ID: 1167239439

View in Genome Browser
Species Human (GRCh38)
Location 19:48334343-48334365
Sequence GGTCCCCAGAGCTCAGTCGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1267
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 1248}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167239436_1167239439 -5 Left 1167239436 19:48334325-48334347 CCAGACCTCTTCAGTACGGGTCC 0: 1
1: 0
2: 0
3: 1
4: 51
Right 1167239439 19:48334343-48334365 GGTCCCCAGAGCTCAGTCGAGGG 0: 1
1: 0
2: 1
3: 17
4: 1248
1167239435_1167239439 -4 Left 1167239435 19:48334324-48334346 CCCAGACCTCTTCAGTACGGGTC 0: 1
1: 0
2: 0
3: 1
4: 37
Right 1167239439 19:48334343-48334365 GGTCCCCAGAGCTCAGTCGAGGG 0: 1
1: 0
2: 1
3: 17
4: 1248
1167239437_1167239439 -10 Left 1167239437 19:48334330-48334352 CCTCTTCAGTACGGGTCCCCAGA 0: 1
1: 0
2: 1
3: 4
4: 72
Right 1167239439 19:48334343-48334365 GGTCCCCAGAGCTCAGTCGAGGG 0: 1
1: 0
2: 1
3: 17
4: 1248
1167239431_1167239439 19 Left 1167239431 19:48334301-48334323 CCTGAGGAGGCGGGGAGGTCCTA 0: 1
1: 0
2: 0
3: 6
4: 127
Right 1167239439 19:48334343-48334365 GGTCCCCAGAGCTCAGTCGAGGG 0: 1
1: 0
2: 1
3: 17
4: 1248
1167239430_1167239439 20 Left 1167239430 19:48334300-48334322 CCCTGAGGAGGCGGGGAGGTCCT 0: 1
1: 0
2: 1
3: 12
4: 166
Right 1167239439 19:48334343-48334365 GGTCCCCAGAGCTCAGTCGAGGG 0: 1
1: 0
2: 1
3: 17
4: 1248
1167239432_1167239439 0 Left 1167239432 19:48334320-48334342 CCTACCCAGACCTCTTCAGTACG 0: 1
1: 0
2: 0
3: 4
4: 85
Right 1167239439 19:48334343-48334365 GGTCCCCAGAGCTCAGTCGAGGG 0: 1
1: 0
2: 1
3: 17
4: 1248
1167239424_1167239439 30 Left 1167239424 19:48334290-48334312 CCGCTTACTCCCCTGAGGAGGCG 0: 1
1: 0
2: 0
3: 1
4: 119
Right 1167239439 19:48334343-48334365 GGTCCCCAGAGCTCAGTCGAGGG 0: 1
1: 0
2: 1
3: 17
4: 1248
1167239429_1167239439 21 Left 1167239429 19:48334299-48334321 CCCCTGAGGAGGCGGGGAGGTCC 0: 1
1: 0
2: 1
3: 17
4: 170
Right 1167239439 19:48334343-48334365 GGTCCCCAGAGCTCAGTCGAGGG 0: 1
1: 0
2: 1
3: 17
4: 1248

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167239439 Original CRISPR GGTCCCCAGAGCTCAGTCGA GGG Intronic
900793015 1:4691943-4691965 GGTCTCCAGGGCTCAGAAGAGGG + Intronic
901100558 1:6715654-6715676 GCTCCCCACATCTCAGACGATGG + Intergenic
901201206 1:7468452-7468474 GGTGCCCAGATCTCTGTCCATGG + Intronic
901224014 1:7601361-7601383 GCTCCCCACATCTCAGACGATGG + Intronic
901270941 1:7952684-7952706 GCTCCCCACATCTCAGACGATGG - Intergenic
901341204 1:8500785-8500807 GCTCCCCACATCTCAGACGATGG - Intronic
901555555 1:10028917-10028939 GCTCCCCACATCTCAGACGATGG - Intergenic
901734871 1:11306002-11306024 GCTCCCCACATCTCAGACGATGG + Intergenic
901855756 1:12043249-12043271 GCTCCCCACATCTCAGACGATGG - Intergenic
901970307 1:12902853-12902875 GCTCCCCACATCTCAGACGATGG - Intronic
902014858 1:13298916-13298938 GCTCCCCACATCTCAGACGATGG + Intergenic
902018614 1:13328250-13328272 GCTCCCCACATCTCAGACGATGG - Intergenic
902463373 1:16597338-16597360 AGTCCCCAGAGCTCTGTCACAGG - Intronic
902936253 1:19766911-19766933 GGTCCCCAGAGATCAGAGGTAGG - Intronic
903100314 1:21023873-21023895 GCTCCCCACATCTCAGACGATGG - Intronic
903103355 1:21053156-21053178 GCTCCCCACATCTCAGACGATGG - Intronic
903147999 1:21387639-21387661 GCTCCCCACATCTCAGACGATGG - Intergenic
903158145 1:21463363-21463385 AGTCCCCAGAGCTCTGTCACAGG + Intronic
903458287 1:23503884-23503906 GCTCCCCACATCTCAGACGATGG - Intergenic
903485817 1:23688803-23688825 GCTCCCCACATCTCAGACGATGG - Intergenic
903508120 1:23853091-23853113 GCTCCCCACATCTCAGACGATGG - Intronic
903519381 1:23935597-23935619 GCTCCCCACATCTCAGACGATGG - Intergenic
903526422 1:23994687-23994709 GCTCCCCACATCTCAGACGATGG + Intergenic
903531250 1:24032258-24032280 GCTCCCCACATCTCAGACGATGG + Intergenic
903633877 1:24799263-24799285 GCTCCCCACATCTCAGACGATGG - Intronic
903638022 1:24834204-24834226 GCTCCCCACATCTCAGACGATGG + Intronic
903894712 1:26596092-26596114 GCTCCCCACATCTCAGACGATGG - Intergenic
903921664 1:26804235-26804257 GCTCCCCACATCTCAGACGATGG + Intergenic
903923495 1:26817725-26817747 GCTCCCCACATCTCAGACGATGG - Intergenic
903962069 1:27064025-27064047 GCTCCCCACATCTCAGACGATGG - Intergenic
904473296 1:30748805-30748827 GAGCCCCAGAGCCCAGTGGAGGG - Intronic
904532026 1:31176384-31176406 GCTCCCCACATCTCAGACGATGG - Intergenic
904627308 1:31814398-31814420 GGTTCCCAGTGCCCAGTGGAGGG - Exonic
904794897 1:33051595-33051617 GCTCCCCACATCTCAGACGATGG - Intronic
904831699 1:33309724-33309746 GCTCCCCACATCTCAGACGATGG + Intronic
905042038 1:34967989-34968011 GCTCCCCACATCTCAGACGATGG + Intergenic
905427311 1:37896128-37896150 GCTCCCCACATCTCAGACGATGG - Intronic
905461901 1:38127626-38127648 GGGCCCCAGAGTTCAGTAGAAGG - Intergenic
905527037 1:38647424-38647446 GCTCCCCACATCTCAGACGATGG - Intergenic
905686666 1:39913396-39913418 GCTCCCCATATCTCAGACGATGG + Intergenic
905699288 1:39999658-39999680 GCTCCCCACATCTCAGACGATGG - Intergenic
905968209 1:42117072-42117094 GGTGCCCAGGGCTCAGTCTTTGG - Intergenic
906136112 1:43501860-43501882 GCTCCCCACATCTCAGACGATGG - Intergenic
906357022 1:45115557-45115579 GCTCCCCACATCTCAGACGATGG + Intronic
906370321 1:45248045-45248067 GCTCCCCACATCTCAGACGATGG - Intronic
906427157 1:45724594-45724616 GCTCCCCACATCTCAGACGATGG - Intronic
906486728 1:46240756-46240778 GCTCCCCACATCTCAGACGATGG - Intergenic
906513721 1:46425803-46425825 TGTCCCCAGAGCTCAGCACAGGG - Intergenic
906741915 1:48192356-48192378 GCTCCCCACATCTCAGACGATGG - Intergenic
906761955 1:48383719-48383741 GCTCCCCACATCTCAGACGATGG + Intronic
907009799 1:50952683-50952705 GCTCCCCACATCTCAGACGATGG - Intronic
907140530 1:52181698-52181720 GCTCCCCACATCTCAGACGATGG - Intronic
907402410 1:54233195-54233217 GCTCCCCACATCTCAGACGATGG - Intronic
907453845 1:54562787-54562809 GCTCCCCACATCTCAGACGATGG + Intronic
907468183 1:54653334-54653356 GGTTCCCAGAGCTCAGACGAGGG - Exonic
908256053 1:62304558-62304580 GGTCACCTGAGGTCAGTGGAGGG - Intronic
908370160 1:63473090-63473112 GCTCCCCACATCTCAGACGATGG - Intronic
908467822 1:64414864-64414886 GCTCCCCACATCTCAGACGATGG - Intergenic
909479068 1:76112758-76112780 GCTCCCCACATCTCAGACGATGG + Intronic
909641176 1:77870464-77870486 GCTCCCCACATCTCAGACGATGG + Intronic
910343733 1:86215717-86215739 GCTCCCCACATCTCAGACGATGG - Intergenic
910406997 1:86899968-86899990 GCTCCCCACATCTCAGACGATGG + Intronic
910673828 1:89798193-89798215 GCTCCCCACATCTCAGACGATGG + Intronic
911351829 1:96762959-96762981 GCTCCCCACATCTCAGACGATGG + Intronic
911534040 1:99078873-99078895 GGTCCCCACATCTCAGACGATGG + Intergenic
911598539 1:99823530-99823552 GCTCCCCACATCTCAGACGATGG - Intergenic
911602083 1:99857232-99857254 GCTCCCCACATCTCAGACGATGG + Intronic
912266192 1:108160257-108160279 GCTCCCCACATCTCAGACGATGG + Intronic
912298567 1:108490210-108490232 GCTCCCCACATCTCAGACGATGG + Intergenic
912303006 1:108536314-108536336 GCTCCCCACATCTCAGACGATGG + Intergenic
912371513 1:109177437-109177459 GCTCCCCACATCTCAGACGATGG + Intronic
912677098 1:111693049-111693071 GGTACTCAGAGCTCAGTCCTGGG - Intronic
912825408 1:112899037-112899059 GCTCCCCACATCTCAGACGATGG + Intergenic
912844079 1:113063798-113063820 GCTCCCCACATCTCAGACGATGG + Intergenic
912844736 1:113069068-113069090 GCTCCCCACATCTCAGACGATGG - Intergenic
913022850 1:114804751-114804773 GCTCCCCACATCTCAGACGATGG + Intergenic
913306263 1:117430590-117430612 GCTCCCCACATCTCAGACGATGG + Intronic
913544082 1:119849869-119849891 GGTCCCCAGAGCTCTGTTACAGG - Intergenic
914212811 1:145596339-145596361 AGTCCCCAGAGCTCTGTCACAGG - Intergenic
914230910 1:145764412-145764434 GCTCCCCACATCTCAGACGATGG - Intronic
914775320 1:150729367-150729389 GCTCCCCACATCTCAGACGATGG + Intergenic
914780576 1:150781600-150781622 GCTCCCCACATCTCAGACGATGG - Intergenic
914887966 1:151600205-151600227 GCTCCCCACATCTCAGACGATGG - Intergenic
914893887 1:151651622-151651644 GCTCCCCACATCTCAGACGATGG + Intronic
914953989 1:152145058-152145080 GCTCCCCACATCTCAGACGATGG + Intergenic
914959954 1:152196684-152196706 GCTCCCCACATCTCAGACGATGG + Intergenic
914987386 1:152472274-152472296 GCTCCCCACATCTCAGACGATGG + Intergenic
915208353 1:154287535-154287557 GCTCCCCACATCTCAGACGATGG - Intergenic
916087546 1:161281844-161281866 GCTCCCCACATCTCAGACGATGG + Intronic
916104774 1:161422942-161422964 GCTCCCCACATCTCAGACGATGG - Intergenic
916131680 1:161616785-161616807 GCTCCCCACATCTCAGACGATGG + Intronic
916223390 1:162466018-162466040 GCTCCCCACATCTCAGACGATGG - Intergenic
916800066 1:168208031-168208053 GCTCCCCACATCTCAGACGATGG + Intergenic
917006141 1:170418868-170418890 GCTCCCCACATCTCAGACGATGG - Intergenic
917126700 1:171694106-171694128 GCTCCCCACATCTCAGACGATGG + Intergenic
917205915 1:172571674-172571696 GCTCCCCACATCTCAGACGATGG - Intronic
917376140 1:174350471-174350493 GCTCCCCACATCTCAGACGATGG + Intronic
917583182 1:176396983-176397005 GCTCCCCACATCTCAGACGATGG + Intergenic
917848465 1:179040995-179041017 GCTCCCCACATCTCAGACGATGG + Intronic
917889176 1:179418997-179419019 GCTCCCCACATCTCAGACGATGG + Intronic
918022800 1:180711150-180711172 GCTCCCCACATCTCAGACGATGG + Intronic
918172439 1:182010801-182010823 GCTCCCCACATCTCAGACGATGG - Intergenic
918228825 1:182510059-182510081 GCTCCCCACATCTCAGACGATGG + Intronic
918255389 1:182742119-182742141 GCTCCCCACATCTCAGACGATGG + Intergenic
919079945 1:192856960-192856982 GCTCCCCACATCTCAGACGATGG - Intergenic
919423850 1:197405652-197405674 GCTCCCCACATCTCAGACGATGG - Intronic
919625294 1:199904720-199904742 GCTCCCCACATCTCAGACGATGG + Intergenic
919925938 1:202191866-202191888 GCTCCCCACATCTCAGACGATGG + Intergenic
919959488 1:202452086-202452108 GCTCCCCACATCTCAGACGATGG + Intronic
920038629 1:203081981-203082003 GGCTCCCAGAACTCAGGCGAGGG - Intergenic
920143949 1:203842020-203842042 GCTCCCCACATCTCAGACGATGG + Intronic
920152520 1:203920097-203920119 GCTCCCCACATCTCAGACGATGG + Intergenic
920451478 1:206064007-206064029 GCTCCCCACATCTCAGACGATGG - Intronic
920794891 1:209129053-209129075 GCTCCCCACATCTCAGACGATGG - Intergenic
920872855 1:209808363-209808385 GGTCCCCAGAGCCCAGCCCTGGG - Intergenic
921142738 1:212321608-212321630 GCTCCCCACATCTCAGACGATGG + Intronic
921192747 1:212724820-212724842 GCTCCCCACATCTCAGACGATGG - Intergenic
921198056 1:212779014-212779036 GCTCCCCACATCTCAGACGATGG - Intronic
921238425 1:213152620-213152642 GCTCCCCACATCTCAGACGATGG + Intronic
922644847 1:227276177-227276199 GCTCCCCACATCTCAGACGATGG - Intronic
922765747 1:228155768-228155790 GGTCTCCAGAGCTGAGCCAATGG + Intronic
922849698 1:228722316-228722338 AGTCCTCAGAGCTCAGTCTTTGG + Intergenic
923137056 1:231128515-231128537 GCTCCCCACATCTCAGACGATGG - Intergenic
