ID: 1167239322

View in Genome Browser
Species Human (GRCh38)
Location 19:48333907-48333929
Sequence CAGGTTCACCCGTGGGAACT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 96
Summary {0: 1, 1: 1, 2: 0, 3: 3, 4: 91}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167239314_1167239322 15 Left 1167239314 19:48333869-48333891 CCTGTCTGCTGAGGGCCGGGGTC 0: 1
1: 0
2: 0
3: 8
4: 168
Right 1167239322 19:48333907-48333929 CAGGTTCACCCGTGGGAACTGGG 0: 1
1: 1
2: 0
3: 3
4: 91
1167239315_1167239322 0 Left 1167239315 19:48333884-48333906 CCGGGGTCTCTTCGCAAACCCGT 0: 1
1: 0
2: 0
3: 6
4: 61
Right 1167239322 19:48333907-48333929 CAGGTTCACCCGTGGGAACTGGG 0: 1
1: 1
2: 0
3: 3
4: 91

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167239322 Original CRISPR CAGGTTCACCCGTGGGAACT GGG Intronic
901189669 1:7401904-7401926 CAGGAGCAGCCCTGGGAACTAGG + Intronic
902394628 1:16125901-16125923 CATGATCAGCAGTGGGAACTTGG - Intronic
902519097 1:17005675-17005697 CAGTTTCATCCGTGGTAAGTGGG - Exonic
910051916 1:82984936-82984958 CAGGTTCACCTGTGTGAGCTTGG - Intergenic
910861938 1:91750325-91750347 CAGGTTTACCAGTTGAAACTGGG + Intronic
912863731 1:113237844-113237866 CAGGTGCTCCCATGGGAGCTAGG - Intergenic
918372977 1:183880513-183880535 CAGGGGCACCCCTGGAAACTTGG - Intronic
918681300 1:187357838-187357860 CAGGTTCTTCCCTGGGTACTTGG + Intergenic
919532046 1:198734323-198734345 CAGTTTCATCCCTGGGACCTAGG - Exonic
920099069 1:203505638-203505660 CTGAGTCACCCGTGTGAACTGGG - Intronic
920400449 1:205672941-205672963 CATGTTCACCCTTGTGAAATAGG + Intronic
922562768 1:226581020-226581042 CAACTTCAACCATGGGAACTAGG - Intronic
1073294958 10:102433330-102433352 CAGGTTCACGAGTGCGAACATGG + Intergenic
1075009601 10:118856378-118856400 AAAGTTCAGCCGTGGGAGCTAGG + Intergenic
1076597769 10:131636385-131636407 CACATGCACCCGGGGGAACTGGG - Intergenic
1078003551 11:7516123-7516145 CAGAATCACCTGGGGGAACTTGG - Intronic
1078100175 11:8325791-8325813 CGGCTTTACCAGTGGGAACTGGG + Intergenic
1078359123 11:10654690-10654712 AAGGGTTACCTGTGGGAACTGGG + Intronic
1081323207 11:41716216-41716238 CAGATTCACCACTGGTAACTTGG - Intergenic
1082794907 11:57371689-57371711 CAGGGTCAGCCTTGGGAATTGGG + Intergenic
1084742064 11:71146446-71146468 GAGGTTGGCCCCTGGGAACTGGG - Intronic
1087716296 11:101612619-101612641 CAGGGTCACCCATCGGAAGTTGG - Intronic
1090133456 11:124170461-124170483 TAGCTTCTCTCGTGGGAACTTGG - Intergenic
1092101850 12:5889976-5889998 CAGGTTCACAGATGGGAAATAGG + Intronic
1093197154 12:16142929-16142951 AAGGTTCACCTCTGGGAAATGGG + Intergenic
1097811457 12:64023833-64023855 CAGGCTTACATGTGGGAACTGGG + Intronic
1099525755 12:83717945-83717967 CAGGTTCACCAGTGGGAATGTGG - Intergenic
1103980258 12:124732552-124732574 GAGGGTCACACGTGGGAACAAGG + Intergenic
1114083250 14:19219495-19219517 CAGGTCCTCCTGGGGGAACTGGG + Intergenic
1114426730 14:22629983-22630005 AGGGTTCACCAGTGGAAACTTGG + Intergenic
1116050017 14:39790896-39790918 AACGTTCACCAGTGTGAACTGGG - Intergenic
1118475174 14:66109700-66109722 CATGTTCCCCCTTGGGACCTGGG - Intergenic
1122773243 14:104106381-104106403 AAGGTGCAGCCGTGGGAACAGGG + Intronic
1122840852 14:104461878-104461900 CAGGTGCACCCGGGGGGCCTCGG + Intergenic
1122863523 14:104593302-104593324 CAGGCTCACAGGTGGGCACTGGG + Exonic
1124193237 15:27598319-27598341 CACATCCTCCCGTGGGAACTAGG - Intergenic
1129262865 15:74378547-74378569 CAGGATCACCTGGGGGAACCGGG - Intergenic
1132468425 16:88668-88690 TAGGTTGACCCGTTGGGACTGGG - Intronic
1139563208 16:67756863-67756885 GAGGTTCAGCCAAGGGAACTTGG - Intronic
1140259444 16:73364881-73364903 GTGGCTCACCCGTGGGAAATGGG - Intergenic
1143980021 17:10860905-10860927 AAGTTGCACCCGTAGGAACTGGG + Intergenic
1145901667 17:28494076-28494098 CTGGGTCAGCCCTGGGAACTTGG - Exonic
