACTTGAGGAAGG - Intergenic
1075650982 10:124128261-124128283 CAGCAGTGGGACCCTGGGGGAGG + Intergenic
1076141767 10:128085015-128085037 CTGCAGTGGACACCTGGGGTTGG - Exonic
1077141495 11:1026821-1026843 CTGCAGCGGGTGCCTGGGGCTGG - Intronic
1077211810 11:1374669-1374691 CTGCAGGGGAAGCCTGATGCTGG - Intergenic
1078222255 11:9361732-9361754 CTGCTTTGGGAGGCTGGGGAAGG - Intergenic
1078460841 11:11514274-11514296 CTGCAGGGCCAGCCTGGGGCAGG - Intronic
1079014482 11:16856950-16856972 CTGCTTTGGAGGCCTGGGCAAGG + Intronic
1079136230 11:17777268-17777290 CTGCAGTTCTTGCCTGGGGAGGG - Intronic
1079172035 11:18105778-18105800 CCGCAGCGCACGCCTGGGGAGGG + Intronic
1079402541 11:20117562-20117584 CTCCTGTGGAAGCCTTGGCAGGG - Intronic
1080706575 11:34701251-34701273 CAGCAGAGGAGGCCTGGGCAGGG + Intergenic
1080918136 11:36680906-36680928 CTGCAGTGTAAGCCATGAGAGGG + Intergenic
1081718838 11:45271502-45271524 CTGGAGAGGAAGGCTGGGGTTGG + Intronic
1083554835 11:63617871-63617893 CTGTACAGGAAGCCTGGGGGAGG - Intergenic
1083759903 11:64810133-64810155 CTGCAAGGCAAGCCGGGGGAGGG + Intronic
1083849282 11:65355605-65355627 CTGCCCTGGCATCCTGGGGACGG + Intronic
1083981951 11:66179423-66179445 CAGCTTTGGAAGCCTGGGGCGGG - Intronic
1084003829 11:66313131-66313153 CTGCAGTCGGAGGCGGGGGATGG - Intergenic
1084265861 11:68004752-68004774 CTGCAGCGGGAGCCTGTGGTGGG + Intronic
1084710446 11:70840699-70840721 AGGAAGTGGGAGCCTGGGGAGGG + Intronic
1084764710 11:71300789-71300811 CATCAGTGAAACCCTGGGGACGG + Intergenic
1084858342 11:72002958-72002980 CCCCAGTGCAAGTCTGGGGAAGG + Exonic
1085317758 11:75555618-75555640 CTGCGCTGCAACCCTGGGGAAGG - Intergenic
1086135167 11:83437508-83437530 CTGCAGTGGGAACCTGGAGTGGG - Intergenic
1088746900 11:112811516-112811538 CTGGAGTTGGAGCCTTGGGAGGG + Intergenic
1088858527 11:113778534-113778556 CAGCAAGGGGAGCCTGGGGAGGG + Intergenic
1089766758 11:120773519-120773541 ATGCAGTGGCAGCCTGGAGTGGG + Intronic
1090162506 11:124510386-124510408 CTGCAATGGCAGTCAGGGGACGG + Intergenic
1090405659 11:126474601-126474623 ATGCAGTGGAAGGCTGGGACAGG - Intronic
1090444045 11:126748266-126748288 CTGCCGCTGAAGCCTGGGCAAGG - Intronic
1090549654 11:127806141-127806163 CTGCAGGGGAAGGTTGGAGAGGG + Intergenic
1091361529 11:134981896-134981918 CTGCAGTGTTATCCTGGGGATGG + Intergenic
1091926405 12:4354430-4354452 CTGCAGTGGCTGCCTCTGGAGGG - Exonic
1092039397 12:5370700-5370722 CTGGAGGGGAAGCTTGGGGGAGG - Intergenic
1092057551 12:5520533-5520555 TTTCAGTGGAAGGGTGGGGAGGG + Intronic
1092744954 12:11664682-11664704 CTGGAATGGAAGCTTTGGGAGGG + Intronic
1093316302 12:17655208-17655230 CTTCAGTGGAAGCATATGGATGG + Intergenic
1094097286 12:26721017-26721039 ATTCAGTGGAGGGCTGGGGATGG + Intronic
1094272244 12:28629867-28629889 CTCCAGCAGAAGCCTGAGGAGGG + Intergenic
1094406521 12:30121852-30121874 CTGTAGGGGAAGCCTGCAGACGG - Intergenic
1095956893 12:47812110-47812132 CTGCTGTGCCAGCTTGGGGAGGG - Intronic
1096078668 12:48819638-48819660 CTGCAGAGGAAGCCTCAGCAGGG - Intronic
1096497160 12:52045284-52045306 CTGCAGCAGAATCCTGGGGCTGG - Intronic
1096587237 12:52630650-52630672 CAGCAGTGGTAGCCTTTGGAGGG - Intergenic
1096782508 12:53999413-53999435 GGGTAGGGGAAGCCTGGGGAAGG - Intronic
1097277721 12:57824501-57824523 ATCCATTGGAAGCCTGGTGAGGG - Intronic
1097931211 12:65188984-65189006 CTGCAGTGGATGCCTGAAAATGG + Intronic
1098977683 12:76920350-76920372 CTGCACAGGAAGCATGGTGATGG + Intergenic
1099062869 12:77934114-77934136 CTGCAGTGATGGGCTGGGGAGGG + Intronic
1100016942 12:90023197-90023219 CTGCAATTGAAGCCTGGAGCGGG + Intergenic
1100302716 12:93322969-93322991 CTGCAGAGGAAGTCAGGGCAAGG + Intergenic
1100703854 12:97178938-97178960 CTGCAGAGTAGTCCTGGGGAGGG + Intergenic
1101281668 12:103263768-103263790 CTGCAGTGGAAGGATTTGGAAGG - Intronic
1101452213 12:104790056-104790078 TTGAAGTGGAAGACTCGGGATGG - Intergenic
1102077966 12:110074970-110074992 CTGAACTGGAAGCCAGGGGTCGG - Intergenic
1102655746 12:114480970-114480992 CTGCAGCGGAGAGCTGGGGAAGG + Intergenic
1102867702 12:116387090-116387112 CTGCATTGGGAGCCTGGCCAAGG - Intergenic