923267901 1:232331684-232331706 GCTCCCCACATCTCAGACGATGG - Intergenic
923267954 1:232331917-232331939 GCTCCCCACATCTCAGACGATGG - Intergenic
923468297 1:234267875-234267897 GCTCCCCACATCTCAGACGATGG + Intronic
923710739 1:236386528-236386550 GCTCCCCACATCTCAGACGATGG - Intronic
923840894 1:237669669-237669691 GGTCCCCACATCTCAGAGGATGG + Intronic
924692224 1:246363037-246363059 GCTCCCCACATCTCAGACGATGG - Intronic
924765945 1:247032180-247032202 GCTCCCCACATCTCAGACGATGG - Intergenic
924788338 1:247220449-247220471 GCTCCCCATATCTCAGACGATGG - Intergenic
924824097 1:247521955-247521977 GCTCCCCACATCTCAGACGATGG - Intronic
924925575 1:248676761-248676783 GCTCCCCATATCTCAGACGATGG - Intergenic
1062931803 10:1358095-1358117 GATGCCCAGAGCTAAGTCCAGGG - Intronic
1063267911 10:4474797-4474819 GTACCCCTGAGCTCAGTTGATGG + Intergenic
1063459578 10:6206666-6206688 GCTCCCCACATCTCAGACGATGG + Intronic
1063744911 10:8869035-8869057 GCTCCCCACATCTCAGACGATGG - Intergenic
1063776835 10:9273596-9273618 GCTCCCCACATCTCAGACGATGG + Intergenic
1064070782 10:12226676-12226698 GCTCCCCACATCTCAGACGATGG + Intronic
1064663649 10:17629499-17629521 GCTCCCCACATCTCAGACGATGG + Intergenic
1065055292 10:21837486-21837508 GCTCCCCACATCTCAGACGATGG - Intronic
1065335769 10:24655829-24655851 GCTCCCCACATCTCAGACGATGG - Intronic
1065337814 10:24672415-24672437 GGTACCCAGGGCTCAGTCTATGG + Intronic
1065594453 10:27296874-27296896 GCTCCCCACATCTCAGACGATGG + Intergenic
1065738010 10:28771743-28771765 GCTCCCCACATCTCAGACGATGG - Intergenic
1065840330 10:29696567-29696589 GCTCCCCACATCTCAGACGATGG - Intronic
1066085280 10:31969696-31969718 GCTCCCCACATCTCAGACGATGG - Intergenic
1066115277 10:32233694-32233716 GCTCCCCACATCTCAGACGATGG + Intergenic
1066325321 10:34352920-34352942 GCTCCCCACATCTCAGACGATGG - Intronic
1066390872 10:34976531-34976553 GCTCCCCACATCTCAGACGATGG - Intergenic
1066952871 10:42138158-42138180 GCTCCCCACATCTCAGACGATGG - Intergenic
1067026407 10:42847237-42847259 GCTCCCCACATCTCAGACGATGG - Intergenic
1067325143 10:45259889-45259911 GCTCCCCACATCTCAGACGATGG - Intergenic
1067354438 10:45512063-45512085 GCTCCCCACATCTCAGGCGATGG - Intronic
1067562579 10:47314322-47314344 GGTCTCCAGAGCCCAGCCTAAGG - Intergenic
1068006072 10:51393241-51393263 GCTCCCCACATCTCAGACGATGG + Intronic
1068043964 10:51862263-51862285 GGTGCCCACAGCTCAGTAAACGG + Intronic
1068969540 10:62947560-62947582 GCTCCCCACATCTCAGACGATGG - Intergenic
1069052740 10:63811844-63811866 GCTCCCCACATCTCAGACGATGG + Intergenic
1069365609 10:67691507-67691529 GCTCCCCACATCTCAGACGATGG - Intronic
1069645491 10:69993252-69993274 GCTCCCCACATCTCAGACGATGG + Intergenic
1069929039 10:71869941-71869963 GCTCCCCACATCTCAGACGATGG + Intergenic
1070318177 10:75333918-75333940 GCTCCCCACATCTCAGACGATGG + Intergenic
1070629708 10:78076087-78076109 GCTCCCCACATCTCAGACGATGG + Intergenic
1070684189 10:78469064-78469086 GCTCCCCACATCTCAGACGATGG + Intergenic
1071538277 10:86454808-86454830 GCTCCCCACATCTCAGACGATGG - Intronic
1071600577 10:86956904-86956926 GCTCTCCAGAGCACAGTCCAGGG - Intronic
1072150097 10:92675706-92675728 GCTCCCCACATCTCAGACGATGG + Intergenic
1072180269 10:92975181-92975203 GCTCCCCACATCTCAGACGATGG - Intronic
1072291679 10:93970656-93970678 GCTCCCCACATCTCAGACGATGG - Intergenic
1072367982 10:94733819-94733841 TATCTCCAGAGCTCAGTCTAGGG - Intronic
1072602440 10:96941822-96941844 GCTCCCCACATCTCAGACGATGG + Intronic
1072648147 10:97275358-97275380 GCTCCCCACATCTCAGACGATGG - Intronic
1072684658 10:97529144-97529166 GCTCCCCACATCTCAGACGATGG + Intronic
1072950050 10:99839846-99839868 GCTCCCCACATCTCAGACGATGG + Intronic
1072980128 10:100092795-100092817 GCTCCCCACATCTCAGACGATGG - Intergenic
1073238185 10:102035979-102036001 GCTCCCCACATCTCAGACGATGG - Intronic
1073274897 10:102301685-102301707 GCTCCCCACATCTCAGACGATGG + Intronic
1073386007 10:103128681-103128703 GCTCCCCACATCTCAGACGATGG - Intronic
1074152215 10:110767709-110767731 GCTCCCCACATCTCAGACGATGG + Intronic
1074587969 10:114787110-114787132 GCTCCCCACATCTCAGACGATGG - Intergenic
1075108556 10:119559742-119559764 GCTCCCCACATCTCAGACGATGG + Intergenic
1075128770 10:119721962-119721984 GCTCCCCACATCTCAGACGATGG - Intergenic
1075206910 10:120456621-120456643 GTTCCCCAGAGATCACTCGCGGG - Intergenic
1075439281 10:122466539-122466561 TCTCCCCAGAGCTCAGTACAGGG - Intronic
1075842744 10:125518344-125518366 GCTCCCCACATCTCAGACGATGG - Intergenic
1076011800 10:126995101-126995123 GCTCCCCAGATCCCAGACGATGG + Intronic
1076861338 10:133139608-133139630 GGTCTCCAGGGCTCTGTCGGGGG + Intergenic
1076914369 10:133414547-133414569 GCTCCCCACATCTCAGACGATGG + Intronic
1077397498 11:2332362-2332384 GCTCCCCACATCTCAGACGATGG - Intergenic
1077439856 11:2562745-2562767 GGTCCCCAGGCCTAAGTCTATGG + Intronic
1077469023 11:2748216-2748238 TGTCCCCAGACCTCGGGCGAGGG + Intronic
1077837035 11:5934621-5934643 GCTCCCCACATCTCAGACGATGG - Intronic
1078176839 11:8977988-8978010 GCTCCCCACATCTCAGACGATGG - Intergenic
1079018289 11:16887968-16887990 GCTCCCCACATCTCAGACGATGG - Intronic
1079020539 11:16906900-16906922 GCTCCCCACATCTCAGACGATGG - Intronic
1079039939 11:17050929-17050951 GCTCCCCACATCTCAGACGATGG + Intergenic
1079372052 11:19860411-19860433 GCTCCCCACATCTCAGACGATGG + Intronic
1079444787 11:20548362-20548384 GCTCCCCACATCTCAGACGATGG - Intergenic
1080097891 11:28429972-28429994 GCTCCCCACATCTCAGACGATGG - Intergenic
1080538347 11:33243661-33243683 GCTCCCCACATCTCAGACGATGG - Intergenic
1080620831 11:33986111-33986133 GCTCCCCACATCTCAGACGATGG - Intergenic
1080860014 11:36144504-36144526 GCTCCCCACATCTCAGACGATGG - Intronic
1081136215 11:39442504-39442526 GGCCCCCACAGCTCAGTGGCGGG + Intergenic
1081288620 11:41303702-41303724 GCTCCCCACATCTCAGACGATGG - Intronic
1081627281 11:44663546-44663568 GCTCCCCACATCTCAGACGATGG - Intergenic
1081738786 11:45423720-45423742 CTTCCCCAGAGCTCTGTCGTGGG + Intergenic
1081784879 11:45738895-45738917 GCTCCCCACATCTCAGACGATGG + Intergenic
1082844838 11:57717083-57717105 GCTCCCCACATCTCAGACGATGG + Intronic
1083030198 11:59585251-59585273 GGTCCCCACATCTCAGACGATGG - Intronic
1083042243 11:59699662-59699684 GCTCCCCACATCTCAGACGATGG - Intergenic
1083079238 11:60073393-60073415 GCTCCCCACATCTCAGACGATGG + Intergenic
1083118846 11:60491481-60491503 GCTCCCCACATCTCAGACGATGG - Intergenic
1083154555 11:60815085-60815107 GCTCCCCACATCTCAGACGATGG - Intergenic
1083208303 11:61166635-61166657 GCTCCCCACATCTCAGACGATGG + Intergenic
1083382242 11:62278535-62278557 GCTCCCCACATCTCAGACGATGG - Intergenic
1083442881 11:62688439-62688461 GGTTCCCAGAGCTCAGCCCTTGG - Exonic
1083646246 11:64172838-64172860 GCTCCCCACATCTCAGACGATGG + Intergenic
1083746627 11:64740686-64740708 GGACTCGAGAGCTCAGCCGACGG + Intronic
1083865421 11:65451010-65451032 GCTCCCCACATCTCAGACGATGG - Intergenic
1083918053 11:65763089-65763111 GCTCCCCACATCTCAGACGATGG + Intergenic
1084388764 11:68861465-68861487 GGTCCCCACATCTCAGACGATGG - Intergenic
1084745763 11:71168205-71168227 GCTCCCCACATCTCAGACGATGG + Intronic
1084924858 11:72502922-72502944 GCTCCCCACATCTCAGACGATGG + Intergenic
1085073688 11:73571859-73571881 GCTCCCCACATCTCAGACGATGG - Intronic
1085097762 11:73774996-73775018 GCTCCCCACATCTCAGACGATGG - Intergenic
1085112088 11:73897525-73897547 GCTCCCCACATCTCAGACGATGG + Intronic
1085139732 11:74129455-74129477 GCTCCCCACATCTCAGACGATGG + Intronic
1085292537 11:75410369-75410391 GCTCCCCACATCTCAGACGATGG + Intronic
1085360171 11:75878241-75878263 GCTCCCCACATCTCAGACGATGG + Intronic
1085480823 11:76821385-76821407 GCTCCCCACATCTCAGACGATGG - Intergenic
1085513432 11:77099110-77099132 GCTCCCCACATCTCAGACGATGG + Intronic
1085563153 11:77490064-77490086 GCTCCCCACATCTCAGACGATGG - Intergenic
1085754438 11:79191702-79191724 GCTCCCCACATCTCAGACGATGG - Intronic
1086104414 11:83133204-83133226 GCTCCCCACATCTCAGACGATGG - Intergenic
1086366031 11:86110554-86110576 GCTCCCCACATCTCAGACGATGG - Intergenic
1086792777 11:91063431-91063453 GCTCCCCACATCTCAGACGATGG - Intergenic
1086881444 11:92157502-92157524 GCTCCCCACATCTCAGACGATGG - Intergenic
1087057417 11:93947627-93947649 GCTCCCCACATCTCAGACGATGG + Intergenic
1087198368 11:95321456-95321478 GCTCCCCACATCTCAGACGATGG + Intergenic
1087214709 11:95482433-95482455 GCTCCCCACATCTCAGACGATGG - Intergenic
1087487043 11:98770215-98770237 GCTCCCCACATCTCAGACGATGG + Intergenic
1087948496 11:104194226-104194248 GCTCCCCACATCTCAGACGATGG - Intergenic
1088658993 11:112027320-112027342 GCTCCCCACATCTCAGACGATGG + Intronic
1089148421 11:116347002-116347024 GCTCCCCACATCTCAGACGATGG - Intergenic
1089421163 11:118332106-118332128 GCTCCCCACATCTCAGACGATGG + Intergenic
1089585690 11:119508263-119508285 GCTCCCCACATCTCAGACGATGG + Intergenic
1090152827 11:124403533-124403555 GCTCCCCACATCTCAGACGATGG + Intergenic
1090322857 11:125862823-125862845 GCTCCCCACATCTCAGACGATGG - Intergenic
1090785543 11:130044417-130044439 GCTCCCCACATCTCAGACGATGG + Intergenic
1090791213 11:130092102-130092124 GCTCCCCACATCTCAGACGATGG + Intronic
1090906936 11:131084526-131084548 GCTCCCCACATCTCAGACGATGG + Intergenic
1091378530 12:41870-41892 GCTCCCCACATCTCAGACGATGG - Intergenic
1091586156 12:1818059-1818081 GCTCCCCACATCTCAGACGATGG - Intronic
1091762368 12:3095716-3095738 GCTCCCCACATCTCAGACGATGG + Intronic
1092185463 12:6475525-6475547 GCTCCCCACATCTCAGACGATGG + Intergenic
1092185540 12:6475837-6475859 GCTCCCCAAATCTCAGACGATGG + Intergenic
1092331533 12:7590565-7590587 GCTCCCCACATCTCAGACGATGG + Intergenic
1092401729 12:8183996-8184018 GCTCCCCACATCTCAGACGACGG - Intronic
1092453501 12:8624935-8624957 GCTCCCCACATCTCAGACGATGG - Intergenic
1092453531 12:8625051-8625073 GCTCCCCACATCTCAGACGATGG - Intergenic
1092590919 12:9952790-9952812 GCTCCCCACATCTCAGACGATGG - Intronic
1092827899 12:12414929-12414951 GCTCCCCACATCTCAGACGATGG + Intronic
1092843788 12:12566024-12566046 GCTCCCCACATCTCAGACGATGG - Intergenic
1093038470 12:14354648-14354670 GCTCCCCACATCTCAGACGATGG - Intergenic
1093065835 12:14657109-14657131 GGTCCCCAAACCCCAGTCCATGG - Intronic
1093927794 12:24926165-24926187 GCTCCCCACATCTCAGACGATGG - Intronic
1094670398 12:32563381-32563403 GCTCCCCACATCTCAGACGATGG + Intronic
1094685620 12:32711277-32711299 GTGCCCCAGAGCTCAGTTTATGG + Intronic
1094717012 12:33023088-33023110 GCTCCCCACATCTCAGACGATGG + Intergenic
1095068874 12:37815299-37815321 GCTCCCCACATCTCAGACGATGG + Intergenic
1095439418 12:42227454-42227476 GCTCCCCACATCTCAGACGATGG - Intronic
1096022411 12:48333484-48333506 GCTCCCCACATCTCAGACGATGG + Intergenic