1147050039 17:37787341-37787363 CAGCTTCAGCCCTGTGAACTTGG - Intergenic
1148796174 17:50197966-50197988 CAGGCTCACCAGGGGGACCTTGG + Exonic
1157786710 18:50489935-50489957 CAGGTTCTGCCCTGTGAACTGGG - Intergenic
1161226893 19:3150975-3150997 CAGGATCACCCCTAGGAACAGGG - Intronic
1166678061 19:44751266-44751288 CAGGTTCACCAGAGGAAACGGGG - Exonic
1167239322 19:48333907-48333929 CAGGTTCACCCGTGGGAACTGGG + Intronic
927519013 2:23688171-23688193 CAGGCCCACCCTTGGTAACTTGG - Intronic
936089258 2:109490388-109490410 CTGGTTCACCCGTGGGAACTGGG + Intronic
937061292 2:118982205-118982227 CAGGCTCACCCTTGGCACCTGGG - Exonic
941658893 2:168174071-168174093 CAGGTTTACAAATGGGAACTAGG + Intronic
943523644 2:188988604-188988626 CAGGTTCACCAGGGGGTCCTTGG - Exonic
946331247 2:219010324-219010346 CAGGAACACCTGTGGGCACTAGG + Intronic
1172448125 20:35003659-35003681 CAGGTTCACCAGGGGCCACTGGG - Intronic
1174711567 20:52711473-52711495 GAGTTTGACCCGTGGGGACTTGG + Intergenic
1175122163 20:56724168-56724190 CAGGTTCCCCCGTTGAGACTGGG - Intergenic
1178189997 21:30269088-30269110 CAGCCTCACCCGTGAGATCTGGG - Intergenic
1178436790 21:32567134-32567156 CAGGTCCACTCCTGGGGACTGGG + Intergenic
1180294723 22:10873772-10873794 CAGGTCCTCCTGGGGGAACTGGG - Intergenic
1180497529 22:15903186-15903208 CAGGTCCTCCTGGGGGAACTGGG - Intergenic
1181034124 22:20161729-20161751 CAGGTTCACCCGTGGCAGGTGGG - Intergenic
1181509231 22:23381672-23381694 CAGGTTCACCTGTGGCAGGTGGG + Intergenic
949693884 3:6671296-6671318 CAGGTTGGGCTGTGGGAACTAGG + Intergenic
949944715 3:9180770-9180792 CAGGATCTACAGTGGGAACTGGG - Intronic
954700542 3:52448591-52448613 CAGGTTCAGCCGTGGGGTATTGG - Intergenic
956901942 3:73726143-73726165 CAGGTTCAACACTGGGAGCTGGG + Intergenic
960836388 3:121911016-121911038 CAGGTTCAGCCTGGGTAACTTGG - Intronic
967034504 3:185638146-185638168 CAGTTTCATGCGTGTGAACTGGG - Intergenic
969457046 4:7306176-7306198 CAGGTGCAGCGGTGGGCACTGGG + Intronic
972738960 4:41873313-41873335 CCTGTTCACACGTGCGAACTGGG + Intergenic
978430077 4:108624359-108624381 CAGGTTTACCAATGGGAAATGGG + Intronic
979566726 4:122162468-122162490 CAGGTTCACAGATGGGAATTGGG + Intronic
980775662 4:137432680-137432702 CAGTTTCACATTTGGGAACTCGG - Intergenic
983671485 4:170243013-170243035 CAGGCGAACCCATGGGAACTGGG + Intergenic
984972244 4:185202107-185202129 CAGGTTCTCCTTTGGGTACTGGG - Intronic
986476776 5:8142586-8142608 CAGATTCACCTCTGGTAACTTGG - Intergenic
986796246 5:11215191-11215213 CAGATTCACACTTGGGAACAAGG + Intronic
986973993 5:13374231-13374253 CAGCTTCAGCAGTGGCAACTGGG + Intergenic
996348006 5:122508515-122508537 CATTTTCACCAGTAGGAACTGGG - Intergenic
1000795533 5:165660182-165660204 CAGGTTCTCACCTGGGTACTGGG + Intergenic
1007034460 6:38660663-38660685 CAGGCTCATGCTTGGGAACTAGG - Intergenic
1022115697 7:27258642-27258664 CAGGATCACCTGGGGGAGCTTGG - Intergenic
1027221667 7:76218096-76218118 CAGGCTCACACCTGGGAGCTAGG - Intronic
1028309613 7:89314923-89314945 CCTGTTCACCAGTAGGAACTTGG - Intronic
1030816849 7:114049394-114049416 CAGATTCACCACTGGTAACTTGG + Intronic
1047140197 8:122129999-122130021 CAGGGTCACCTGAGGTAACTAGG - Intergenic
1047985050 8:130224099-130224121 CAGGCTCAGCACTGGGAACTGGG - Intronic
1051596586 9:18830114-18830136 CAGACTCACCAGTGGAAACTTGG + Intronic
1056980864 9:91310017-91310039 CAGGTTGACCCAGGTGAACTTGG - Intronic
1057583935 9:96312917-96312939 CTGGTTCACCAGGGGGAACCAGG - Intergenic
1059450525 9:114368587-114368609 CAGGTTCACCTGTGGAAGCAGGG + Exonic
1062704060 9:137925077-137925099 CAGGTTTTCCCTGGGGAACTAGG - Intronic
1191247378 X:58238575-58238597 CAGAGGCACCTGTGGGAACTTGG + Intergenic
1195220423 X:102741054-102741076 CAGATTCACCAATGGTAACTCGG - Intronic
1199551871 X:149069605-149069627 CAATTTTACCTGTGGGAACTGGG + Intergenic