1103933851 12:124465041-124465063 CTGCAGTGGCAGCCTGAGGCAGG - Intronic
1104075119 12:125381913-125381935 CTGAAGTGGAAGCTTGGAGGTGG + Intronic
1104512676 12:129394807-129394829 CTTTAGTGGTTGCCTGGGGATGG + Intronic
1104723617 12:131061055-131061077 CTGCAGTGGGGGCTGGGGGAGGG - Intronic
1105546608 13:21355436-21355458 CTTCAGAGCTAGCCTGGGGAGGG + Intergenic
1105752401 13:23433553-23433575 CTGCAGGAGCGGCCTGGGGACGG - Intronic
1107022799 13:35768330-35768352 CTGCAGCAGCAGCCTGTGGATGG + Intergenic
1107372371 13:39766707-39766729 CTTCTGTGGGAGCTTGGGGAGGG - Intronic
1108030612 13:46225378-46225400 CTGCTGCTGAAGCCTGGGGCAGG - Intronic
1108228608 13:48316369-48316391 CTGCAGTGGTAGCCTGAGGAAGG - Intronic
1109620610 13:64900310-64900332 CTGCACAGGAAGGGTGGGGATGG - Intergenic
1110264881 13:73526024-73526046 ATGGATTGGAAGCATGGGGAGGG + Intergenic
1113055328 13:106260833-106260855 CTGCAGAAGAGGCCTGGGGTGGG - Intergenic
1114454668 14:22846993-22847015 CAGCATTGGAAGGCTGGGGCCGG + Exonic
1115907192 14:38212529-38212551 CTACATTGGAAGCCTGAGCAGGG + Exonic
1116531359 14:45977464-45977486 CTGGGGAAGAAGCCTGGGGAAGG + Intergenic
1116883704 14:50197613-50197635 CTGCAGTGTAATCCTGTGGTTGG - Intronic
1117277918 14:54208291-54208313 CTGCAGAGGAAGCCTGCGGAGGG - Intergenic
1117967279 14:61218942-61218964 CTGCGGTGGAAGCCTCAGGAGGG - Intronic
1118221751 14:63860879-63860901 CTGCAGTGGAAACATGAGCAGGG + Intronic
1119086095 14:71740308-71740330 CTGCAGCGGAATCCTTTGGATGG - Exonic
1119641438 14:76318148-76318170 CTGGGGTGGAAGACTGGGGAAGG - Intronic
1120844900 14:89117072-89117094 CTGAGGTGGAAGCCAGGGAATGG - Intergenic
1121017418 14:90557006-90557028 CTGCAGTGGCCGCATGGGAATGG - Intronic
1121732204 14:96194619-96194641 GTGCAGTGGAAACCAGAGGATGG + Intergenic
1121846891 14:97180007-97180029 CTGCAGTGGAAGCTCGGAGGTGG + Intergenic
1122125335 14:99575710-99575732 GGCCAGTGGAAGCCTGGAGAGGG - Intronic
1122509771 14:102257019-102257041 GTGGTGTGGGAGCCTGGGGAAGG - Intronic
1122616701 14:103022897-103022919 GTGCAGTGGGAGCCTGAGGGGGG - Intronic
1122918914 14:104871584-104871606 CTGCAGTGGATGCCAAGGGAGGG - Intronic
1202921833 14_KI270723v1_random:34700-34722 TCCCAGCGGAAGCCTGGGGACGG + Intergenic
1202923083 14_KI270724v1_random:2881-2903 TCCCAGCGGAAGCCTGGGGACGG - Intergenic
1124038710 15:26080647-26080669 CTCAAGTGGAAGGCTGGGAATGG - Intergenic
1124143423 15:27097691-27097713 CTGCTGCTGAAGCCTGGGGGAGG + Intronic
1124665798 15:31591293-31591315 CTGCAGCGGATACATGGGGAAGG + Intronic
1125796406 15:42407079-42407101 CTGTAGGGAAAGCCGGGGGAAGG - Intronic
1126101190 15:45119239-45119261 CTGGAGTGGAGTCCTGAGGAAGG - Exonic
1127722015 15:61712209-61712231 CTGAACTGGTATCCTGGGGAAGG - Intergenic
1127832942 15:62766895-62766917 CTGGAGTGGACACCTAGGGAGGG - Intronic
1128338491 15:66803474-66803496 CTGCAGGAGAGGCCTGTGGAGGG + Intergenic
1128347035 15:66860859-66860881 TGGCACTGGCAGCCTGGGGAAGG + Intergenic
1128644332 15:69363995-69364017 CTGCAGTGCAAGTCTGGAAACGG - Intronic
1128740702 15:70082035-70082057 CTGCAGGGAAAGGCTGGGGTGGG + Intronic
1128875772 15:71200049-71200071 CTGAAGGAGAAGCCTAGGGATGG - Intronic
1129217483 15:74108441-74108463 CTGCTGTGGAAGCCTCAGGGAGG - Intronic
1129227773 15:74179910-74179932 CTGCACTGGGAGCCTCAGGAGGG - Intronic
1129740012 15:77985553-77985575 CTGCAGGGGAAGCCAGGGTGAGG - Intronic
1129845748 15:78767052-78767074 CTGCAGGGGAAGCCAGGGTGAGG + Intronic
1130256112 15:82326808-82326830 CTGCAGGGGAAGCCAGGGTGAGG - Intergenic
1130598841 15:85263178-85263200 CTGCAGGGGAAGCCAGGGTGAGG + Intergenic
1131824173 15:96304179-96304201 CTGAAGCTGAAGCCAGGGGAGGG + Intergenic
1132012488 15:98288246-98288268 CTGCTCTGGAAGCCTTGGCAGGG - Intergenic
1132116061 15:99137307-99137329 CTGCAGTGGAGGCCACAGGAGGG + Exonic
1132326228 15:100973027-100973049 CTAGAGTGGAAGCTCGGGGAGGG + Intronic
1133338352 16:5021005-5021027 CTGCAGTGGGAGCTGGGGTAGGG + Intergenic
1133608723 16:7413327-7413349 CTACAGAGGAAGACTGGGGAAGG - Intronic