1096044615 12:48551813-48551835 GCTCCCCACATCTCAGACGAAGG - Intergenic
1096082322 12:48841920-48841942 GCTCCCCACATCTCAGACGATGG - Intronic
1096167621 12:49437249-49437271 GCTCCCCACATCTCAGACGATGG + Intronic
1096224929 12:49860844-49860866 GCTCCCCACATCTCAGACGATGG - Intergenic
1096252213 12:50040586-50040608 GGTGCCCAGAGCCCAGGCAAGGG - Intergenic
1096556966 12:52409647-52409669 GCTCCCCACATCTCAGACGATGG - Intergenic
1097110122 12:56652002-56652024 GCTCCCCACATCTCAGACGATGG + Intergenic
1097127156 12:56784057-56784079 GCTCCCCACATCTCAGACGATGG + Intronic
1097149070 12:56963462-56963484 GCTCCCCACATCTCAGACGATGG - Intergenic
1097230588 12:57508041-57508063 GCTCCCCACATCTCAGACGATGG + Intronic
1097265979 12:57745136-57745158 GGTCCCCAGAGCTGGGGAGATGG + Exonic
1098018909 12:66134537-66134559 GCTCCCCACATCTCAGACGATGG - Intronic
1098370989 12:69759916-69759938 GCTCCCCACATCTCAGACGATGG + Intronic
1098379521 12:69853535-69853557 GCTCCCCACATCTCAGACGACGG + Intronic
1098412562 12:70201743-70201765 GCTCCCCACATCTCAGACGATGG - Intergenic
1099255587 12:80308387-80308409 GCTCCCCACATCTCAGACGATGG + Intronic
1099971283 12:89503614-89503636 GCTCCCCACATCTCAGACGATGG - Intronic
1100507615 12:95235879-95235901 GCTCCCCACATCTCAGACGATGG + Intronic
1100570800 12:95841759-95841781 GCTCCCCACATCTCAGACGATGG + Intergenic
1100577648 12:95907821-95907843 GCTCCCCACATCTCAGACGATGG + Intronic
1100581969 12:95947230-95947252 GCTCCCCACATCTCAGACGATGG - Intronic
1101846655 12:108368299-108368321 GGGCCCCAGAGTTCTGTGGAAGG - Intergenic
1101884003 12:108645948-108645970 GGTGACCAGAGCTCAGTCTCTGG + Exonic
1101885145 12:108655955-108655977 GCTCCCCACATCTCAGACGATGG - Intronic
1102186400 12:110951236-110951258 GCTCCCCACATCTCAGACGATGG + Intergenic
1102268250 12:111507239-111507261 GCTCCCCACATCTCAGACGACGG - Intronic
1102578463 12:113872140-113872162 GCTCCCCACATCTCAGACGATGG - Intronic
1103414120 12:120732642-120732664 GCTCCCCACATCTCAGACGATGG + Intronic
1103456981 12:121075878-121075900 GCTCCCCACATCTCAGACGATGG - Intergenic
1103457001 12:121075954-121075976 GCTCCCCACATCTCAGACGATGG - Intergenic
1103591217 12:121993582-121993604 GCTCCCCACATCTCAGACGATGG - Intronic
1103641647 12:122357213-122357235 GCTCCCCACATCTCAGACGATGG - Intronic
1104104338 12:125644896-125644918 TGTCCCCAGAACTCAGTGAATGG + Intronic
1104399567 12:128464377-128464399 GGTCCCCAGACCTTAGCTGATGG + Intronic
1104479091 12:129091641-129091663 GGTCCTCAGAGCCCAGGTGAGGG - Intronic
1104712911 12:130997584-130997606 GCTCCCCACATCTCAGACGATGG + Intronic
1104861478 12:131926524-131926546 GCTCCCCACATCTCAGACGATGG + Intergenic
1105333166 13:19436940-19436962 GGTCCCTGGATCTCAGTCTAGGG + Intronic
1105367649 13:19778986-19779008 GCTCCCCACATCTCAGACGATGG - Intronic
1105527121 13:21186794-21186816 GCTCCCCACATCTCAGACGATGG + Intergenic
1105555908 13:21447897-21447919 GCTCCCCACATCTCAGACGATGG - Intronic
1105692890 13:22859322-22859344 GCTCCCCACATCTCAGACGATGG + Intergenic
1105806204 13:23953046-23953068 GGTCCCCACAGCGCAGTGGCAGG + Intergenic
1105808449 13:23972801-23972823 GCTCCCCACATCTCAGACGATGG + Intergenic
1105878545 13:24582841-24582863 GGTCCCTGGATCTCAGTCTAGGG - Intergenic
1105921304 13:24966220-24966242 GGTCCCTGGATCTCAGTCTAGGG + Intergenic
1105921812 13:24970568-24970590 GCTCCCCACATCTCAGACGATGG + Intergenic
1105980615 13:25513338-25513360 GCTCCCCACATCTCAGACGATGG + Intronic
1106104719 13:26723762-26723784 GCTCCCCACATCTCAGACGATGG - Intergenic
1106436470 13:29727797-29727819 GGTCCTCAAAGCTCAGTCCTTGG + Intergenic
1106500614 13:30325068-30325090 TGTCCCCAGATCTCAGACCAAGG + Intergenic
1106560254 13:30839986-30840008 GCTCCCCACATCTCAGACGATGG + Intergenic
1106918531 13:34540447-34540469 GCTCCCCACATCTCAGACGATGG - Intergenic
1107165783 13:37280228-37280250 GCTCCCCACATCTCAGACGATGG - Intergenic
1107493063 13:40900364-40900386 GCTCCCCACATCTCAGACGATGG - Intergenic
1107498810 13:40955023-40955045 GCTCCCCACATCTCAGACGATGG - Intronic
1107863559 13:44682779-44682801 GCTCCCCACATCTCAGACGATGG + Intergenic
1107953399 13:45485692-45485714 GCTCCCCACATCTCAGACGATGG + Intronic
1108024359 13:46162759-46162781 GCTCCCCACATCTCAGACGATGG - Intronic
1108330179 13:49377968-49377990 GCTCCCCACATCTCAGACGATGG - Intronic
1108351273 13:49592756-49592778 GCTCCCCACATCTCAGACGATGG - Intergenic
1108370287 13:49761814-49761836 GCTCCCCACATCTCAGACGATGG - Intronic
1108501917 13:51077765-51077787 GCTCCCCACATCTCAGACGATGG - Intergenic
1108608500 13:52063648-52063670 GCTCCCCACATCTCAGACGATGG - Intronic
1108610470 13:52079875-52079897 GCTCCCCACATCTCAGACGATGG - Intronic
1112420506 13:99242891-99242913 GCTCCCCACATCTCAGACGATGG + Intronic
1113329085 13:109311473-109311495 GCTCCCCACATCTCAGACGATGG - Intergenic
1114174744 14:20309958-20309980 GCTCCCCACATCTCAGACGATGG - Intergenic
1114199057 14:20505929-20505951 GCTCCCCACATCTCAGACGATGG - Intronic
1114428181 14:22638938-22638960 GCTCCCCACATCTCAGACGATGG - Intergenic
1114507849 14:23232218-23232240 GCTCCCCACATCTCAGACGATGG - Intronic
1115259498 14:31437554-31437576 GCTCCCCACATCTCAGACGATGG + Intronic
1115493972 14:33984624-33984646 GCTCCCCACATCTCAGACGATGG + Intronic
1115504235 14:34078852-34078874 GCTCCCCACATCTCAGGCGATGG - Intronic
1115609624 14:35038825-35038847 GCTCCCCACATCTCAGACGATGG - Intergenic
1115703787 14:35978016-35978038 GCTCCCCACATCTCAGACGATGG + Intergenic
1116005410 14:39285865-39285887 GCTCCCCACATCTCAGACGATGG + Intronic
1116152186 14:41154680-41154702 GGCCCCCACAGCTCAGTGGCGGG + Intergenic
1116192089 14:41674983-41675005 GCTCCCCACATCTCAGACGATGG + Intronic
1116409078 14:44601352-44601374 GCTCCCCACATCTCAGACGATGG - Intergenic
1116871715 14:50074240-50074262 GCTCCCCACATCTCAGACGATGG - Intergenic
1116959698 14:50956769-50956791 GCTCCCCACATCTCAGACGATGG + Intergenic
1117411756 14:55456652-55456674 GCTCCCCACATCTCAGACGATGG + Intronic
1117448310 14:55826437-55826459 GGTCCCCAGAGTTAGGTCGTTGG + Intergenic
1117763701 14:59059047-59059069 GCTCCCCACATCTCAGACGATGG + Intergenic
1118184120 14:63522559-63522581 GCTCCCCACATCTCAGACGATGG - Intronic
1118239023 14:64038182-64038204 GCTCCCCACATCTCAGACGATGG + Intronic
1118253319 14:64183336-64183358 GCTCCCCACATCTCAGACGATGG + Intronic
1118341295 14:64896064-64896086 GCTCCCCACATCTCAGACGATGG + Intergenic
1118423499 14:65633595-65633617 GCTCCCCACATCTCAGACGATGG - Intronic
1118428663 14:65692887-65692909 GCTCCCCACATCTCAGACGATGG + Intronic
1118517765 14:66546111-66546133 GCTCCCCACATCTCAGACGATGG + Intronic
1118584650 14:67341249-67341271 GCTCCCCACATCTCAGACGATGG - Intronic
1118890309 14:69903193-69903215 GCTCCCCACATCTCAGACGATGG - Intronic
1118955551 14:70477547-70477569 GCTCCCCACATCTCAGACGATGG - Intergenic
1119254632 14:73184986-73185008 GCTCCCCACATCTCAGACGATGG + Intronic
1119595043 14:75925471-75925493 GCTCCCCACATCTCAGGCGATGG + Intronic
1119698662 14:76734859-76734881 GCTCCCCACATCTCAGACGATGG + Intergenic
1119722067 14:76898289-76898311 GCTCCCCACATCTCAGACGATGG + Intergenic
1120505831 14:85352890-85352912 GCTCCCCACATCTCAGACGATGG + Intergenic
1121306842 14:92912073-92912095 GCTCCCCACATCTCAGACGATGG + Intergenic
1121738433 14:96234846-96234868 GGTCCTCACAGCTCAGTCATGGG - Intronic
1121798175 14:96752976-96752998 GGTCCCCAGCCCTCAGGCCATGG + Intergenic
1122238169 14:100344698-100344720 GCTCCCCACATCTCAGACGATGG - Intronic
1122568582 14:102677581-102677603 GCTCCCCACATCTCAGACGATGG + Intronic
1122957800 14:105079431-105079453 GCTCCCCACATCTCAGACGATGG + Intergenic
1122963948 14:105112416-105112438 GCTCCCCACATCTCAGACGATGG + Intergenic
1123429738 15:20204201-20204223 GCTCCCCACATCTCAGACGATGG + Intergenic
1123944122 15:25230765-25230787 GCTCACCACAGCTCAGTCCAGGG - Intergenic
1124132726 15:27004328-27004350 GGTCCCCACATCTCAGACAATGG + Intronic
1124245766 15:28070017-28070039 GCTCCCCACATCTCAGACGATGG - Intronic
1124335117 15:28850022-28850044 GCTCCCCACATCTCAGACGATGG + Intergenic
1125459705 15:39894600-39894622 GCTCCCCACATCTCAGACGATGG + Intronic
1125659081 15:41382212-41382234 GCTCCCCACATCTCAGACGATGG - Intergenic
1125861508 15:43004953-43004975 GCTCCCCACATCTCAGACGATGG - Intronic
1125862759 15:43014497-43014519 GCTCCCCACATCTCAGACGATGG - Intronic
1125868432 15:43076519-43076541 GCTCCCCACATCTCAGACGATGG - Intronic
1125878063 15:43167504-43167526 GCTCCCCACATCTCAGACGATGG + Intronic
1126295329 15:47132365-47132387 GCTCCCCACATCTCAGACGATGG - Intergenic
1126573144 15:50172718-50172740 GCTCCCCACATCTCAGACGATGG - Intronic
1126691822 15:51294288-51294310 GCTCCCCACATCTCAGACGATGG - Intronic
1126799382 15:52286008-52286030 GCTCCCCACATCTCAGACGATGG - Intronic
1127072858 15:55302689-55302711 GCTCCCCACATCTCAGACGATGG - Intronic
1127281347 15:57496331-57496353 GGTCCCCAGCCCTCAGGCCATGG + Intronic
1127584203 15:60366421-60366443 GCTCCCCACATCTCAGACGATGG - Intronic
1127644632 15:60946843-60946865 GCTCCCCACATCTCAGACGATGG - Intronic
1127804186 15:62503629-62503651 GGTCCACAGAGCACAGCCAAGGG - Intronic
1127824387 15:62690390-62690412 GCTCCCCACATCTCAGACGATGG + Intronic
1127874267 15:63098890-63098912 GCTCCCCACATCTCAGACGATGG - Intergenic
1128071403 15:64799425-64799447 GCTCCCCACATCTCAGACGATGG + Intergenic
1128490279 15:68135942-68135964 GCTCCCCACATCTCAGGCGATGG + Intronic
1128587223 15:68860514-68860536 GCTCCCCACATCTCAGACGATGG + Intronic
1128597514 15:68964895-68964917 GCTCCCCACATCTCAGACGATGG + Intronic
1128843761 15:70871816-70871838 GCTCCCCACATCTCAGACGATGG + Intronic
1129008700 15:72396470-72396492 GCTCCCCACATCTCAGACGATGG - Intergenic
1129313727 15:74728847-74728869 GCTCCCCACATCTCAGACGATGG - Intergenic
1129428347 15:75481086-75481108 GCTCCCCACATCTCAGACGATGG - Intronic
1129431180 15:75503251-75503273 GCTCCCCACATCTCAGACGATGG - Intronic
1129438202 15:75559104-75559126 GCTCCCCACATCTCAGACGATGG - Intronic
1129586909 15:76876254-76876276 GGCCCCCACAGCTCAGTGGCGGG + Intronic
1129680534 15:77656232-77656254 TTTCCCCAAAGCTCAGTCCAGGG - Intronic
1129718896 15:77866979-77867001 TGTCCCCAGAGCTGTGTGGAGGG + Intergenic
1130428409 15:83822575-83822597 GCTCCCCACATCTCAGACGATGG + Intronic
1130942650 15:88524054-88524076 GCTCCCCACATCTCAGACGATGG - Intronic
1130946775 15:88553859-88553881 GCTCCCCACATCTCAGACGATGG + Intergenic
1130971368 15:88736323-88736345 GATCCCCTGAGCTCAGTGGGAGG - Intergenic
1131001462 15:88942091-88942113 GCTCCCCACATCTCAGACGATGG + Intergenic
1131043931 15:89297217-89297239 GCTCCCCACATCTCAGGCGATGG + Intronic
1131125160 15:89853724-89853746 GCTCCCCACATCTCAGACGATGG - Intronic
1131127123 15:89867627-89867649 GCTCCCCACATCTCAGACGATGG - Intronic
