ID: 1167239437

View in Genome Browser
Species Human (GRCh38)
Location 19:48334330-48334352
Sequence TCTGGGGACCCGTACTGAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 78
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 72}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167239437_1167239445 2 Left 1167239437 19:48334330-48334352 CCTCTTCAGTACGGGTCCCCAGA 0: 1
1: 0
2: 1
3: 4
4: 72
Right 1167239445 19:48334355-48334377 TCAGTCGAGGGATCTATTTGGGG 0: 1
1: 0
2: 0
3: 5
4: 40
1167239437_1167239444 1 Left 1167239437 19:48334330-48334352 CCTCTTCAGTACGGGTCCCCAGA 0: 1
1: 0
2: 1
3: 4
4: 72
Right 1167239444 19:48334354-48334376 CTCAGTCGAGGGATCTATTTGGG 0: 1
1: 0
2: 0
3: 3
4: 37
1167239437_1167239446 10 Left 1167239437 19:48334330-48334352 CCTCTTCAGTACGGGTCCCCAGA 0: 1
1: 0
2: 1
3: 4
4: 72
Right 1167239446 19:48334363-48334385 GGGATCTATTTGGGGATTTTTGG 0: 1
1: 0
2: 0
3: 13
4: 171
1167239437_1167239447 11 Left 1167239437 19:48334330-48334352 CCTCTTCAGTACGGGTCCCCAGA 0: 1
1: 0
2: 1
3: 4
4: 72
Right 1167239447 19:48334364-48334386 GGATCTATTTGGGGATTTTTGGG 0: 1
1: 0
2: 3
3: 24
4: 268
1167239437_1167239439 -10 Left 1167239437 19:48334330-48334352 CCTCTTCAGTACGGGTCCCCAGA 0: 1
1: 0
2: 1
3: 4
4: 72
Right 1167239439 19:48334343-48334365 GGTCCCCAGAGCTCAGTCGAGGG 0: 1
1: 0
2: 1
3: 17
4: 1248
1167239437_1167239443 0 Left 1167239437 19:48334330-48334352 CCTCTTCAGTACGGGTCCCCAGA 0: 1
1: 0
2: 1
3: 4
4: 72
Right 1167239443 19:48334353-48334375 GCTCAGTCGAGGGATCTATTTGG 0: 1
1: 0
2: 0
3: 3
4: 47
1167239437_1167239448 12 Left 1167239437 19:48334330-48334352 CCTCTTCAGTACGGGTCCCCAGA 0: 1
1: 0
2: 1
3: 4
4: 72
Right 1167239448 19:48334365-48334387 GATCTATTTGGGGATTTTTGGGG 0: 1
1: 0
2: 3
3: 31
4: 529

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167239437 Original CRISPR TCTGGGGACCCGTACTGAAG AGG (reversed) Intronic
902923555 1:19681078-19681100 TCTGGGGTCCCAGATTGAAGGGG - Intergenic
905236920 1:36556321-36556343 TCTGGGCAACCCTACTGAAGTGG - Intergenic
905441122 1:37997134-37997156 TCTGGGAACCCAGACTGCAGGGG + Exonic
915279867 1:154815044-154815066 TCGGGCCACTCGTACTGAAGGGG - Intronic
915805605 1:158845680-158845702 TCTGGGGACTCGTATTTAAATGG - Exonic
920314941 1:205070404-205070426 TCTGGGGACCAATACAGAATGGG - Exonic
921910383 1:220542541-220542563 GCTGGGAACCCCTACTGACGTGG + Intronic
1065238352 10:23678789-23678811 CCTGGACACCTGTACTGAAGTGG + Intergenic
1067265172 10:44735537-44735559 GCTGGGGACCCCAACTGTAGTGG + Intergenic
1067792869 10:49301030-49301052 CCTGGAGACCCTTACTGAAGAGG + Intronic
1070173445 10:73950372-73950394 TCTGGGAAGCCAGACTGAAGAGG + Intergenic
1070955906 10:80463389-80463411 TCAGGGGAGCAGAACTGAAGGGG - Intronic
1072411265 10:95204069-95204091 TCTGGTGACCCAGACTGAAGTGG - Intronic
1074001560 10:109378827-109378849 TCGGGGGACCTAGACTGAAGGGG - Intergenic
1077039313 11:511679-511701 TCTGGAGATCCGTGCTGATGTGG + Intergenic
1077864346 11:6210617-6210639 TCTGGGGCCCCCTCCAGAAGGGG - Exonic
1085465667 11:76721746-76721768 TCTGGGGACCCGTACTGTGGGGG + Intergenic
1089215752 11:116833723-116833745 CCTTGGGACCCGGACTGGAGTGG + Intergenic
1096431242 12:51545048-51545070 GCTGGGGACCCCTGCTGTAGAGG - Intergenic
1104208195 12:126661012-126661034 TCTGGGGAACTGTAATGCAGAGG - Intergenic
1108704534 13:52973360-52973382 TCTGGGGACCCTTGCTGAATTGG + Intergenic
1112298704 13:98211170-98211192 TCTGGGGACCCCTCCTTTAGAGG - Intronic
1115308959 14:31960288-31960310 AGTGGGGACACGTCCTGAAGAGG + Intergenic
1118447095 14:65861963-65861985 TCTGGGGCCCTGTGCTGGAGGGG + Intergenic
1119419705 14:74501252-74501274 TCTGGGAACCTGCACGGAAGGGG + Intronic