1134264615 16:12682474-12682496 AAGCAGTGGCAGCCTGGGGTGGG + Intronic
1134410804 16:14001796-14001818 CTGCAGATCAAGCTTGGGGAAGG - Intergenic
1135117877 16:19738993-19739015 CTGCAGAGGGAGCATGGGGAGGG - Intronic
1135978116 16:27124552-27124574 CTGGAGAGGAAGCCTGGGAAGGG - Intergenic
1136656394 16:31711745-31711767 CTGCTGTGGAAGCCTGGACTGGG + Intergenic
1136867242 16:33768139-33768161 AGGCAGTGGAAGCCAGGGGCGGG - Intergenic
1137379192 16:47981845-47981867 GTGCAGTGGAGGCCTGGGTCAGG - Intergenic
1137685188 16:50381868-50381890 GTGAAGTGAAAGCCTGGGGCAGG - Intergenic
1138251097 16:55502619-55502641 CTGCAGTGGAAGGAAGGGCATGG - Intronic
1138366509 16:56482837-56482859 CTGCAGGGGAGGCCGGGAGATGG - Intronic
1138978601 16:62239326-62239348 CTGCAGTGGAATCCTGGTTTGGG + Intergenic
1139268389 16:65660378-65660400 CAGCACTGAAAGCCTGGGGAAGG - Intergenic
1141621407 16:85238402-85238424 CTGCAGCGGTAGCCTGGTGGGGG + Intergenic
1141811527 16:86379320-86379342 CGGCACTGGAGCCCTGGGGATGG - Intergenic
1142372607 16:89691433-89691455 CTGATGGGGATGCCTGGGGAGGG - Exonic
1203104920 16_KI270728v1_random:1348064-1348086 AGGCAGTGGAAGCCAGGGGCGGG + Intergenic
1203128594 16_KI270728v1_random:1614304-1614326 AGGCAGTGGAAGCCAGGGGCGGG - Intergenic
1142468105 17:147371-147393 CTGCTGGGGAAGCCCGGGGCCGG + Exonic
1142615323 17:1130883-1130905 CTGCCCCGGCAGCCTGGGGAGGG + Intronic
1143637733 17:8176068-8176090 CTGCAGGGCAGGCCTGGGGGCGG + Intronic
1143686595 17:8522384-8522406 CTTCAGTGGAAGCTGGGAGAAGG + Intronic
1144370790 17:14589638-14589660 TTGGAGTGGAAGCCTAGGGCAGG + Intergenic
1144427623 17:15158596-15158618 CTGCTTTGGAAGCCTGAGGCTGG - Intergenic
1145204710 17:20977020-20977042 CTTCACTGGGGGCCTGGGGAAGG - Intergenic
1145826927 17:27884056-27884078 ATGCAGCGGTTGCCTGGGGATGG - Intronic
1146525440 17:33563487-33563509 CTCCAGTGGTGGGCTGGGGATGG - Intronic
1149644942 17:58233814-58233836 CTCTGGTGGAAACCTGGGGAGGG - Intronic
1150291159 17:63983229-63983251 CTGCAGGTGAAGCTTGGGGGTGG - Intergenic
1150480308 17:65503993-65504015 ATGCAGGGAAAGCCTGGGGATGG + Intergenic
1150649392 17:67000107-67000129 TTGCAGAGAGAGCCTGGGGAAGG - Intronic
1151590369 17:75039823-75039845 CTACAGTGGCTGCCTGGGGATGG - Intronic
1151763529 17:76121010-76121032 CTGTAGTGAGTGCCTGGGGAGGG - Intronic
1152032774 17:77854296-77854318 CTGCAGCAGAGGCCAGGGGAGGG - Intergenic
1152092960 17:78257099-78257121 TTGCAGTGGAAGGATGGGCAGGG + Intergenic
1152246486 17:79187331-79187353 GCGCAGGGGAAGCCTGAGGATGG - Intronic
1152649042 17:81483511-81483533 CGGCAGTGGACCTCTGGGGACGG - Intergenic
1153848636 18:9072405-9072427 CTACTGGGGAAGGCTGGGGAAGG - Intergenic
1154004478 18:10515325-10515347 CTGAAACGGAAGCTTGGGGATGG + Intergenic
1154493774 18:14941032-14941054 CTGCAGTGTTATCCTGGGGATGG - Intergenic
1155090541 18:22504892-22504914 CAGAGGTGGAAGCCTGGAGAAGG + Intergenic
1157090226 18:44628023-44628045 CTACAGTGGATGTCTGGGCAGGG - Intergenic
1157413925 18:47486364-47486386 CTGCAGAGGAAACAAGGGGATGG - Intergenic
1157592725 18:48845279-48845301 GGGCAGTGGAAGCCTGGGCTGGG - Intronic
1157718985 18:49908989-49909011 CTGGAGGGGCAGCCTGGGGCTGG - Intronic
1157815208 18:50725128-50725150 GGGCAGTGGGAACCTGGGGAAGG - Intronic
1159010907 18:63057912-63057934 CTGCAATGGATGCCCGGGGAGGG + Intergenic
1160114521 18:76064951-76064973 CTGCAGTGCAGGACTGGGAAGGG - Intergenic
1160340614 18:78085779-78085801 CTGCTGTGCCAGGCTGGGGAAGG - Intergenic
1160820406 19:1055167-1055189 CTACACTGGCAGGCTGGGGATGG - Exonic
1160911111 19:1474216-1474238 CTTGAGTGGAAACCTGGGCAAGG - Exonic
1161250183 19:3276088-3276110 CTGGGGTGGGACCCTGGGGAGGG + Intronic
1161436620 19:4267517-4267539 CAGCAGTGGAAGAGTGGGCATGG + Intronic
1161985392 19:7650631-7650653 CTGGAGTGGGTGCCTGGGGAGGG + Intergenic
1162996496 19:14339162-14339184 GTGTAGTGGGAGCCTGGGCAGGG - Intergenic
1163268225 19:16234108-16234130 CTGCTGGGGCAGCCTGGGGCTGG - Intronic
1163510741 19:17733620-17733642 CTGTGCTGGAAGCCTGGGGGAGG + Intronic
1163761971 19:19142210-19142232 CTGCCACGGGAGCCTGGGGAGGG + Intergenic