1131479415 15:92768700-92768722 GCTCCCCACATCTCAGACGATGG + Intronic
1132037011 15:98493187-98493209 GCTCCCCACATCTCAGACGATGG + Intronic
1132300805 15:100774376-100774398 GCTCCCCACATCTCAGACGATGG + Intergenic
1132776687 16:1599029-1599051 GCTCCCCACATCTCAGACGATGG - Intronic
1132992294 16:2802262-2802284 GCTCCCCACATCTCAGACGATGG + Intergenic
1133210399 16:4260418-4260440 GGTCCCCAGAGCCCACTCCCGGG + Intronic
1133365091 16:5203171-5203193 GCTCCCCACATCTCAGACGATGG + Intergenic
1134854331 16:17506150-17506172 GCTCCCCACATCTCAGACGATGG + Intergenic
1135575576 16:23583352-23583374 GCTCCCCACATCTCAGACGATGG - Intronic
1135575604 16:23583468-23583490 GCTCCCCACATCTCAGACGATGG - Intronic
1135639741 16:24109487-24109509 GCTCCCCACATCTCAGACGATGG + Intronic
1135667831 16:24350976-24350998 GAACCCCAGAGCTCACTCGCTGG + Intronic
1135694463 16:24574715-24574737 GGTCCCCACATCTCAGACGATGG + Intergenic
1135694574 16:24575183-24575205 GCTCCCCACATCTCAGACGATGG + Intergenic
1136160510 16:28416461-28416483 GCTCCCCACATCTCAGACGATGG - Intergenic
1136202585 16:28698853-28698875 GCTCCCCACATCTCAGACGATGG + Intronic
1136572087 16:31104248-31104270 GCTCCCCACATCTCAGACGATGG - Intergenic
1136583556 16:31169417-31169439 GCTCCCCACATCTCAGACGATGG - Intergenic
1136593515 16:31232181-31232203 GCTCCCCACATCTCAGACGATGG - Intergenic
1136919094 16:34246286-34246308 GCTCCCCACATCTCAGACGATGG + Intergenic
1137240842 16:46653544-46653566 GCTCCCCACATCTCAGACGATGG + Intergenic
1137303872 16:47181114-47181136 GCTCCCCACATCTCAGACGATGG - Intronic
1137430837 16:48416924-48416946 GCTCCCCACATCTCAGACGACGG + Intronic
1138028184 16:53539192-53539214 GCTCCCCACATCTCAGACGATGG - Intergenic
1138043350 16:53697977-53697999 GCTCCCCACATCTCAGACGATGG - Intronic
1138699378 16:58846466-58846488 GCTCCCCACATCTCAGACGATGG + Intergenic
1139394705 16:66630873-66630895 GCTCCCCACATCTCAGACGATGG - Intronic
1139556293 16:67712899-67712921 GCTCCCCACATCTCAGACGATGG - Intronic
1139623261 16:68163782-68163804 GCTCCCCACATCTCAGACGATGG + Intronic
1139885393 16:70204477-70204499 GCTCCCCACATCTCAGACGATGG - Intergenic
1140063250 16:71589414-71589436 GCTCCCCACATCTCAGACGATGG - Intergenic
1140390584 16:74583138-74583160 TGTCCCCAGGGCTCAGTCCTTGG + Intronic
1140444346 16:75012897-75012919 GGTCTCCAGAGCTCAATAAAGGG + Intronic
1140994043 16:80243150-80243172 GCTCCCCACATCTCAGACGATGG - Intergenic
1141891387 16:86928960-86928982 GGTCTCCAAAGGTCAGTGGAAGG - Intergenic
1142103286 16:88286876-88286898 GTTCCCCAGAGCTCAGTATCTGG - Intergenic
1142332287 16:89462684-89462706 GCTCCCCACATCTCAGACGATGG - Intronic
1142529830 17:572158-572180 GCTCCCCACATCTCAGACGATGG - Intronic
1142818519 17:2447196-2447218 GCTCCCCACATCTCAGACGATGG - Intronic
1142939935 17:3372204-3372226 GCTCCCCACATCTCAGACGATGG + Intergenic
1142949172 17:3464595-3464617 GCTCCCCACATCTCAGACGATGG - Intronic
1142963262 17:3564508-3564530 GCTCCCCACATCTCAGACGATGG + Intergenic
1143008795 17:3854265-3854287 GCTCCCCACATCTCAGACGATGG - Intergenic
1143342735 17:6226203-6226225 GCTCCCCACATCTCAGACGATGG - Intergenic
1143538734 17:7557392-7557414 GGTGCCCAGAGAGCTGTCGAGGG - Exonic
1143667666 17:8373747-8373769 GCTCCCCACATCTCAGACGATGG - Intronic
1143884756 17:10057369-10057391 GCTCCCCACATCTCAGACGATGG - Intronic
1144509973 17:15867360-15867382 GCTCCCCACATCTCAGACGATGG - Intergenic
1144536334 17:16095180-16095202 GCTCCCCACATCTCAGACGATGG - Intronic
1144559833 17:16312341-16312363 GCTCCCCACATCTCAGACGATGG + Intronic
1144799024 17:17912566-17912588 GCTCCCCACATCTCAGACGATGG + Intronic
1144860374 17:18298038-18298060 GCTCCCCACATCTCAGACGATGG - Intronic
1145027039 17:19475934-19475956 GCTCCCCACATCTCAGACGATGG - Intergenic
1145047333 17:19628276-19628298 GCTCCCCACATCTCAGACGATGG + Intergenic
1145087003 17:19950884-19950906 GGTCCCCACATCTCAGACGATGG - Intronic
1145205741 17:20984295-20984317 GCTCCCCACATCTCAGACGATGG - Intergenic
1145418078 17:22741125-22741147 GCTCCCCACATCTCAGACGATGG - Intergenic
1145684199 17:26638156-26638178 GCTCCCCACATCTCAGACGATGG - Intergenic
1145717145 17:27033728-27033750 GCTCCCCACATCTCAGACGATGG - Intergenic
1145733607 17:27212003-27212025 GCTCCCCACATCTCAGACGATGG - Intergenic
1145896096 17:28458798-28458820 GCTCCCCACATCTCAGACGATGG - Intronic
1145920297 17:28604635-28604657 GCTCCCCACATCTCAGACGATGG + Intronic
1146048910 17:29533221-29533243 GCTCCCCACATCTCAGACGATGG + Intronic
1146155823 17:30523271-30523293 GCTCCCCACATCTCAGACGATGG - Exonic
1146188512 17:30744617-30744639 GATCCCAAGAGCTCTGTCTAGGG - Intergenic
1146216469 17:30980743-30980765 GCTCCCCACATCTCAGACGATGG + Intronic
1146333385 17:31948930-31948952 GATCCCAAGAGCTCTGTCTAGGG - Intronic
1146444558 17:32923244-32923266 GCTCCCCACATCTCAGACGATGG + Intergenic
1146731328 17:35195394-35195416 GCTCCCCACATCTCAGACGATGG + Intergenic
1147024113 17:37565659-37565681 GCTCCCCACATCTCAGACGATGG - Intronic
1147172550 17:38630766-38630788 GCTCCCCACATCTCAGACGATGG - Intergenic
1147221152 17:38931096-38931118 GCTCCCCACATCTCAGACGATGG + Intergenic
1147278365 17:39337521-39337543 GCTCCCCACATCTCAGACGATGG - Intronic
1147612734 17:41811383-41811405 GCTCCCCACAGATCGGTCGAAGG - Intronic
1147709008 17:42449108-42449130 GCTCCCCACATCTCAGACGATGG - Intergenic
1147785021 17:42972937-42972959 GCTCCCCACATCTCAGACGATGG - Intronic
1147852012 17:43450925-43450947 GCTCCCCACATCTCAGACGATGG - Intergenic
1147963258 17:44180297-44180319 GCTCCCCACATCTCAGACGATGG - Intergenic
1148269642 17:46253208-46253230 GCTCCCCACATCTCAGACGATGG + Intergenic
1148348683 17:46922856-46922878 GGTCCTCAGAGCAAAGTTGAAGG - Intergenic
1148386578 17:47238581-47238603 AGTCCCCAGAGCCCAGCCCAGGG - Intergenic
1148406419 17:47420562-47420584 GCTCCCCACATCTCAGACGATGG - Intronic
1149632975 17:58142404-58142426 GCTCCCCACATCTCAGACGATGG - Intergenic
1149780671 17:59394393-59394415 GCTCCCCACATCTCAGACGATGG + Intronic
1149793621 17:59500222-59500244 GCTCCCCACATCTCAGACGATGG - Intergenic
1149908802 17:60551129-60551151 GCTCCCCACATCTCAGACGATGG - Intergenic
1149951853 17:60996757-60996779 GGGCCCCAGGGCTCAGTCCTGGG - Intronic
1150213859 17:63456391-63456413 GCTCCCCACATCTCAGACGATGG - Intergenic
1150380569 17:64716522-64716544 GCTCCCCACATCTCAGACGATGG - Intergenic
1150477195 17:65484398-65484420 GCTCCCCACATCTCAGACGATGG - Intergenic
1150518258 17:65837378-65837400 GCTCCCCACATCTCAGACGATGG - Intronic
1150527289 17:65937392-65937414 GCTCCCCACATCTCAGACGATGG - Intronic
1150780328 17:68116440-68116462 GCTCCCCACATCTCAGACGATGG + Intergenic
1150894674 17:69196433-69196455 GCTCCCCACATCTCAGACGATGG + Intronic
1152020056 17:77776239-77776261 GCTCCCCACATCTCAGACGATGG - Intergenic
1152129102 17:78465545-78465567 GCTCCCCACATCTCAGACGATGG - Intronic
1152246224 17:79186018-79186040 GGACCCCTGAGCTCAGTCATTGG + Intronic
1152672655 17:81618272-81618294 GCTCCCCACATCTCAGACGATGG - Intronic
1152696260 17:81798244-81798266 GCTCCCCACATCTCAGACGATGG + Intergenic
1153066725 18:1053730-1053752 CTTCCCCAGAGCTCAGCCCATGG - Intergenic
1153221778 18:2868219-2868241 GCTCCCCACATCTCAGACGATGG + Intronic
1153998080 18:10459243-10459265 GAGCCCCAGAGCTGAGTGGATGG + Intronic
1154158143 18:11959743-11959765 GCTCCCCACATCTCAGACGATGG - Intergenic
1154289993 18:13098560-13098582 GCTCCCCACATCTCAGACGATGG + Intronic
1154440274 18:14383047-14383069 GCTCCCCACATCTCAGACGATGG + Intergenic
1154990331 18:21592971-21592993 GCTCCCCACATCTCAGACGATGG + Intronic
1155552247 18:26976833-26976855 GGTCCTCAGAGTTTAGTAGAAGG + Intronic
1156326387 18:36078031-36078053 GCTCCCCACATCTCAGACGATGG + Intergenic
1157455849 18:47828015-47828037 GCTCCCCACATCTCAGACGATGG - Exonic
1157546109 18:48547593-48547615 GGTGGCCAGAGCTCAGTACAAGG - Intronic
1157629524 18:49080884-49080906 GCTCCCCACATCTCAGACGATGG + Intronic
1157677485 18:49578403-49578425 GCTCCCCACATCTCAGACGATGG + Intronic
1158148514 18:54343076-54343098 GCTCCCCACATCTCAGACGATGG - Intronic
1158459392 18:57633292-57633314 GCTCCCCACATCTCAGACGATGG + Intergenic
1159340489 18:67127057-67127079 GCTCCCCACATCTCAGACGATGG + Intergenic
1160912476 19:1481337-1481359 GGTCCCCGGACATCAGTCCATGG - Intergenic
1162163825 19:8739353-8739375 GCTCCCCACATCTCAGACGATGG - Intergenic
1162278931 19:9679956-9679978 GCTCCCCACATCTCAGACGATGG - Intergenic
1162602143 19:11677182-11677204 GCTCCCCACATCTCAGACGATGG + Intergenic
1162683195 19:12362295-12362317 GCTCCCCACATCTCAGACGATGG - Intronic
1162886763 19:13703055-13703077 GCTCCCCACATCTCAGACGATGG - Intergenic
1163542187 19:17918213-17918235 GCTCCCCACATCTCAGACGATGG - Intergenic
1163558553 19:18006007-18006029 GCTCCCCACATCTCAGACGATGG + Intronic
1163906016 19:20150429-20150451 GCTCCCCACATCTCAGACGATGG + Intergenic
1163913080 19:20214512-20214534 GCTCCCCACATCTCAGACGATGG - Intergenic
1163945552 19:20530648-20530670 GCTCCCCACATCTCAGACGATGG + Intergenic
1164012185 19:21212861-21212883 GCTCCCCACATCTCAGACGATGG + Intergenic
1164034824 19:21443860-21443882 GCTCCCCACATCTCAGACGATGG + Intronic
1164043234 19:21511457-21511479 GCTCCCCACATCTCAGACGATGG + Intronic
1164047056 19:21551666-21551688 GCTCCCCACATCTCAGACGATGG + Intronic
1164054136 19:21607394-21607416 GCTCCCCACATCTCAGACGATGG + Intergenic
1164054991 19:21614866-21614888 GCTCCCCACATCTCAGACGATGG - Intergenic
1164066396 19:21720961-21720983 GCTCCCCACATCTCAGACGATGG - Intergenic
1164071794 19:21775811-21775833 GCTCCCCACATCTCAGACGATGG - Intergenic
1164081868 19:21866248-21866270 GCTCCCCACATCTCAGACGATGG + Intergenic
1164106151 19:22108104-22108126 GCTCCCCACATCTCAGACGATGG + Intergenic
1164126288 19:22321816-22321838 GCTCCCCATATCTCAGACGATGG + Intergenic
1164186242 19:22871819-22871841 GCTCCCCACATCTCAGACGATGG + Intergenic
1164191980 19:22925801-22925823 GCTCCCCACATCTCAGACGATGG - Intergenic
1164218613 19:23173140-23173162 GCTCCCCACATCTCAGACGATGG - Intergenic
1164263881 19:23594734-23594756 GCTCCCCACATCTCAGACGATGG - Intronic
1164298543 19:23937525-23937547 GCTCCCCACATCTCAGACGATGG + Intronic
1164301107 19:23963979-23964001 GCTCCCCACATCTCAGACGATGG - Intergenic
1164653267 19:29901422-29901444 GCTCCCCACATCTCAGACGATGG + Intergenic
1164659355 19:29949330-29949352 GCTCCCCACATCTCAGACGATGG + Intronic
1165064397 19:33220534-33220556 GGTGCCCAGGGCTCAGTCCTGGG + Intronic
1165193132 19:34079973-34079995 GCTCCCCACATCTCAGACGATGG + Intergenic
1165199340 19:34132483-34132505 GCTCCCCACATCTCAGACGATGG - Intergenic
1165295452 19:34922353-34922375 GCTCCCCACATCTCAGACGATGG + Intergenic
1165727756 19:38124382-38124404 GCTCCCCACATCTCAGACGATGG + Intronic
1165842693 19:38798196-38798218 GCTCCCCACATCTCAGACGATGG + Intergenic