1127842331 15:62842288-62842310 TGTGGGCACCAGTTCTGAAGAGG + Exonic
1128521852 15:68380588-68380610 TCTGGGGAGCCTTCCTGGAGGGG + Intronic
1130923140 15:88365770-88365792 TCTGGGGTCCTGGACAGAAGGGG - Intergenic
1134080295 16:11320103-11320125 TCAGGGAACCAGTGCTGAAGAGG - Intronic
1137550782 16:49436062-49436084 ACAGGGGACACCTACTGAAGAGG + Intergenic
1150002555 17:61451169-61451191 TCTGGGGATCCTTATTGATGAGG + Intergenic
1155514988 18:26615603-26615625 TCAGGGGACCAGTACTGTAAGGG - Intronic
1162790371 19:13059650-13059672 TTTGGGGAACCCTACTGGAGTGG + Intronic
1166407229 19:42529584-42529606 CCTGGGGACCCGCAGTGAACAGG - Intronic
1167239437 19:48334330-48334352 TCTGGGGACCCGTACTGAAGAGG - Intronic
926158873 2:10474303-10474325 TCTGGGTGCCCGTACTGGGGGGG - Intergenic
928843798 2:35644318-35644340 TTTGGGGAACCACACTGAAGGGG + Intergenic
937248540 2:120509609-120509631 TCTGGGGACCAGGACTGGAAGGG + Intergenic
937680642 2:124640699-124640721 TCTGGGAACCTTTACTGAGGGGG - Intronic
937984702 2:127633249-127633271 TCCGGGGCCCCGTCCTGAGGGGG - Exonic
948355153 2:237372014-237372036 CCTGGGGAGCCGCATTGAAGAGG - Exonic
1169800326 20:9507045-9507067 TCTGGGGACTCGTGCAGATGGGG - Intergenic
1174215322 20:48911977-48911999 TCTGGGGAACCTAACTGTAGTGG - Intergenic
1176092878 20:63326677-63326699 TCTGGGAACCAGGGCTGAAGTGG + Intronic
1179648740 21:42792897-42792919 GCTGGGGTCCCATACAGAAGGGG + Intergenic
1183503773 22:38197058-38197080 TTTGGGGACCCCTGCTGTAGAGG + Intronic
1184281767 22:43441457-43441479 TCTGAGGACCCGTGCTGACCAGG - Intronic
952960936 3:38588765-38588787 TCTGGGCACCCGCCCTGACGGGG + Intronic
954879048 3:53821618-53821640 TCTGGGGAGCAGTAAAGAAGGGG + Intronic
960761442 3:121077228-121077250 TCTGGGGACCCATCCGGGAGTGG - Intronic
973774518 4:54231880-54231902 TCTCGGGACGCGGACTGAGGAGG + Intronic
981591299 4:146365812-146365834 CTTGGGGACCCCTGCTGAAGAGG - Intronic
986664799 5:10091945-10091967 TCTTGGGACTCCTACTGCAGCGG - Intergenic
989736052 5:44708108-44708130 TCTGGGGACCACTACTATAGAGG + Intergenic
991489388 5:67167075-67167097 TGTGGAGACCCGTCCTGAACGGG + Exonic
998100215 5:139426649-139426671 ACTGGGAACCCGAACTGAGGGGG - Intronic
1000172682 5:158718472-158718494 TCTGAAGCCTCGTACTGAAGGGG + Intronic
1001171150 5:169420031-169420053 CCTGGTGACCTGTAATGAAGAGG - Intergenic
1002641634 5:180633263-180633285 GCTCTGGACCCGTAGTGAAGTGG - Intronic
1007712949 6:43836265-43836287 CCTGGTGACACCTACTGAAGGGG + Intergenic
1008071196 6:47100726-47100748 TCTGGGAACCAGTTCTGAAATGG + Intergenic
1017402532 6:154080700-154080722 TCTGGTGACCCGTACGTGAGTGG + Intronic
1018767474 6:166945343-166945365 TCTGGGGAGGCGTGATGAAGAGG - Intronic
1019167761 6:170110309-170110331 GCTGCAGACCCGTCCTGAAGAGG - Intergenic
1030323231 7:108192091-108192113 TTTGGGGACCCGTGCTCTAGAGG - Intronic
1030626344 7:111849732-111849754 TCTGGGGACCCCTGCTCCAGTGG - Intronic
1035034209 7:155884733-155884755 TCCGGGGAACCGGCCTGAAGGGG - Intergenic
1035369736 7:158372244-158372266 TCTGGGGACCAGCACTGGGGAGG - Intronic
1039588669 8:38728650-38728672 TCTGGGGACCCTCGCCGAAGAGG + Intronic
1043286384 8:78537065-78537087 TTTGGGGACCAGTTATGAAGGGG + Intronic
1049248592 8:141576174-141576196 TCTGGGTACCAGGACTGATGAGG + Intergenic
1051000958 9:12281004-12281026 TTTGGGGACCCCTACTTTAGTGG + Intergenic
1053462972 9:38284873-38284895 ACCGGGGAGCCGTGCTGAAGGGG - Intergenic
1056120071 9:83478951-83478973 TCTAGGGACCCGTAGTGCATAGG - Intronic
1059067017 9:111096077-111096099 TCTGGGAACCAGTGCAGAAGAGG - Intergenic
1186073328 X:5847704-5847726 TCTGGAGACACATATTGAAGGGG + Intronic
1186437059 X:9551897-9551919 TCTGGTGACCCCCACTGCAGGGG + Intronic
1192575272 X:72238747-72238769 CCTGGGGACCCGAACTGTTGAGG - Intronic