1163785866 19:19274674-19274696 GGGCAGTGGACACCTGGGGAAGG - Intergenic
1163786170 19:19275966-19275988 CTGCAGAGGGAGGTTGGGGAGGG - Intergenic
1163823705 19:19511090-19511112 GTGCAGTGGGAGTCTAGGGAAGG + Intergenic
1165110412 19:33498914-33498936 CTGGAGGGGCAGCCTGGGGTGGG - Intronic
1167238061 19:48326820-48326842 CTGCAGTGGAAGCCTGGGGAGGG - Exonic
1167241875 19:48348773-48348795 GGGCAGTAGAAGCCTTGGGAGGG - Intronic
1167285409 19:48596304-48596326 CTGCAATGGGGGCCTGGGGGAGG + Intronic
1167429853 19:49447965-49447987 CTGCGGTTGAGGCCTGGGCAGGG - Intronic
1167578620 19:50329397-50329419 CAGCACTGGTAGCCAGGGGAAGG + Intronic
1167843242 19:52139330-52139352 GTGAAGGGGCAGCCTGGGGAGGG + Intronic
1167864147 19:52310505-52310527 CTGCACAGGATGCCTGGGCAGGG - Intronic
925653930 2:6124460-6124482 CTCCAGTGTAAGCCTGGGCCTGG + Intergenic
925955028 2:8955018-8955040 CTCCATTGCAAGCCTGGGGCAGG - Intronic
927875684 2:26653773-26653795 CTACAGTGGAGTCCTGGGAAGGG - Intergenic
928174547 2:29024775-29024797 CTGCAGAGGCAGCCTGAGCATGG + Intronic
928679096 2:33680744-33680766 CTGCAGTGGAGGCCTGGGTATGG - Intergenic
929823838 2:45294883-45294905 CTGGAGAGGAAGCCTAGGGTGGG - Intergenic
929957457 2:46469599-46469621 GTGAAGTGGAAGGATGGGGAGGG - Intronic
930227248 2:48806329-48806351 CTGCATTGGAAATTTGGGGATGG + Intergenic
931458169 2:62428229-62428251 TGGCAGTGGCAGCCAGGGGAGGG + Intergenic
934084371 2:88497732-88497754 CTGCAGTGTAACCCTGGTGAAGG + Intergenic
934516202 2:94988399-94988421 CCACAGTGGAAGCCTGAGAAGGG + Intergenic
934521530 2:95023075-95023097 TTGCAGAGCCAGCCTGGGGAAGG - Intergenic
936125919 2:109789160-109789182 CTGCAGTGGTGGCCTGGTGAAGG - Intergenic
936218774 2:110582308-110582330 CTGCAGTGGTGGCCTGGTGAAGG + Intergenic
936457667 2:112687686-112687708 CTGCTGAGCAAGCCAGGGGAGGG + Intergenic
937155325 2:119714873-119714895 CTGCAATGCAAGCTTGGGCAAGG + Intergenic
937249381 2:120513981-120514003 CTGCAGTGGGGCCTTGGGGATGG + Intergenic
937468866 2:122158230-122158252 CTGCATTGGAAGAATGGGAAAGG + Intergenic
938132892 2:128732449-128732471 GTGTAGTGGAAGCCTCGGGTAGG - Intergenic
938648195 2:133352628-133352650 GTGTAGTGGAGGCATGGGGATGG + Intronic
941008470 2:160270842-160270864 CTGAAGTGGAATTCTGGGGTTGG - Intronic
942568149 2:177287047-177287069 CTGCAAGGGAAGCCTGGGAAAGG - Intronic
942657183 2:178226141-178226163 ATGCAGTGACAGCCTGGGTAGGG + Intronic
943266403 2:185738435-185738457 AAGCTGTGGGAGCCTGGGGATGG + Intergenic
943283240 2:185964428-185964450 CTGAAAGGGAAGACTGGGGAGGG - Intergenic
944602793 2:201320648-201320670 CCCCTGTGGAAGCCAGGGGATGG - Intronic
945066264 2:205949883-205949905 CTGCAGGGGAAGCCCAGCGAGGG + Intergenic
945251646 2:207769749-207769771 CTCCAGTGGACTCCTGGGGGCGG + Intergenic
945945899 2:215995265-215995287 CTGCTCTTGAGGCCTGGGGAAGG - Intronic
948857301 2:240736025-240736047 CTGCAGGGGCAGCCAGGGCAGGG - Intronic
1168833988 20:864776-864798 CTGCAGTGGGATCCTGGGAAAGG + Intergenic
1168957755 20:1846472-1846494 CTGCAGGGGAGCCCTGGGAATGG + Intergenic
1171245147 20:23604715-23604737 CAGCATTGGAATCCTGAGGATGG + Intronic
1171570680 20:26247999-26248021 TGGCAGTGTGAGCCTGGGGATGG + Intergenic
1172701448 20:36855921-36855943 CTGCCGGAGAGGCCTGGGGAGGG - Intronic
1173104956 20:40125079-40125101 CTGAAGTGGAAGGTTGGGCAGGG + Intergenic
1173502760 20:43565872-43565894 CTGCCCTGGAAGCCTTGGGCTGG - Exonic
1175120875 20:56715392-56715414 CCTCTGTGAAAGCCTGGGGAGGG - Intergenic
1175202817 20:57289868-57289890 CTGCAATGCCACCCTGGGGATGG + Intergenic
1175248888 20:57597193-57597215 CTGCAGTCGAGACCTGCGGAGGG + Intergenic
1175736023 20:61387867-61387889 CGGCAGTGGAGACCTGGGGCGGG - Intronic
1175844505 20:62051465-62051487 CTGCACGTGCAGCCTGGGGAGGG - Intronic
1175991753 20:62793370-62793392 CTCCAGTGGGAACCTGGGCAGGG - Intergenic
1177616249 21:23524740-23524762 CTTCAGTGGCAGCCTGTCGATGG + Intergenic
1178296389 21:31413813-31413835 CAGCACTGGAACCCTGTGGAAGG - Intronic
1179194565 21:39153094-39153116 CTGCAGGGCAAGCCTGGATAAGG - Intergenic
1179396081 21:41041060-41041082 CTTCAGTGGAAACCAGGAGAGGG + Intergenic