1165953869 19:39489628-39489650 GGTCCCCAGGCCTCAGCCCAGGG - Intronic
1166029722 19:40117795-40117817 GCTCCCCACATCTCAGACGATGG - Intergenic
1166163144 19:40966804-40966826 GCTCCCCACATCTCAGACGATGG + Intergenic
1166191565 19:41180127-41180149 GCTCCCCACATCTCAGACGATGG - Intergenic
1166421526 19:42639982-42640004 GCTCCCCACATCTCAGACGATGG + Intronic
1166832676 19:45648052-45648074 GCTCCCCACATCTCAGACGATGG - Intergenic
1167038762 19:47009734-47009756 GCTCCCCACATCTCAGACGATGG - Intergenic
1167239439 19:48334343-48334365 GGTCCCCAGAGCTCAGTCGAGGG + Intronic
1167588035 19:50385951-50385973 GCTCCCCAGTGCTCAGCAGAGGG - Intronic
1167897564 19:52593778-52593800 GCTCCCCACATCTCAGACGATGG + Intergenic
1167924467 19:52811507-52811529 GCTCCCCACATCTCAGACGATGG - Intronic
1167937398 19:52919734-52919756 GCTCCCCACATCTCAGACGATGG - Intergenic
1167971096 19:53187963-53187985 GCTCCCCACATCTCAGACGATGG + Intronic
1167975452 19:53222805-53222827 GCTCCCCACATCTCAGACGATGG - Intergenic
1168109457 19:54183834-54183856 GTTCCCCAGGGCTCAGTCCCAGG + Intronic
1168258055 19:55178037-55178059 GGTCCCCAGAGTCCAGTTGAGGG + Intronic
1168572581 19:57483194-57483216 GCTCCCCACATCTCAGACGATGG - Intergenic
1168658250 19:58147126-58147148 GCTCCCCACATCTCAGACGATGG - Intronic
1168696277 19:58405726-58405748 GCTCCCCACATCTCAGACGATGG + Intronic
1202679035 1_KI270711v1_random:34785-34807 AGTCCCCAGAGCTCTGTCACAGG - Intergenic
925216859 2:2103900-2103922 TTTCTCCACAGCTCAGTCGAAGG + Intronic
925400534 2:3569375-3569397 GCTCCCCACATCTCAGACGATGG + Intergenic
925403672 2:3591626-3591648 GCTCCCCACATCTCAGACGATGG + Intergenic
925407628 2:3616179-3616201 GCTCCCCACATCTCAGACGATGG + Intronic
925470334 2:4154274-4154296 GGTGCCCACAGCTCAGAAGAAGG - Intergenic
925811750 2:7708123-7708145 GGACCCCAGAGTTCAGCTGAGGG - Intergenic
926215551 2:10903132-10903154 GCTCCCCACATCTCAGACGATGG + Intergenic
926252786 2:11165323-11165345 GCTCCCCACATCTCAGACGATGG + Intronic
926252825 2:11165476-11165498 GCTCCCCACATCTCAGACGATGG + Intronic
926322710 2:11760100-11760122 GCTCCCCACATCTCAGACGATGG + Intronic
926423384 2:12719068-12719090 GGGCCCCTGGGCTCAGCCGAAGG - Intronic
926469388 2:13234999-13235021 TGTCCTCAGAGCTCAGTCAAGGG + Intergenic
926683383 2:15680416-15680438 GCTCCCCACATCTCAGACGATGG + Intergenic
927757887 2:25723543-25723565 GCTCCCCACATCTCAGACGATGG + Intergenic
927978685 2:27359370-27359392 GCTCCCCACATCTCAGACGATGG - Intergenic
928003272 2:27540769-27540791 GCTCCCCACATCTCAGACGATGG + Intronic
928005485 2:27558284-27558306 GCTCCCCACATCTCAGACGATGG + Intronic
928542235 2:32294447-32294469 GCTCCCCACATCTCAGACGATGG + Intronic
928596853 2:32868402-32868424 GCTCCCCACATCTCAGACGATGG - Intergenic
928687218 2:33761607-33761629 GCTCCCCACATCTCAGACGATGG + Intergenic
928888777 2:36179932-36179954 GCTCCCCACATCTCAGACGATGG - Intergenic
929151968 2:38756139-38756161 GCTCCCCACATCTCAGACGATGG + Intronic
929415954 2:41746693-41746715 GCTCCCCACATCTCAGACGATGG - Intergenic
929445159 2:41995507-41995529 GCTCCCCACATCTCAGACGATGG - Intergenic
929517951 2:42621837-42621859 GCTCCCCACATCTCAGACGATGG + Intronic
929577813 2:43063395-43063417 GCTCCCCACATCTCAGACGATGG + Intergenic
929614446 2:43297154-43297176 GCTCCCCACATCTCAGACGATGG - Intronic
929739476 2:44588053-44588075 GCTCCCCACATCTCAGACGATGG - Intronic
930079429 2:47433946-47433968 GCTCCCCACATCTCAGACGATGG + Intronic
930202347 2:48557355-48557377 GCTCCCCACATCTCAGACGATGG + Intronic
930208867 2:48614853-48614875 GCTCCCCACATCTCAGACGATGG + Intronic
930665629 2:54096253-54096275 GCTCCCCACATCTCAGACGATGG + Intronic
930703913 2:54485806-54485828 GCTCCCCACATCTCAGACGACGG - Intronic
930727835 2:54698972-54698994 GCTCCCCACATCTCAGACGATGG - Intergenic
930821373 2:55650642-55650664 GCTCCCCACATCTCAGACGATGG - Intronic
930834001 2:55774122-55774144 GCTCCCCACATCTCAGACGATGG + Intergenic
931479890 2:62630271-62630293 ACTCCCCACAGCTCAGACGATGG - Intergenic
931576366 2:63722344-63722366 GCTCCCCACATCTCAGACGATGG - Intronic
931656356 2:64512600-64512622 GCTCCCCACATCTCAGACGATGG + Intergenic
931752042 2:65338913-65338935 GCTCCCCACATCTCAGACGATGG - Intronic
931783773 2:65601262-65601284 GCTCCCCACATCTCAGACGATGG + Intergenic
932718889 2:74123834-74123856 GCTCCCCACATCTCAGACGATGG - Intergenic
932807579 2:74796410-74796432 GCTCCCCACATCTCAGACGATGG + Intergenic
932903440 2:75725194-75725216 GCTCCCCACATCTCAGACGATGG - Intergenic
933734918 2:85487639-85487661 GCTCCCCACATCTCAGACGATGG - Intergenic
934549043 2:95243465-95243487 GCTCCCCACATCTCAGACGATGG - Intronic
934703404 2:96461407-96461429 GCTCCCCACATCTCAGACGATGG - Intergenic
935630865 2:105211297-105211319 GCTCCCCACATCTCAGACGATGG + Intergenic
935636138 2:105251113-105251135 GCTCCCCACATCTCAGACGATGG - Intergenic
935636196 2:105251342-105251364 GCTCCCCACATCTCAGACGATGG - Intergenic
936158240 2:110064063-110064085 GCTCCCCACATCTCAGACGACGG + Intergenic
936186451 2:110307379-110307401 GCTCCCCACATCTCAGACGACGG - Intergenic
936345613 2:111672765-111672787 GCTCCCCACATCTCAGACGACGG - Intergenic
936546058 2:113394096-113394118 GCTCCCCACATCTCAGACGATGG - Intergenic
937283018 2:120733352-120733374 GTGTCCCAGCGCTCAGTCGAAGG + Intergenic
937437556 2:121892680-121892702 GCTCCCCACATCTCAGACGATGG - Intergenic
937734927 2:125277320-125277342 GCTCCCCACATCTCAGACGATGG + Intergenic
937919619 2:127120219-127120241 GCTCCCCACATCTCAGACGATGG + Intergenic
938006218 2:127789081-127789103 GCTCCCCACATCTCAGACGATGG + Intronic
938821995 2:134968730-134968752 GGTCCCCACATCTCAGACGATGG + Intronic
938829144 2:135034148-135034170 GCTCCCCACATCTCAGGCGATGG + Intronic
938836178 2:135105807-135105829 GCTCCCCACATCTCAGACGATGG - Intronic
940299106 2:152160344-152160366 GCTCCCCACATCTCAGACGATGG - Intronic
940635547 2:156293477-156293499 GCTCCCCACATCTCAGACGATGG - Intergenic
940643217 2:156368176-156368198 GCTCCCCACATCTCAGACGATGG - Intergenic
940652461 2:156451974-156451996 GCTCCCCACATCTCAGACGATGG + Intronic
941024036 2:160439435-160439457 GCTCCCCACATCTCAGACGATGG + Intronic
941025063 2:160448869-160448891 GCTCCCCACATCTCAGACGATGG - Intronic
941197535 2:162470282-162470304 GCTCCCCACATCTCAGACGATGG - Intronic
941603223 2:167564243-167564265 GCTCCCCACATCTCAGACGATGG + Intergenic
941768687 2:169326831-169326853 GCTCCCCACATCTCAGACGATGG - Intronic
941786586 2:169505570-169505592 GCTCCCCACATCTCAGACGATGG - Exonic
941793399 2:169575626-169575648 GCTCCCCACATCTCAGACGATGG + Intergenic
941814854 2:169786752-169786774 GCTCCCCACATCTCAGACGATGG + Intergenic
942012155 2:171774645-171774667 GCTCCCCACATCTCAGACGATGG - Intergenic
942021073 2:171867053-171867075 GCTCCCCACATCTCAGACGATGG + Intronic
942024659 2:171899854-171899876 GCTCCCCACATCTCAGACGACGG - Intronic
942621076 2:177845411-177845433 GCTCCCCACATCTCAGACGATGG + Intronic
943005730 2:182386420-182386442 GCTCCCCACATCTCAGACGATGG - Intronic
943297234 2:186154391-186154413 GCTCCCCACATCTCAGACGATGG + Intergenic
943411680 2:187556515-187556537 GCTCCCCACATCTCAGACGATGG - Intronic
943443230 2:187951633-187951655 GGCCCCCACAGCTCAGTGGCGGG - Intergenic
943578027 2:189653589-189653611 GCTCCCCACATCTCAGACGATGG - Intergenic
943648371 2:190431125-190431147 GCTCCCCACATCTCAGACGATGG + Intronic
943773343 2:191741833-191741855 GCTCCCCACATCTCAGACGATGG - Intergenic
944060660 2:195567798-195567820 GCTCCCCACATCTCAGACGATGG - Intergenic
944136993 2:196410840-196410862 AGTCCACAGAGCACAGTAGAAGG + Intronic
944255289 2:197618701-197618723 GCTCCCCACATCTCAGACGATGG - Intronic
944263186 2:197696791-197696813 GCTCCCCACATCTCAGACGATGG + Intronic
944283603 2:197923538-197923560 GCTCCCCACATCTCAGACGATGG + Intronic
944585187 2:201166500-201166522 GCTCCCCACATCTCAGACGATGG + Exonic
944598920 2:201284059-201284081 GCTCCCCACATCTCAGACGATGG + Intronic
944722714 2:202440387-202440409 GCTCCCCACATCTCAGACGATGG + Intronic
944733103 2:202535465-202535487 GCTCCCCACATCTCAGACGATGG + Intronic
944751629 2:202715502-202715524 GCTCCCCACATCTCAGACGATGG + Intronic
944815633 2:203372883-203372905 GCTCCCCACATCTCAGGCGATGG + Intronic
945110699 2:206357179-206357201 GCTCCCCACATCTCAGACGATGG + Intergenic
945115210 2:206401648-206401670 GCTCCCCACATCTCAGACGATGG + Intergenic
945232908 2:207610410-207610432 GCTCCCCACATCTCAGACGATGG - Exonic
945530765 2:210950716-210950738 GCTCCCCACATCTCAGACGATGG - Intergenic
945835861 2:214835737-214835759 GCTCCCCACATCTCAGACGATGG + Intergenic
945864877 2:215163680-215163702 GCTCCCCACATCTCAGACGATGG + Intergenic
945970486 2:216226938-216226960 GCTCCCCACATCTCAGACGATGG + Intergenic
946318096 2:218931414-218931436 GCTCCCCACATCTCAGACGATGG - Intergenic
946650914 2:221892074-221892096 GCTCCCCACATCTCAGACGATGG - Intergenic
947402294 2:229742754-229742776 GCTCCCCACATCTCAGACGATGG - Intergenic
947797766 2:232905717-232905739 GCTCCCCACATCTCAGACGATGG - Intronic
947901438 2:233724579-233724601 GCTCCCCACATCTCAGACGATGG + Intronic
1169085617 20:2823682-2823704 GCTCCCCACATCTCAGACGATGG - Intergenic
1169108907 20:3019494-3019516 GCTCCCCACATCTCAGACGATGG + Intronic
1169168192 20:3441559-3441581 GCTCCCCACATCTCAGACGATGG + Intergenic
1169246855 20:4032502-4032524 GCTCCCCACATCTCAGACGATGG - Intergenic
1169441840 20:5639538-5639560 GCTCCCCACATCTCAGACGATGG + Intergenic
1169718243 20:8644410-8644432 GCTCCCCACATCTCAGACGATGG - Intronic
1169885666 20:10395199-10395221 GCTCCCCACATCTCAGACGATGG + Intergenic
1170202475 20:13760370-13760392 GCTCCCCACATCTCAGACGATGG - Intronic
1170425099 20:16228129-16228151 GCTCCCCACATCTCAGACGATGG + Intergenic
1170623187 20:18010895-18010917 GCTCCCCACATCTCAGACGATGG + Intronic
1170811674 20:19678923-19678945 GCTCCCCACATCTCAGACGATGG + Intronic
1171366174 20:24626456-24626478 GCTCCCCACATCTCAGACGATGG + Intronic
1171463619 20:25312754-25312776 GCTCCCCACATCTCAGACGATGG - Intronic
1171496786 20:25561648-25561670 GCTCCCCACATCTCAGACGATGG - Intronic
1171848527 20:30292032-30292054 GCTCCCCATATCTCAGACGATGG + Intergenic
1171899946 20:30847359-30847381 GCTCCCCACATCTCAGACGATGG + Intergenic
1171951590 20:31426915-31426937 GCTCCCCACATCTCAGACGATGG - Intergenic
1171957538 20:31471783-31471805 GCTCCCCACATCTCAGACGATGG + Intronic
1172059007 20:32175947-32175969 GCTCCCCACATCTCAGACGATGG - Intergenic
1172141136 20:32723749-32723771 GCTCCCCACATCTCAGACGATGG - Intronic
1172199574 20:33115577-33115599 GCTCCCCACATCTCAGACGATGG - Intergenic
1172209256 20:33185575-33185597 GCTCCCCACATCTCAGACGATGG + Intergenic
1172249555 20:33469310-33469332 GATCCCAAGAGTTCAGTAGAGGG + Intergenic
1172258126 20:33536748-33536770 GCTCCCCACATCTCAGGCGATGG + Intronic