1179631415 21:42680763-42680785 CGGGAATGGAGGCCTGGGGAGGG - Intronic
1179970853 21:44836163-44836185 CTGCAGGGGTAGGGTGGGGATGG - Intergenic
1180588342 22:16914005-16914027 CAGCAGTCACAGCCTGGGGAAGG - Intergenic
1180590216 22:16930862-16930884 CTGGAGTGGAACCCTGGGAATGG - Intergenic
1180763249 22:18224569-18224591 CTGCAGGGGTAGCCTTAGGAAGG + Intergenic
1180772398 22:18399978-18400000 CTGCAGGGGTAGCCTTAGGAAGG - Intergenic
1180803776 22:18649594-18649616 CTGCAGGGGTAGCCTTAGGAAGG - Intergenic
1180806988 22:18719855-18719877 CTGCAGGGGTAGCCTTAGGAAGG + Intergenic
1180948410 22:19709328-19709350 CTGCCGGGACAGCCTGGGGATGG + Intergenic
1181217943 22:21345665-21345687 CTGCAGGGGTAGCCTTAGGAAGG + Intergenic
1181286053 22:21753463-21753485 CGGCAGTGGAGGCCTGGCCAGGG + Intergenic
1181317293 22:21978938-21978960 CTGCAGTGATGGCCTTGGGAGGG + Intronic
1181539382 22:23565384-23565406 CTCCATAGGAGGCCTGGGGAGGG + Intergenic
1182065673 22:27429937-27429959 CTGCAGTGGAAGGGCTGGGAGGG - Intergenic
1182149965 22:28020987-28021009 CTGCCTTGGAAGCCAGGTGAGGG - Intronic
1182420108 22:30244888-30244910 CTGCACTGGAAACATGGGGCGGG - Exonic
1182596283 22:31423441-31423463 CTGAATTGGAAGCCTTGTGATGG + Intronic
1182684455 22:32110781-32110803 CTGAAGTGGAGGCCTGAGGAAGG + Exonic
1183346931 22:37313145-37313167 CGCCAGTGGGAGCCTGGAGAGGG + Intronic
1183404689 22:37624704-37624726 CTGGAGTGGAGGCCTGGAGGCGG + Intronic
1183566080 22:38616301-38616323 CTGCAGTGGCTGCCGGGGGCAGG + Intronic
1183590267 22:38775813-38775835 GTGCAGGGGAGGCCTGGCGATGG + Intronic
1183744281 22:39684422-39684444 CTGCAGCGCAATCTTGGGGAGGG - Exonic
1183748839 22:39707644-39707666 CTGCAGGTGAAGCCTGAGCAGGG - Intergenic
1184027464 22:41868531-41868553 CTGCAGCAGAAACCTGAGGATGG - Intronic
1184321142 22:43742946-43742968 CTGGAGAGCAAGGCTGGGGAAGG + Intronic
1184348625 22:43928413-43928435 CTGCATGGGAATTCTGGGGAGGG + Intronic
1184673490 22:46027844-46027866 CGGCAGGGGAAGCTGGGGGAGGG - Intergenic
1184749049 22:46473702-46473724 CTGCTGTGAAGGCCTCGGGAAGG - Intronic
1185082764 22:48718830-48718852 CTGCAGGGCAAGCCTGGTGCAGG - Intronic
1185236249 22:49715089-49715111 GGGCAGTGGTTGCCTGGGGAGGG + Intergenic
1203234237 22_KI270731v1_random:140966-140988 CTGCAGGGGTAGCCTTAGGAAGG - Intergenic
949159180 3:859815-859837 CTGCAGCTGAAGACTCGGGAAGG - Intergenic
950429074 3:12940645-12940667 TTGCAGGGGCAGGCTGGGGAGGG - Intronic
950431121 3:12951809-12951831 CCCCAGTGGAAACCTAGGGAGGG + Intronic
950576848 3:13837228-13837250 CTGCTGTGGAGTCCTGGGGCAGG - Intronic
950866074 3:16190305-16190327 CTGGAGGGGGAGCCTGAGGATGG - Intronic
952970080 3:38645265-38645287 CTGCAGGGGAAGCCTGGGACGGG - Intronic
953265378 3:41381779-41381801 GTGAAGTGGAAGCCTTTGGAGGG - Intronic
953680509 3:45035210-45035232 CTGAGGTGGAGGCCTGGGAAGGG + Intronic
953875070 3:46662088-46662110 CTGGACTGGGTGCCTGGGGAGGG - Intergenic
954131547 3:48563733-48563755 CTGCTGTGGCTGCCTGGGGCTGG + Exonic
954384873 3:50238713-50238735 CTGCCATGGCTGCCTGGGGAGGG + Intronic
954437685 3:50504571-50504593 CTTCAGTAGAATCCTAGGGATGG - Intergenic
954615088 3:51965441-51965463 CTGACTTGGAAGCCTGCGGAGGG - Intronic
954785897 3:53092249-53092271 CTGCCCTAGAGGCCTGGGGAGGG + Intronic
956397074 3:68837441-68837463 CTGGAGTGGAAGGAAGGGGAGGG - Intronic
956426922 3:69145329-69145351 CTGCAAAGGGAGCCTGGGGAGGG + Intergenic
957053484 3:75427397-75427419 CTGCACAGGATGCCTGGGGCTGG + Intergenic
957939945 3:86991325-86991347 CTGCAGGGGGACCCCGGGGAAGG + Intergenic
960506372 3:118499795-118499817 CTGGGGAGGAAGGCTGGGGAAGG - Intergenic
961179411 3:124864906-124864928 CACCTGTGGAAGCCAGGGGATGG - Intronic
961340570 3:126214244-126214266 AGGCATTGGAAGCCTGGGAAGGG - Intergenic
961364921 3:126393590-126393612 CTGCAGAGGTAGGCTGGGGCCGG + Intergenic
961368287 3:126414983-126415005 CTGATGTGGAGGCCTGGGCAGGG - Intronic
961457931 3:127033443-127033465 CTCCTGTGGCACCCTGGGGAAGG - Intronic
961471308 3:127114866-127114888 CAGCAATGAGAGCCTGGGGAGGG + Intergenic