1172279907 20:33701344-33701366 GCTCCCCACAGCTCAGACGATGG - Intergenic
1172337853 20:34132420-34132442 GCTCCCCACATCTCAGACGATGG - Intergenic
1172348505 20:34223243-34223265 GCTCCCCACATCTCAGACGATGG - Intronic
1172349988 20:34231056-34231078 GCTCCCCACATCTCAGACGATGG + Intronic
1172465504 20:35153478-35153500 GCTCCCCACATCTCAGACGATGG - Intergenic
1172575085 20:36001777-36001799 GCTCCCCACATCTCAGACGATGG + Intronic
1172722743 20:37012479-37012501 GCTCCCCACATCTCAGACGATGG - Intronic
1172728846 20:37069453-37069475 GCTCCCCACATCTCAGACGATGG - Intronic
1172735785 20:37125835-37125857 GCTCCCCACATCTCAGACGATGG - Intronic
1172907190 20:38378745-38378767 GCTCCCCACATCTCAGACGATGG - Intergenic
1172918614 20:38461921-38461943 GCTCCCCACATCTCAGACGATGG + Intergenic
1173273219 20:41555672-41555694 GCTCCCCACATCTCAGACGATGG + Intronic
1173508485 20:43607550-43607572 GCTCCCCACATCTCAGACGATGG + Intronic
1174020693 20:47526141-47526163 GCTCCCCACATCTCAGACGATGG + Intronic
1174344819 20:49922065-49922087 GCTCCCCACATCTCAGACGATGG - Intergenic
1174835788 20:53854385-53854407 GCTCCCCACATCTCAGACGATGG - Intergenic
1175361489 20:58414605-58414627 GCTCCCCACATCTCAGACGATGG + Intronic
1176000068 20:62827689-62827711 GGCTGCCAGGGCTCAGTCGAGGG - Intronic
1176171040 20:63696509-63696531 CCTCCCCAGAGCTCAGTCCAAGG - Intronic
1177134234 21:17292473-17292495 GCTCCCCACATCTCAGACGATGG + Intergenic
1177669713 21:24209109-24209131 GGGCCCCACAGCTCAGTGGCGGG + Intergenic
1178034356 21:28563865-28563887 GCTCCCCACATCTCAGACGATGG - Intergenic
1178075477 21:29011283-29011305 GCTCCCCACATCTCAGACGATGG - Intronic
1178873190 21:36392748-36392770 GCTCCCCACATCTCAGACGATGG + Intronic
1178958083 21:37041471-37041493 GGTCCCCAGGGCTCTGTGGGTGG + Intergenic
1180039447 21:45268598-45268620 GCTCCCCACATCTCAGACGATGG - Intronic
1180672063 22:17561194-17561216 GCTCCCCACATCTCAGACGATGG - Intergenic
1180830077 22:18900614-18900636 GCTCCCCACATCTCAGACGATGG + Intergenic
1181301576 22:21884161-21884183 GCTCCCCACATCTCAGACGATGG + Intergenic
1181586071 22:23854428-23854450 GCTCCCCACATCTCAGACGATGG - Intergenic
1181617603 22:24065425-24065447 GCTCCCCACATCTCAGACGATGG + Intronic
1181792355 22:25278005-25278027 GCTCCCCACATCTCAGACGATGG + Intergenic
1181982301 22:26773762-26773784 GCTCCCCACATCTCAGACGATGG + Intergenic
1182199329 22:28553401-28553423 GCTCCCCACATCTCAGACGATGG - Intronic
1182377432 22:29858351-29858373 GCTCCCCACATCTCAGACGATGG + Intergenic
1182484593 22:30631871-30631893 GCTCCCCACATCTCAGACGATGG + Intergenic
1182616886 22:31593376-31593398 GCTCCCCACATCTCAGACGATGG + Intronic
1182976349 22:34626355-34626377 GCTCCCCACATCTCAGACGATGG + Intergenic
1183073395 22:35411674-35411696 CTTCCCCAGGGCTCAGTCCATGG + Intronic
1183167515 22:36159087-36159109 GCTCCTCAGAGCTCAGATGACGG - Intronic
1183185743 22:36290762-36290784 GCTCCCCACATCTCAGACGATGG - Intronic
1183466379 22:37982444-37982466 GAACCCCAGACCTGAGTCGAGGG + Intronic
1183549594 22:38474123-38474145 AGTCCCCAAAGCTCAGTCTTAGG - Intronic
1183595172 22:38806910-38806932 GCTCCCCACATCTCAGACGATGG - Intergenic
1183841567 22:40502441-40502463 GCTCCCCACATCTCAGACGATGG + Intronic
1183845179 22:40536719-40536741 GCTCCCCACATCTCAGACGATGG - Intronic
1183871768 22:40745778-40745800 GCTCCCCACATCTCAGACGATGG + Intergenic
1183940903 22:41294667-41294689 GCTCCCCACATCTCAGACGATGG - Intergenic
1183995787 22:41631548-41631570 GCTCCCCACATCTCAGACGATGG + Intronic
1184202577 22:42981099-42981121 GCTCCCCACATCTCAGACGATGG - Intronic
1185106417 22:48872289-48872311 GATACCCAGAGCTCAGTCCTGGG + Intergenic
1185340163 22:50287539-50287561 GGTGCCCAGAGCCCAGGCGGGGG + Intronic
1203280167 22_KI270734v1_random:125885-125907 GCTCCCCACATCTCAGACGATGG + Intergenic
949551168 3:5113955-5113977 GCTCCCCACATCTCAGACGATGG + Intergenic
949565703 3:5243002-5243024 GCTCCCCACATCTCAGACGATGG + Intergenic
949853362 3:8439947-8439969 GCTCCCCACATCTCAGACGATGG - Intergenic
949988703 3:9559932-9559954 GCTCCCCACATCTCAGACGATGG - Intergenic
949988761 3:9560164-9560186 GCTCCCCACATCTCAGACGATGG - Intergenic
949989869 3:9570024-9570046 GCTCCCCACATCTCAGACGATGG - Intergenic
949992609 3:9591833-9591855 GCTCCCCACATCTCAGACGATGG - Intergenic
950060774 3:10070037-10070059 GCTCCCCACATCTCAGACGATGG - Intronic
950253796 3:11488026-11488048 GCTCCCCACATCTCAGACGATGG + Intronic
950392221 3:12705610-12705632 GTTCCTCAGAGCTCAGTCCTTGG - Intergenic
950412758 3:12849902-12849924 GCTCCCCACATCTCAGACGATGG + Intronic
950535850 3:13577727-13577749 GGTCCACAGAGCTCCGTGGCTGG + Intronic
950742340 3:15061751-15061773 GCTCCCCACATCTCAGACGATGG - Intronic
950754950 3:15163521-15163543 GCTCCCCACATCTCAGACGATGG + Intergenic
950819476 3:15742352-15742374 GCTCCCCACATCTCAGACGATGG - Intronic
950949205 3:16980516-16980538 GCTCCCCACATCTCAGACGATGG + Intronic
951013666 3:17705628-17705650 GCTCCCCACATCTCAGACGATGG + Intronic
951168767 3:19513304-19513326 GACCCCCAGACCTCAGTCCAAGG + Exonic
952308841 3:32169706-32169728 GCTCCCCACATCTCAGACGACGG - Intergenic
952364668 3:32664090-32664112 GCTCCCCACATCTCAGACGATGG - Intergenic
952896612 3:38082176-38082198 GCTCCCCACATCTCAGACGATGG + Intronic
953037754 3:39227673-39227695 GCTCCCCACATCTCAGACGATGG - Intergenic
953096217 3:39779669-39779691 GGCCCCCACAGCGCAGTGGAGGG - Intergenic
953322334 3:41983466-41983488 GCTCCCCACATCTCAGACGATGG + Intergenic
953425963 3:42797563-42797585 GCTCCCCACATCTCAGACGATGG - Intronic
953922773 3:46964031-46964053 GCTCCCCACATCTCAGACGATGG - Intronic
954080593 3:48211143-48211165 GCTCCCCACATCTCAGACGATGG - Intergenic
954162700 3:48734122-48734144 GCTCCCCACATCTCAGACGATGG - Intronic
954356308 3:50085228-50085250 GCTCCCCACATCTCAGACGATGG + Intronic
954399666 3:50312369-50312391 GCTCCCCACATCTCAGACGATGG + Intronic
954529829 3:51309004-51309026 GCTCCCCACATCTCAGACGATGG + Intronic
954599749 3:51858607-51858629 GCTCCCCACATCTCAGACGATGG - Intergenic
955297292 3:57747237-57747259 GCTCCCCACATCTCAGACGATGG - Intergenic
955394955 3:58550512-58550534 GCTCCCCACATCTCAGACGATGG + Intergenic
955434975 3:58890805-58890827 GCTCCCCACATCTCAGACGATGG + Intronic
955699844 3:61672100-61672122 GCTCCCCACATCTCAGACGATGG + Intronic
956061884 3:65356600-65356622 GGTCCCCCGAGCGCAGGAGAGGG - Exonic
956270282 3:67443666-67443688 GCTCCCCACATCTCAGACGATGG - Intronic
956603372 3:71047196-71047218 GGTCACTGGAGCTCAGTGGAGGG + Intronic
957316849 3:78583718-78583740 GCTCCCCACATCTCAGACGATGG + Intergenic
957620084 3:82584442-82584464 GCTCCCCACATCTCAGACGATGG - Intergenic
958560830 3:95745075-95745097 GCTCCCCATATCTCAGACGATGG - Intergenic
958808966 3:98838427-98838449 GCTCCCCACATCTCAGACGATGG + Intronic
958957505 3:100478244-100478266 GCTCCCCACATCTCAGACGATGG + Intergenic
959042567 3:101439147-101439169 GCTCCCCACATCTCAGACGATGG - Intronic
959415795 3:106075169-106075191 GCTCCCCACATCTCAGACGATGG + Intergenic
959419520 3:106112354-106112376 GCTCCCCACATCTCAGACGATGG + Intergenic
959586105 3:108026416-108026438 GCTCCCCACATCTCAGACGATGG + Intergenic
959683732 3:109123988-109124010 GCTCCCCACATCTCAGACGATGG - Intergenic
959901841 3:111670253-111670275 GGTCCCCAGAGCTAAGCCCCAGG - Intergenic
960030161 3:113046963-113046985 GCTCCCCACATCTCAGACGATGG + Intergenic
960698026 3:120414396-120414418 GCTCCCCACATCTCAGACGATGG - Intronic
960780675 3:121313977-121313999 GCTCCCCACATCTCAGACGATGG + Intronic
960861962 3:122164307-122164329 GCTCCCCACATCTCAGACGATGG - Intergenic
960866110 3:122201799-122201821 GCTCCCCACATCTCAGACGATGG + Intronic
960920954 3:122747268-122747290 GCTCCCCACATCTCAGACGATGG - Intronic
960924464 3:122780935-122780957 GGTCCCCACATCTCAGACGATGG + Intronic
961330141 3:126133668-126133690 GCTCCCCAGAGCCCAGTCCCTGG + Intronic
961729166 3:128954220-128954242 GCTCCCCACATCTCAGACGATGG - Intronic
961789159 3:129363719-129363741 GCTCCCCACATCTCAGACGATGG + Intergenic
961962371 3:130867906-130867928 GCTCCCCACATCTCAGACGATGG - Intronic
962063151 3:131952178-131952200 GCTCCCCACATCTCAGACGATGG - Intronic
962076700 3:132089596-132089618 GGTGCCCAGAGCTGAGTCCTTGG + Intronic
962113112 3:132471626-132471648 GCTCCCCACATCTCAGACGATGG + Intronic
962572132 3:136723307-136723329 GCTCCCCACATCTCAGACGATGG - Intronic
962623109 3:137198700-137198722 GCTCCCCACATCTCAGACGATGG + Intergenic
963249130 3:143086968-143086990 GCTCCCCACATCTCAGACGATGG + Intergenic
963498339 3:146096499-146096521 GCTCCCCACATCTCAGACGATGG - Intronic
963911655 3:150821216-150821238 GCTCCCCACATCTCAGACGATGG + Intergenic
964765912 3:160178648-160178670 GCTCCCCACATCTCAGACGATGG - Intergenic
965302302 3:167018679-167018701 GCTCCCCACATCTCAGTCGATGG - Intergenic
965650018 3:170923572-170923594 GCTCCCCACATCTCAGACGATGG - Intergenic
966015569 3:175133102-175133124 GCTCCCCACATCTCAGACGATGG + Intronic
966359522 3:179119772-179119794 GCTCCCCACATCTCAGACGATGG - Intergenic
966375410 3:179291088-179291110 GCTCCCCACATCTCAGACGATGG + Intergenic
966420246 3:179728362-179728384 GCTCCCCACATCTCAGACGATGG + Intronic
966617255 3:181926129-181926151 GCTCCCCACATCTCAGACGACGG + Intergenic
966966975 3:185003939-185003961 GCTCCCCACATCTCAGACGATGG + Intronic
967169436 3:186811851-186811873 GCTCCCCACATCTCAGACGATGG + Intergenic
967176050 3:186864153-186864175 GCTCCCCACATCTCAGACGATGG - Intergenic
967177461 3:186873874-186873896 GCTCCCCACATCTCAGACGATGG - Intergenic
967524210 3:190473237-190473259 GCTCCCCACATCTCAGACGATGG - Intergenic
968042473 3:195599925-195599947 GCTCCCCACATCTCAGACGATGG + Intergenic
968139399 3:196244069-196244091 GCTCCCCACATCTCAGACGATGG - Intronic
968139479 3:196244381-196244403 GCTCCCCACATCTCAGACGATGG - Intronic
968175225 3:196543412-196543434 GCTCCCCACATCTCAGACGATGG + Intergenic
968411618 4:395609-395631 GCTCCCCACATCTCAGACGATGG - Intergenic
968429846 4:550556-550578 GCTCCCCACATCTCAGACGATGG + Intergenic
968429890 4:550752-550774 GCTCCCCACATCTCAGACGATGG + Intergenic
968507119 4:975959-975981 GCTCCCCACATCTCAGACGATGG - Intronic
968924353 4:3539129-3539151 GCTCCCCACATCTCAGACGATGG + Intergenic
969404153 4:6977856-6977878 GCTCCCCACATCTCAGACGATGG - Intronic
969508370 4:7602496-7602518 GCTCCCCACATCTCAGACGATGG + Intronic
970409205 4:15790791-15790813 GCTCCCCACATCTCAGACGATGG - Intronic
970472778 4:16393681-16393703 GCTCCCCACATCTCAGACGATGG + Intergenic
971030011 4:22625654-22625676 GGTCCTCAGAGTTTAGTAGAAGG + Intergenic
971541072 4:27817445-27817467 GGTCCCCAAACCTCAGGCCAGGG + Intergenic
972288244 4:37668831-37668853 GCTCCCCACATCTCAGACGATGG - Intronic
972412377 4:38807455-38807477 GCTCCCCACATCTCAGACGATGG - Intronic
972412398 4:38807531-38807553 GCTCCCCACATCTCAGACGATGG - Intronic
972551816 4:40141467-40141489 GCTCCCCACATCTCAGACGATGG + Intronic
972654076 4:41049161-41049183 GCTCCCCACATCTCAGACGATGG - Intronic
972939704 4:44181822-44181844 GCTCCCCACATCTCAGACGATGG - Intronic
973109055 4:46377350-46377372 GCTCCCCACATCTCAGACGATGG - Intronic
973263325 4:48186432-48186454 GCTCCCCACATCTCAGACGATGG - Intronic
973281555 4:48364256-48364278 GCTCCCCACATCTCAGACGATGG + Intronic
973593372 4:52464719-52464741 GCTCCCCACATCTCAGACGATGG - Intergenic
973673215 4:53238741-53238763 GCTCCCCACATCTCAGACGATGG + Intronic
973675275 4:53256305-53256327 GCTCCCCACATCTCAGACGATGG + Intronic
973785101 4:54325896-54325918 GCTCCCCACATCTCAGACGATGG + Intergenic
974076561 4:57173150-57173172 GCTCCCCACATCTCAGACGATGG - Intergenic
975042418 4:69761974-69761996 GCTCCCCACATCTCAGACGATGG - Intronic
975063777 4:70037528-70037550 GCTCCCCACATCTCAGACGATGG - Intergenic
975685540 4:76916667-76916689 GCTCCCCACATCTCAGACGATGG - Intergenic
976149372 4:82077654-82077676 GCTCCCCACATCTCAGACGATGG - Intergenic
976265037 4:83182092-83182114 GCTCCCCACATCTCAGACGATGG - Intergenic
976340907 4:83944042-83944064 GCTCCCCACATCTCAGACGATGG + Intergenic
976607367 4:86995887-86995909 GCTCCCCACATCTCAGACGATGG - Intronic
977205078 4:94157889-94157911 GCTCCCCACATCTCAGACGATGG - Intergenic
978409091 4:108409438-108409460 GCTCCCCACATCTCAGACGATGG - Intergenic
978519089 4:109597975-109597997 GCTCCCCACATCTCAGACGATGG + Intronic
978947495 4:114516517-114516539 GCTCCCCACATCTCAGACGATGG - Intergenic
979622334 4:122811807-122811829 GCTCCCCACATCTCAGACGATGG - Intergenic
980056564 4:128084005-128084027 GCTCCCCACATCTCAGACGATGG + Intronic
981677436 4:147357891-147357913 GCTCCCCACATCTCAGACGATGG - Intergenic
981970379 4:150659332-150659354 GCTCCCCACATCTCAGACGATGG - Intronic
982022304 4:151215051-151215073 GCTCCCCACATCTCAGACGATGG + Intronic
982040370 4:151390786-151390808 GCTCCCCACATCTCAGACGATGG - Intergenic
982075261 4:151731690-151731712 GCTCCCCACATCTCAGACGATGG - Intronic
982182919 4:152765581-152765603 GCTCCCCACATCTCAGACGATGG + Intronic
982348128 4:154384420-154384442 GCACCCCAGAGCTCAGTCTCGGG + Exonic
982616032 4:157637475-157637497 GCTCCCCACATCTCAGACGATGG + Intergenic
983218177 4:165020288-165020310 GCTCCCCACATCTCAGACGATGG + Intergenic
983604518 4:169570107-169570129 GCTCCCCACATCTCAGACGATGG - Intronic
983652185 4:170046329-170046351 GCTCCCCACATCTCAGACGATGG - Intergenic
983664496 4:170166507-170166529 GCTCCCCACATCTCAGACGATGG + Intergenic
984728176 4:183041030-183041052 GCTCCCCACATCTCAGACGATGG + Intergenic
984804280 4:183737169-183737191 GCTCCCCACATCTCAGACGATGG + Intergenic
984977249 4:185240898-185240920 GCTCCCCACATCTCAGACGATGG + Intronic
985216350 4:187658068-187658090 GCTCCCCACATCTCAGACGATGG - Intergenic
986067978 5:4254768-4254790 AGGCCCCAGATCTCAGTCTATGG - Intergenic
987268043 5:16277240-16277262 GCTCCCCACATCTCAGACGATGG + Intergenic
987297643 5:16568093-16568115 GTTCCCCAGAGTTCAGACAAAGG + Intronic
987469258 5:18309599-18309621 GCTCCCCACATCTCAGACGATGG - Intergenic
988551937 5:32207854-32207876 GCTCCCCACATCTCAGACGATGG - Intergenic
988760717 5:34307090-34307112 GCTCCCCACATCTCAGACGATGG + Intergenic
989021553 5:37013588-37013610 GCTCCCCACATCTCAGACGATGG + Intronic
989061631 5:37415891-37415913 GCTCCCCACATCTCAGACGATGG + Intronic
989068206 5:37483975-37483997 GCTCCCCACATCTCAGACGATGG + Intronic
989076063 5:37563946-37563968 GCTCCCCACATCTCAGACGATGG + Intronic
989211624 5:38862660-38862682 GCTCCCCACATCTCAGACGATGG + Intronic
989575002 5:42980448-42980470 GCTCCCCACATCTCAGACGATGG - Intergenic
989633439 5:43511016-43511038 GCTCCCCACATCTCAGACGATGG - Intronic
989634808 5:43522076-43522098 GCTCCCCACATCTCAGACGATGG - Intergenic
990297794 5:54420784-54420806 GCTCCCCACATCTCAGACGATGG + Intergenic
990459139 5:56015353-56015375 GCTCCCCACATCTCAGACGATGG + Intergenic
991073856 5:62513972-62513994 GCTCCCCACATCTCAGACGATGG + Intronic
991375130 5:65958040-65958062 GCTCCCCACATCTCAGACGATGG + Intronic
991377082 5:65977537-65977559 GCTCCCCACATCTCAGACGATGG + Intronic
992289573 5:75270155-75270177 GCTCCCCACATCTCAGACGATGG - Intergenic
992373787 5:76171355-76171377 GCTCCCCACATCTCAGACGATGG - Intronic
992463848 5:76985318-76985340 GCTCCCCACATCTCAGACGATGG + Intergenic
992574411 5:78096586-78096608 GCTCCCCACATCTCAGACGATGG - Intronic
992801716 5:80301186-80301208 GCTCCCCACATCTCAGACGATGG - Intergenic
992977967 5:82139457-82139479 GCTCCCCACATCTCAGACGATGG - Intronic
993496559 5:88615769-88615791 GCTCCCCACATCTCAGACGATGG - Intergenic
995123656 5:108559510-108559532 GCTCCCCACATCTCAGACGATGG + Intergenic
995236266 5:109833051-109833073 GCTCCCCACATCTCAGACGATGG + Intronic
995236276 5:109833090-109833112 GCTCCCCATATCTCAGACGATGG + Intronic
995942397 5:117600164-117600186 GCTCCCCACATCTCAGACGATGG + Intergenic
995994443 5:118282597-118282619 GCTCCCCACATCTCAGACGATGG - Intergenic
996054080 5:118965015-118965037 GCTCCCCACATCTCAGACGATGG - Intronic
996159852 5:120147997-120148019 GCTCCCCACATCTCAGACGATGG - Intergenic
997565339 5:134882223-134882245 GCTCCCCACATCTCAGACGATGG + Intronic
997636272 5:135409180-135409202 GCTCCCCACATCTCAGACGATGG - Intergenic
997930676 5:138070109-138070131 GCTCCCCACATCTCAGACGATGG - Intergenic
998021906 5:138777238-138777260 GCTCCCCACATCTCAGACGATGG + Intronic
998025336 5:138811297-138811319 GCTCCCCACATCTCAGACGATGG + Intronic
998053596 5:139056286-139056308 GCTCCCCACATCTCAGACGATGG - Intronic
998067398 5:139170482-139170504 GCTCCCCACATCTCAGACGATGG - Intronic
998432245 5:142076723-142076745 GCTCCCCACATCTCAGACGATGG + Intergenic
999123546 5:149229224-149229246 GGTTCTCAGAGCCCAGTAGAGGG - Intronic
999181179 5:149670816-149670838 GCTCCCCACATCTCAGACGATGG + Intergenic
999375199 5:151081464-151081486 GGCCCCCAGAGTTCCGTCCAGGG + Intronic
999455694 5:151714266-151714288 GCTCCCCACATCTCAGACGATGG + Intergenic
999532698 5:152480230-152480252 GCTCCCCACATCTCAGACGATGG + Intergenic
1000159113 5:158582413-158582435 GCTCCCCACATCTCAGACGATGG - Intergenic
1000364002 5:160474205-160474227 AGTCCCCAATGCTCAGTCCAAGG - Intergenic
1000630290 5:163584006-163584028 GCTCCCCACATCTCAGACGATGG + Intergenic
1000722907 5:164730542-164730564 GTTCCACAGAGCACAGTGGAGGG + Intergenic
1000985304 5:167859085-167859107 GCTCCCCACATCTCAGACGATGG - Intronic
1001077946 5:168643773-168643795 GCTCCCCACATCTCAGACGATGG + Intergenic
1001394294 5:171404516-171404538 GCTCCCCACATCTCAGACGATGG + Intronic
1001958182 5:175862783-175862805 AGTCCCCAGAGATCAATTGAGGG - Intronic
1002115715 5:176961246-176961268 GCTCCCCACATCTCAGACGATGG - Intronic
1002529441 5:179835146-179835168 GCTCCCCACATCTCAGACGATGG + Intronic
1002787915 6:418666-418688 GGTCCCCAGAGCTCTGGGGGTGG + Intergenic
1003319477 6:5038186-5038208 GCTCCCCACATCTCAGACGATGG + Intergenic
1004152449 6:13133910-13133932 GCTCCCCACATCTCAGACGATGG - Intronic
1004388016 6:15188742-15188764 GCTCCCCACATCTCAGACGATGG - Intergenic
1004415031 6:15416068-15416090 GCTCCCCACATCTCAGACGATGG + Intronic
1004874309 6:19939315-19939337 GGTCCCCACATCTCAGACGATGG - Intergenic
1005158707 6:22836349-22836371 GCTCCCCACATCTCAGACGATGG - Intergenic
1005607097 6:27485830-27485852 GCTCCCCACATCTCAGACGATGG + Intergenic
1005837159 6:29718510-29718532 GCTCCCCACATCTCAGACGATGG - Intergenic
1005929787 6:30475098-30475120 GCTCCCCACATCTCAGACGATGG - Intergenic
1005933237 6:30499019-30499041 GCTCCCCACATCTCAGACGATGG + Intergenic
1006004818 6:30993480-30993502 GGTCCCCACATCTCAGACGATGG + Intergenic
1006014200 6:31067432-31067454 GCTCCCCACATCTCAGACGATGG + Intergenic
1006065134 6:31455883-31455905 GCTCCCCACATCTCAGACGATGG + Intergenic
1006128569 6:31854747-31854769 GCTCCCCACATCTCAGACGATGG + Intergenic
1006141553 6:31932496-31932518 GCTCCCCACATCTCAGACGATGG + Intronic
1006209952 6:32385473-32385495 GCTCCCCACATCTCAGACGATGG + Intergenic
1006225320 6:32532118-32532140 GCTCCCCACATCTCAGACGATGG - Intergenic
1006232507 6:32596334-32596356 GCTCCCCACATCTCAGACGATGG + Intergenic
1006281933 6:33060133-33060155 GCTCCCCACATCTCAGACGATGG + Intergenic
1006287870 6:33111857-33111879 GGTCAGCAGGGCTCAGTCTAGGG - Intergenic
1006403873 6:33832936-33832958 GCTCCCCACATCTCAGACGATGG + Intergenic
1006492198 6:34397275-34397297 GCTCCCCACATCTCAGACGATGG - Intronic
1006546613 6:34786440-34786462 GCTCCCCACATCTCAGACGATGG - Intergenic
1006617521 6:35340350-35340372 GCTCCCCACATCTCAGACGATGG - Intergenic
1006623515 6:35383644-35383666 GCTCCCCACATCTCAGACGATGG - Intronic
1007641360 6:43342500-43342522 CATCCCCAGGGCTCAGTCCAGGG - Intronic
1007651444 6:43425120-43425142 GCTCCCCACATCTCAGACGATGG - Intergenic
1007674361 6:43581274-43581296 GCTCCCCACATCTCAGACGATGG + Intronic
1008106406 6:47444310-47444332 GCTCCCCACATCTCAGACGATGG + Intergenic
1008112251 6:47506182-47506204 GCTCCCCACATCTCAGACGATGG + Intronic
1008184390 6:48371517-48371539 GCTCCCCACATCTCAGACGATGG + Intergenic
1008480653 6:51981933-51981955 GCTCCCCACATCTCAGACGATGG - Intronic
1008624791 6:53305584-53305606 GCTCCCCACATCTCAGACGATGG + Intronic
1008926661 6:56895400-56895422 GCTCCCCACATCTCAGACGATGG + Intronic
1009049034 6:58257699-58257721 GCTCCCCACATCTCAGACGATGG - Intergenic
1010192096 6:73205780-73205802 GCTCCCCACATCTCAGACGATGG + Intergenic
1010239214 6:73601158-73601180 GCTCCCCACATCTCAGACGATGG - Intronic
1010246023 6:73661078-73661100 GCTCCCCACATCTCAGACGATGG + Intergenic
1010300671 6:74255385-74255407 GCTCCCCACATCTCAGACGATGG + Intergenic
1010400641 6:75442134-75442156 GCTCCCCACAGCTCAGACAATGG + Intronic
1011148699 6:84245038-84245060 GCTCCCCACATCTCAGACGATGG + Intergenic
1011405355 6:87010528-87010550 GCTCCCCACATCTCAGACGATGG + Intronic
1011474252 6:87736241-87736263 GCTCCCCACATCTCAGACGATGG + Intergenic
1011476150 6:87751464-87751486 GCTCCCCACATCTCAGACGATGG + Intergenic
1012244933 6:96915463-96915485 GTGCCCGAGAGCTCAGTGGAAGG + Intergenic
1012428644 6:99141952-99141974 GCTCCCCACATCTCAGACGATGG - Intergenic
1012899638 6:104991433-104991455 GATCCCCACATCTCAGACGATGG + Intronic
1012983725 6:105854237-105854259 GCTCCCCACATCTCAGGCGATGG + Intergenic
1013190838 6:107803202-107803224 GCTCCCCACATCTCAGACGATGG - Intronic
1013325954 6:109046698-109046720 GCTCCCCACATCTCAGACGATGG - Intronic
1013530833 6:111017633-111017655 GCTCCCCACATCTCAGACGATGG + Intronic
1013681370 6:112528627-112528649 GCTCCCCACATCTCAGACGATGG + Intergenic
1014123387 6:117750964-117750986 GCTCCCCACATCTCAGACGATGG - Intergenic
1014557181 6:122849688-122849710 GCTCCCCACATCTCAGACGATGG + Intergenic