961552273 3:127676262-127676284 CTGCTCTAGAAGCCTGGGGAGGG - Exonic
962047305 3:131774277-131774299 CAGCAGGGGAAGCCTGCTGAGGG + Intronic
962331948 3:134486071-134486093 GTGCAGGGGAAGTCTGGAGAAGG + Intronic
962344772 3:134610955-134610977 CTGCAGGGGAACCCCGGGGCAGG + Intronic
962827051 3:139107901-139107923 CTGCATTAGAAGGCGGGGGATGG - Intronic
962887177 3:139638370-139638392 CTGGAGTGGGGGCCTTGGGATGG - Intronic
963519716 3:146348460-146348482 CTGCTGTGGAAGCCTCCAGATGG + Intergenic
964538560 3:157753907-157753929 GTGCAGAGTAAGCCAGGGGATGG + Intergenic
966427245 3:179792551-179792573 CTGGAGTGGAAGCCAGGAGAAGG + Intergenic
966624362 3:182000485-182000507 CTGAAGTGGAAACCTTGGGAAGG + Intergenic
967041457 3:185697185-185697207 CTGCACTGGAACCCAGGAGATGG - Intronic
968130488 3:196190208-196190230 CTGGAGTAGAAGCCTCTGGAAGG - Intergenic
969305141 4:6321989-6322011 ATGAAGTGGAGTCCTGGGGAGGG + Exonic
969621500 4:8281090-8281112 CTCCAGGGGCAGCCAGGGGAAGG - Intronic
969675365 4:8611466-8611488 CTGCAGTGGAAGCTGGAGGGTGG + Intronic
971372418 4:26029307-26029329 CAGCAGGGCCAGCCTGGGGAGGG - Intergenic
971523552 4:27586220-27586242 CTGAAGTGGGAGCCCAGGGAGGG - Intergenic
975814730 4:78205886-78205908 CTTGAGAGGAAGCCTGAGGAAGG + Intronic
975904083 4:79188815-79188837 TAGCAGTGGAAGCTTGGGGTGGG + Intergenic
976478638 4:85513253-85513275 CTTCAGTGGACACCTGGGGTGGG + Intronic
976569781 4:86594618-86594640 CTGTAGAAGGAGCCTGGGGAGGG - Exonic
977796733 4:101174692-101174714 ATGAAGTGTAAGTCTGGGGAAGG + Intronic
978621786 4:110640106-110640128 CTGGACTGGGAGCCTGGGGAAGG + Intronic
980354671 4:131725441-131725463 CTTCAGGGGCAGCCTGGGGGTGG + Intergenic
980355201 4:131727947-131727969 CTTCAGGGGCAGCCTGGGGGTGG + Intergenic
980355747 4:131730431-131730453 CTTCAGGGGCAGCCTGGGGGTGG + Intergenic
980356288 4:131732925-131732947 CTTCAGGGGCAGCCTGGGGGTGG + Intergenic
980356823 4:131735413-131735435 CTTCAGGGGCAGCCTGGGGGTGG + Intergenic
980357361 4:131737901-131737923 CTTCAGGGGCAGCCTGGGGGTGG + Intergenic
980357903 4:131740380-131740402 CTTCAGGGGCAGCCTGGGGGTGG + Intergenic
980358439 4:131742879-131742901 CTTCAGGGGCAGCCTGGGGGTGG + Intergenic
980358973 4:131745360-131745382 CTTCAGGGGCAGCCTGGGGGTGG + Intergenic
980359514 4:131747833-131747855 CTTCAGGGGCAGCCTGGGGGTGG + Intergenic
980360058 4:131750317-131750339 CTTCAGGGGCAGCCTGGGGGTGG + Intergenic
980360597 4:131752796-131752818 CTTCAGGGGCAGCCTGGGGGTGG + Intergenic
980361138 4:131755268-131755290 CTTCAGGGGCAGCCTGGGGGTGG + Intergenic
980361680 4:131757751-131757773 CTTCAGGGGCAGCCTGGGGGTGG + Intergenic
980362221 4:131760223-131760245 CTTCAGGGGCAGCCTGGGGGTGG + Intergenic
980362763 4:131762706-131762728 CTTCAGGGGCAGCCTGGGGGTGG + Intergenic
980779222 4:137475616-137475638 TTGCAGTGGAAGGCTGTGAAAGG - Intergenic
980948429 4:139347028-139347050 CTGTAGTGGGAGGCTGGGGGTGG - Intronic
981861777 4:149364095-149364117 CTGAACTGGAAGACTGGAGAAGG + Intergenic
982026507 4:151257668-151257690 ATGCTTTGGGAGCCTGGGGAGGG + Intronic
982266560 4:153543518-153543540 AGGCAGTGAGAGCCTGGGGAAGG + Intronic
984654291 4:182300521-182300543 CTGGAGTGGACACCTGGTGACGG + Intronic
984931388 4:184850465-184850487 CTGCTGGGGATGCCTGGGAAAGG + Intergenic
985706852 5:1406389-1406411 GTGCAGCCGAAGCCTGGGGCCGG - Intronic
985718575 5:1476558-1476580 CTGCAGCAGGAGCCTGGGGGTGG + Intronic
986082077 5:4405470-4405492 CTGCAGGGGAAGCTTGAGTAGGG + Intergenic
986631699 5:9780310-9780332 GTGCAGTGGAGGGCTGGTGATGG - Intergenic
987736401 5:21849407-21849429 CTGCAGTGCATTCCTGGGCATGG + Intronic
988416964 5:30957658-30957680 CTACACTGGCAGCCTGGGGGGGG - Intergenic
988444590 5:31271417-31271439 ACGCAGTGGAAGGCTGAGGAAGG - Intronic
988464282 5:31473559-31473581 CTGCAGTAGAAGCTTCAGGAAGG - Intronic
988537790 5:32084384-32084406 CTGCATTGGAAGGATGAGGACGG - Intronic
991042474 5:62190243-62190265 TTGGAGGGGAAGCCTGGGCAGGG + Intergenic
991045442 5:62218083-62218105 CTACAGTGGGAGCTTTGGGAGGG - Intergenic
992556298 5:77906758-77906780 CCAAAGTGGAAGCCTGGGGCTGG + Intergenic
992663499 5:78984580-78984602 CTGAGGTGGGAGGCTGGGGAGGG - Intronic
995715028 5:115073867-115073889 CTGAAAGGGAAGACTGGGGAGGG - Intergenic
996022112 5:118602743-118602765 ATGAAGTGGAGGCATGGGGATGG - Intergenic
998561167 5:143173101-143173123 ATGCAGTGGGACCCAGGGGAGGG + Intronic
999261132 5:150239608-150239630 CTGCACTGGGAACCTGGGGCGGG - Intronic
999768468 5:154757143-154757165 CTGCAGAGGAATGCTGGGAAGGG - Intronic
999871392 5:155755004-155755026 CAGAGGTGGCAGCCTGGGGAGGG - Intergenic
1001677100 5:173528133-173528155 CTCCAGTACAAGCCTGTGGATGG + Intergenic
1001744648 5:174082992-174083014 AAGCAGAGGAAGCCTGAGGAAGG - Intronic
1001933885 5:175691255-175691277 CTGGAGAGGAAGTCAGGGGAAGG + Intergenic
1002045855 5:176541584-176541606 CTGCAGAGGAGGCCTGGGGGAGG - Intergenic
1002169276 5:177366349-177366371 CTTCACTGTAAGCCTGGGGTAGG + Exonic
1002449368 5:179310198-179310220 CTGCTGTGGGGGCCTGTGGACGG + Intronic
1002526501 5:179818626-179818648 CTGAGGTGGAAGAGTGGGGAGGG - Intronic
1002837836 6:880407-880429 CTTCAGTGGAATGGTGGGGATGG + Intergenic
1003192741 6:3888689-3888711 CTGCAGTGGAAACCGGGGTGTGG - Intergenic
1003260265 6:4510462-4510484 CAGCAGTGGAACACTGGGGCTGG - Intergenic
1003320755 6:5049058-5049080 CTGCAGAGGAAGATTGGGAAAGG + Intergenic
1003421089 6:5959190-5959212 CTGCAGTGGGTGGCGGGGGAGGG + Intergenic
1003619461 6:7685188-7685210 CTGGAGAAGAAGCCTTGGGATGG + Intergenic
1004626158 6:17379286-17379308 CATCAGTGGGTGCCTGGGGATGG + Intergenic
1005354592 6:24970076-24970098 CTGGATGGGAAGCCTGGGAAAGG + Intronic
1006148215 6:31971713-31971735 CTACAGAGGAGGCCTGGAGAAGG + Exonic
1006408456 6:33858326-33858348 CCACAGTGGTAGCCTGGGGTGGG + Intergenic
1006677390 6:35774209-35774231 CTGGAGAGGAGGCCTGGGGATGG - Intergenic
1007519651 6:42441786-42441808 CTGGACTGGGAGCTTGGGGAAGG - Intronic
1009810912 6:68665042-68665064 CTGAAGGTGAAGCCTGGTGAAGG - Intronic
1010022416 6:71175963-71175985 CTGCAGTGGAAGCATGAGAAGGG - Intergenic
1010177908 6:73051191-73051213 CAGCAGTGGCAGCGTGGGGCAGG - Intronic
1010374090 6:75146166-75146188 GTGCAGTGGCAGCCTGTGGGAGG - Exonic
1010752785 6:79633225-79633247 GTGCAGTGTAAGCCTGGTTAAGG + Intronic
1012793810 6:103734752-103734774 CTGCAGTAGCAGCCTGGAGCTGG + Intergenic
1013832457 6:114290953-114290975 CAGCAGTGGAAAACTGGGGCTGG + Intronic
1013938510 6:115630817-115630839 CAGCAGAGGAAGCCTGTGTATGG + Intergenic
1013953718 6:115816628-115816650 TTGCATTGGAAGACTAGGGAAGG - Intergenic
1014199000 6:118588187-118588209 CTGAAAGGGCAGCCTGGGGAGGG + Intronic
1016324051 6:142879732-142879754 AGACTGTGGAAGCCTGGGGAGGG - Intronic
1016906395 6:149154751-149154773 CTGCAAAGGAAGCCAGAGGAGGG - Intergenic
1017234313 6:152103798-152103820 CTGAAATGGAAACCTGGGGTGGG - Intronic
1017680838 6:156862356-156862378 CTACAGTGGAAGCCACAGGAAGG + Intronic
1018621542 6:165733784-165733806 CTTCAGTGGAAGCTTGGTGCAGG - Intronic
1019014168 6:168867646-168867668 CTGCAGGGGTAGCATGGGGACGG + Intergenic
1019352917 7:563329-563351 CTGCAGAGGCAGCCTGTGGAGGG - Intronic
1019416957 7:932256-932278 CTGGAGAGGAAGGCTGGGGAGGG - Intronic
1019621146 7:1992673-1992695 CTGCTGGGGGAGCTTGGGGAAGG + Intronic
1019831590 7:3336193-3336215 CTGCTCTCGAAGCCTGGGAAGGG - Intronic
1021905203 7:25326549-25326571 CCCCAGTGGAGGGCTGGGGACGG + Intergenic
1022456559 7:30563369-30563391 GTGGACCGGAAGCCTGGGGAGGG + Intergenic
1022497628 7:30862997-30863019 CTGGATTGGCAGGCTGGGGAGGG - Intronic
1022529640 7:31058796-31058818 GGGCAGTGGAAGCATAGGGATGG + Intronic
1023696480 7:42852978-42853000 CTGAAGTGGAGGGTTGGGGAAGG - Intergenic
1024263174 7:47587048-47587070 CAGGAGAGGGAGCCTGGGGAGGG + Intergenic
1026380207 7:69791964-69791986 CTGGAGTAGGAGGCTGGGGAAGG + Intronic
1031895789 7:127347038-127347060 CAGCAGTGTATGCCTTGGGAAGG + Intronic
1032456911 7:132080100-132080122 CTGCCTGGGAATCCTGGGGAAGG - Intergenic
1033055031 7:138044002-138044024 CTGCAGTGGTAGTCTGTGAAGGG + Intronic
1033277674 7:139985044-139985066 CTCCAGCAGAATCCTGGGGAGGG - Intronic
1033280729 7:140004742-140004764 CTGCTGTGGCTGGCTGGGGAAGG - Intronic
1033862479 7:145644781-145644803 CTGCAGTGGAAGTCTGAGCAAGG + Intergenic
1034306818 7:150049740-150049762 CTGGATTGAAAGCTTGGGGAAGG - Intergenic
1034406375 7:150905528-150905550 CAGCAGAGGAGGCCTGGAGAGGG + Intergenic
1034453073 7:151148296-151148318 CTGAGGTGGACTCCTGGGGAGGG - Intergenic
1034477724 7:151296616-151296638 GTTCAGTGGTTGCCTGGGGATGG - Intergenic
1034587561 7:152108540-152108562 TTGCAGAGGAAGCCCTGGGAGGG + Intronic
1034800027 7:154050903-154050925 CTGGATTGAAAGCTTGGGGAAGG + Intronic
1034848969 7:154475959-154475981 CTGAATTGGAAGTCAGGGGACGG - Intronic
1035065761 7:156104192-156104214 CTGCGGTGGATGCCAGGGTAAGG - Intergenic
1035311841 7:157974618-157974640 TGGCAGTGGGAGCCTGGGCAGGG + Intronic
1036751612 8:11447042-11447064 CTGCAGTGGGAGCCTGCTGGTGG - Intronic
1037597465 8:20366492-20366514 CATCAGTGGTTGCCTGGGGATGG - Intergenic
1037913627 8:22758962-22758984 GAGAAGTGGAAGCCAGGGGAGGG + Intronic
1038335245 8:26640778-26640800 GGGCAGTGGATGCCAGGGGAGGG - Intronic
1039834784 8:41247853-41247875 CTGCAGGGGAAGCCGTGGGGTGG - Intergenic
1040536667 8:48316645-48316667 CTGGAGTTGGAGCCTGGGGGAGG + Intergenic
1040878149 8:52174838-52174860 CTCCAGTGAAAGCCTGGGAGGGG - Intronic
1041196988 8:55410489-55410511 GTCCAGTGGAAGCCCAGGGAAGG - Intronic
1041632945 8:60108652-60108674 CAGCAGAGCAAGCCTGGGGCAGG + Intergenic
1041925288 8:63229973-63229995 CTTCAGTAAAAGTCTGGGGAAGG + Intergenic
1042680358 8:71376881-71376903 CTGCGGAGGGAGCCTGGGCAGGG - Intergenic
1044999798 8:97869397-97869419 CTGCAGTGCGGGCCTGGGGAGGG - Intronic
1045489016 8:102655435-102655457 CTGCAGCGGAGTCGTGGGGAAGG - Intronic
1047757806 8:127932018-127932040 CAACAGAGGAAGCCTGAGGATGG - Intergenic
1049337900 8:142096253-142096275 CTGCAGAGGCTGCCTGGAGAGGG - Intergenic
1050296899 9:4214530-4214552 CTGGCGTGGGAGCTTGGGGAGGG - Intronic
1052706621 9:32001026-32001048 CTGCAGTGTGAGCCTTCGGAGGG + Intergenic
1053008562 9:34620658-34620680 AGGCACTGGAAGCCAGGGGAGGG - Intergenic
1053387221 9:37702610-37702632 CTGGAGTGAAGGCCTGGGAAGGG + Intronic
1054257980 9:62834072-62834094 CAGCAGAGGAAGACTGGGGCAGG - Intergenic
1055301911 9:74891325-74891347 CTGCTGTGGATGGGTGGGGAAGG - Intergenic
1056630567 9:88289699-88289721 CTGCCGTGCAGGCCTGGGGAGGG - Intergenic
1056759416 9:89404690-89404712 CTGCGGTGGGTGGCTGGGGACGG - Intronic
1057268867 9:93636027-93636049 CAGCTGTGGAAGCCATGGGATGG + Intronic
1057279912 9:93701932-93701954 CTGCAGAGGCGGCCTGGGGCTGG - Intergenic
1057825765 9:98371099-98371121 CATCCGTGGCAGCCTGGGGATGG - Intronic
1057906490 9:98987408-98987430 CAGCAGCCGCAGCCTGGGGAGGG + Intronic
1060345637 9:122813301-122813323 CTGCACTGCCAGCCTGGGCATGG + Intronic
1061026721 9:128054614-128054636 CTGCAGTGGAACTCTGGGAGAGG - Intergenic
1061556734 9:131374906-131374928 AGGCAGTGGTACCCTGGGGAGGG - Intergenic
1061939154 9:133874818-133874840 CTGCAGTTGTGGGCTGGGGAGGG - Intronic
1062016213 9:134292641-134292663 CTGCAGGGGAGGGCTGGGTACGG - Intergenic
1062232317 9:135488533-135488555 CTGCAGTGGTAGCCTGAGGAAGG + Exonic
1062622879 9:137430458-137430480 CAGCAGGGGAGGCCTGGGGTGGG + Intronic
1062708658 9:137959933-137959955 CAGGAGTGGAAGCGTGTGGAGGG + Intronic
1202800793 9_KI270719v1_random:174308-174330 CAGCAGAGGAAGACTGGGGCAGG + Intergenic
1186195870 X:7110030-7110052 CTGCAAGGGCAGCATGGGGAGGG + Intronic
1187592777 X:20736596-20736618 ATGAAGTGGAAGCCAAGGGAGGG + Intergenic
1192583026 X:72300410-72300432 CTGCCTGGGAAGTCTGGGGAAGG - Intronic
1195384638 X:104302672-104302694 CTGCAGTGCCAGCCTGGCAAGGG + Intergenic
1196983963 X:121247536-121247558 GGGTAGTGGAAGGCTGGGGAGGG - Intergenic
1199623026 X:149715838-149715860 CAGCACTGCAAGCCTGAGGAAGG + Exonic
1199635468 X:149808235-149808257 CAGCACTGCAAGCCTGAGGATGG + Intergenic
1199875329 X:151923686-151923708 CAGCACTGCAAGCCTGAGGAAGG + Exonic
1199881143 X:151974875-151974897 CCGCAGTGGCGGCGTGGGGACGG - Intergenic
1199894055 X:152115497-152115519 CAGCACTGCAAGCCTGAGGAAGG - Intergenic
1199955156 X:152736183-152736205 CAGCACTGCAAGCCTGAGGAAGG + Exonic