1014764285 6:125389510-125389532 GCTCCCCACATCTCAGACGATGG + Intergenic
1015220805 6:130802256-130802278 GCTCCCCACATCTCAGACGATGG - Intergenic
1015476606 6:133664585-133664607 GCTCCCCACATCTCAGACGATGG - Intergenic
1015643730 6:135364272-135364294 GCTCCCCACATCTCAGACGATGG + Intronic
1016123676 6:140374088-140374110 GCTCCCCACATCTCAGACGATGG + Intergenic
1016973664 6:149786735-149786757 GCTCCCCACATCTCAGACGATGG + Intronic
1017170354 6:151450224-151450246 GCTCCCCACATCTCAGACGATGG - Intronic
1017215226 6:151899777-151899799 GCTCCCCACATCTCAGACGATGG + Intronic
1017844086 6:158241127-158241149 GCTCCCCACATCTCAGACGATGG + Intronic
1018295278 6:162338867-162338889 GCTCCCCACATCTCAGACGATGG - Intronic
1018528189 6:164736423-164736445 GCTCCCCACATCTCAGACGATGG + Intergenic
1018686624 6:166308416-166308438 GGTCCCCACAGCTGAGACGCGGG + Intronic
1019048998 6:169169063-169169085 GGCCCCCAGAGCACGGTGGAGGG + Intergenic
1019439052 7:1037861-1037883 GCTCCCCACATCTCAGACGATGG - Intronic
1019445699 7:1069964-1069986 GCTCCCCACATCTCAGACGATGG - Intronic
1019459177 7:1147345-1147367 GCTCCCCACATCTCAGACGATGG + Intergenic
1019674393 7:2302717-2302739 GCTCCCCACATCTCAGACGATGG - Intronic
1019709819 7:2513075-2513097 GGTGCCCAGGGCCCAGACGAGGG - Intronic
1019715050 7:2534666-2534688 GCTCCCCACATCTCAGACGATGG + Intergenic
1020284951 7:6671809-6671831 GCTCCCCACATCTCAGACGATGG + Intergenic
1020498844 7:8890534-8890556 GCTCCCCACATCTCAGACGATGG - Intergenic
1020616561 7:10466148-10466170 GCTCCCCACATCTCAGACGATGG + Intergenic
1021120442 7:16790381-16790403 GCTCCCCACATCTCAGACGATGG + Intergenic
1021440186 7:20668337-20668359 GCTCCCCACATCTCAGACGATGG - Intronic
1021647324 7:22800782-22800804 GCTCCCCACATCTCAGACGATGG - Intergenic
1021735272 7:23636476-23636498 GCTCCCCACATCTCAGACGATGG - Intronic
1021872215 7:25018259-25018281 GCTCCCCACATCTCAGACGATGG - Intergenic
1022187828 7:27987230-27987252 GCTCCCCACATCTCAGACGATGG - Intronic
1022274059 7:28838767-28838789 GCTCCCCACATCTCAGACGATGG - Intergenic
1022700312 7:32753863-32753885 GCTCCCCACATCTCAGACGATGG - Intergenic
1023044142 7:36196987-36197009 GCTCCCCACATCTCAGACGATGG - Intronic
1023160540 7:37292563-37292585 GCTCCCCACATCTCAGACGATGG - Intronic
1024309805 7:47959437-47959459 GCTCCCCACATCTCAGACGATGG - Intronic
1024989246 7:55220570-55220592 GCTCCCCACATCTCAGACGATGG + Intronic
1025000545 7:55311831-55311853 GCTCCCCACATCTCAGACGATGG - Intergenic
1025011681 7:55402859-55402881 GCTCCCCACATCTCAGACGATGG + Intronic
1025706827 7:63874155-63874177 GCTCCCCACATCTCAGACGATGG - Intergenic
1025778265 7:64577332-64577354 GCTCCCCACATCTCAGACGATGG - Intergenic
1025778295 7:64577448-64577470 GCTCCCCACATCTCAGACGATGG - Intergenic
1025793623 7:64717899-64717921 GCTCCCCACATCTCAGACGATGG - Intergenic
1025808230 7:64856126-64856148 GCTCCCCACATCTCAGACGATGG - Intergenic
1025821691 7:64968490-64968512 GCTCCCCACATCTCAGACGATGG + Intergenic
1025828938 7:65033536-65033558 GCTCCCCACATCTCAGACGATGG - Intergenic
1025852805 7:65258045-65258067 GCTCCCCACATCTCAGACGATGG - Intergenic
1025979575 7:66394495-66394517 GCTCCCCACATCTCAGACGATGG + Intronic
1026007988 7:66614644-66614666 GCTCCCCACATCTCAGACGATGG - Intergenic
1026413654 7:70155215-70155237 CCTCCCCAGAGCTCAGCCCACGG - Intronic
1026575247 7:71566227-71566249 GTTTCCCAGAGGTCAGTCTAGGG - Intronic
1026575668 7:71569628-71569650 GTTCCCCAGAGTTCAGTCCAGGG - Intronic
1026783491 7:73284704-73284726 GCTCCCCACATCTCAGACGATGG + Intergenic
1027182991 7:75952702-75952724 GCTCCCCACATCTCAGACGATGG + Intronic
1027371027 7:77509027-77509049 GCTCCCCACATCTCAGACGATGG - Intergenic
1028595711 7:92545232-92545254 GCTCCCCACACCTCAGACGATGG + Intergenic
1028685665 7:93586466-93586488 GCTCCCCACATCTCAGACGATGG + Intergenic
1029279406 7:99426791-99426813 GCTCCCCACATCTCAGACGATGG - Intronic
1029334639 7:99888630-99888652 GCTCCCCACATCTCAGACGATGG + Intronic
1029430170 7:100523950-100523972 GCTCCCCACATCTCAGACGATGG + Intergenic
1029469010 7:100742247-100742269 GCTCCCCACATCTCAGACGATGG + Intronic
1029550885 7:101236547-101236569 GGTCGCCAGCGCTCAGTCTCTGG + Intronic
1029569358 7:101359676-101359698 GCTCCCCACATCTCAGACGATGG + Intergenic
1030036360 7:105411125-105411147 GCTCCCCACATCTCAGACGATGG + Intergenic
1030329306 7:108255664-108255686 GCTCCCCACATCTCAGACGATGG - Intronic
1030602726 7:111609925-111609947 GCTCCCCACATCTCAGACGATGG - Intergenic
1030692659 7:112551631-112551653 AGTCCCCACATCTCAGACGATGG - Intergenic
1030725661 7:112922571-112922593 GCTCCCCACATCTCAGACGATGG - Intronic
1032056621 7:128689376-128689398 GCTCCCCACATCTCAGACGATGG - Intergenic
1033219768 7:139520355-139520377 GCTCCCCACATCTCAGACGATGG + Intergenic
1033294019 7:140114743-140114765 GCTCCCCACATCTCAGACGATGG - Intronic
1033565655 7:142575499-142575521 GCTCCCCACATCTCAGACGATGG - Intergenic
1034034184 7:147802196-147802218 GCTCCCCACATCTCAGACGATGG + Intronic
1034292763 7:149945785-149945807 TGTCCCTAAAGCTCAGACGATGG - Intergenic
1034322467 7:150198459-150198481 GCTCCCCACATCTCAGACGATGG - Intergenic
1034541573 7:151761866-151761888 TGTCCCCAGACCACAGTCAAAGG + Intronic
1034813304 7:154151087-154151109 TGTCCCTAAAGCTCAGACGATGG + Intronic
1034985226 7:155509076-155509098 GATCCCCCTAGCTCAGTCGGAGG - Exonic
1035508039 8:150310-150332 GCTCCCCACATCTCAGACGATGG + Intergenic
1035633208 8:1124363-1124385 GGACCTCAGAGCTGAGTCCAGGG + Intergenic
1035826777 8:2653648-2653670 GGACCCCGGACCTCAGTGGAAGG - Intergenic
1036095955 8:5725334-5725356 GCTCCCCACATCTCAGGCGATGG - Intergenic
1036483012 8:9154267-9154289 GCTCCCCACATCTCAGACGATGG + Exonic
1036507043 8:9365373-9365395 GCTCCCCACATCTCAGACGATGG + Intergenic
1036536803 8:9658021-9658043 GCTCCCCACATCTCAGACGATGG + Intronic
1037658875 8:20910282-20910304 GGTCCCCAATGCTAAGTAGAGGG + Intergenic
1037756305 8:21712387-21712409 GCTCCCCACATCTCAGACGATGG + Intronic
1038595070 8:28880871-28880893 GCTCCCCACATCTCAGACGATGG - Intronic
1038744919 8:30247263-30247285 GCTCCCCACATCTCAGACGATGG + Intergenic
1038994804 8:32909928-32909950 GGTCCCCAGAGCACAGGAGTTGG + Intergenic
1039072303 8:33658563-33658585 GCTCCCCACATCTCAGACGATGG + Intergenic
1039153423 8:34529536-34529558 GCTCCCCACATCTCAGGCGATGG + Intergenic
1039201049 8:35094455-35094477 GCTCCCCACATCTCAGACGATGG + Intergenic
1039488167 8:37927736-37927758 GCTCCCCACATCTCAGACGATGG - Intergenic
1039650956 8:39339436-39339458 GCTCCCCACATCTCAGACGATGG + Intergenic
1040043549 8:42939863-42939885 GCTCCCCACATCTCAGACGATGG + Intronic
1040052869 8:43033276-43033298 GCTCCCCACATCTCAGACGATGG + Intronic
1040052918 8:43033470-43033492 GCTCCCCACATCTCAGACGATGG + Intronic
1040070054 8:43180476-43180498 GCTCCCCACATCTCAGACGATGG + Intronic
1040093421 8:43419912-43419934 GCTCCCCACATCTCAGACGATGG + Intergenic
1040785443 8:51159026-51159048 GCTCCCCACATCTCAGACGATGG - Intergenic
1040806336 8:51401035-51401057 AATCCCCAGAGTTCAGTCCAGGG - Intronic
1041070701 8:54125140-54125162 GCTCCCCACATCTCAGACGATGG - Intergenic
1041287051 8:56272439-56272461 GCTCCCCACATCTCAGACGATGG + Intergenic
1041677325 8:60549020-60549042 GCTCCCCACATCTCAGACGATGG + Intronic
1041796703 8:61753462-61753484 GCTCCCCACATCTCAGACGATGG + Intergenic
1041920885 8:63180315-63180337 GCTCCCCACATCTCAGACGATGG + Intronic
1041920893 8:63180354-63180376 GCTCCCCACATCTCAGACGATGG + Intronic
1042048886 8:64685480-64685502 GCTCCCCACATCTCAGACGATGG - Intronic
1042196017 8:66232238-66232260 GCTCCCCACATCTCAGACGATGG - Intergenic
1042290785 8:67167717-67167739 GCTCCCCACATCTCAGACGATGG + Intronic
1042303491 8:67310672-67310694 GCTCCCCACATCTCAGACGATGG - Intronic
1042833307 8:73054897-73054919 GATCCCCAGAGTGCAGACGAAGG - Intergenic
1043958588 8:86390115-86390137 GCTCCCCACATCTCAGACGATGG + Intronic
1043961648 8:86424225-86424247 GCTCCCCACATCTCAGACGATGG + Intronic
1043986061 8:86694680-86694702 GCTCCCCACATCTCAGACGATGG + Intronic
1044507575 8:93039187-93039209 GCTCCCCACATCTCAGACGATGG - Intergenic
1044597275 8:93970949-93970971 GCTCCCCACATCTCAGACGATGG + Intergenic
1044660536 8:94590510-94590532 GCTCCCCACATCTCAGACGATGG - Intergenic
1045120490 8:99029158-99029180 GCTCCCCACATCTCAGACGATGG + Intronic
1045235755 8:100351333-100351355 GCTCCCCACATCTCAGACGATGG - Intronic
1045298740 8:100892939-100892961 GCTCCCCACATCTCAGACGATGG + Intergenic
1046026233 8:108727517-108727539 GCTCCCCACATCTCAGTTGATGG - Intronic
1046636230 8:116678608-116678630 GCTCCCCACATCTCAGACGATGG - Intronic
1047388642 8:124432250-124432272 GCTCCCCACATCTCAGACGATGG + Intergenic
1047782176 8:128119118-128119140 GCTCCCCACATCTCAGACGATGG + Intergenic
1047848200 8:128826847-128826869 GCTCCCCACATCTCAGACGATGG + Intergenic
1048284491 8:133131154-133131176 GGTTCCCAGTGCTCACTCCATGG + Intronic
1048368342 8:133757519-133757541 GCTCCCCACATCTCAGACGATGG - Intergenic
1049016539 8:139924067-139924089 AGGCCCCAGAGCTCAGTGCAGGG + Intronic
1049177464 8:141202570-141202592 GCTCCCCACATCTCAGACGATGG + Intergenic
1049234998 8:141508026-141508048 GGTCCCCAGACCCGAGTCTAGGG + Intergenic
1049551336 8:143261359-143261381 TGTCCCCAGAGCTGAGGCGGTGG + Intronic
1049729032 8:144166540-144166562 GCTCCCTAGAGCTCTGTCCAAGG + Intronic
1049783021 8:144437388-144437410 GGTGCCCAGATCTCAGCCCATGG + Intronic
1050534888 9:6622857-6622879 GCTCCCCACATCTCAGACGATGG - Intronic
1050558126 9:6807497-6807519 GCTCCCCACATCTCAGACGATGG - Intronic
1050862301 9:10449611-10449633 GCTCCCCACATCTCAGACGATGG - Intronic
1051258020 9:15233971-15233993 GCTCCCCACATCTCAGACGATGG - Intronic
1051276824 9:15406441-15406463 GCTCCCCACATCTCAGACGATGG - Intergenic
1051430679 9:16977711-16977733 GCTCCCCACATCTCAGACGATGG + Intergenic
1052492909 9:29189511-29189533 GCTCCCCACATCTCAGACGATGG + Intergenic
1052613765 9:30811890-30811912 GGTCCCCAGACCCCAGGCCAGGG + Intergenic
1052881009 9:33600903-33600925 GCTCCCCACATCTCAGACGATGG - Intergenic
1052887970 9:33667685-33667707 GCTCCCCACATCTCAGACGATGG - Intergenic
1052928642 9:34038858-34038880 GCTCCCCACATCTCAGACGATGG - Intronic
1052941880 9:34137494-34137516 GCTCCCCACATCTCAGACGATGG - Intergenic
1053048075 9:34936684-34936706 GCTCCCCACATCTCAGACGATGG - Intergenic
1053255968 9:36615735-36615757 GCTCCCCACATCTCAGACGATGG + Intronic
1053467972 9:38324640-38324662 GCTCCCCACATCTCAGACGATGG - Intergenic
1055138781 9:72851649-72851671 GCTCCCCACATCTCAGACGATGG + Intergenic
1055242039 9:74197420-74197442 GCTCCCCACATCTCAGACGATGG - Intergenic
1055297949 9:74853026-74853048 GCTCCCCACATCTCAGACGACGG - Intronic
1055414398 9:76064791-76064813 GCTCCCCACATCTCAGACGATGG + Intronic
1055506628 9:76955439-76955461 GCTCCCCACATCTCAGACGATGG - Intergenic
1055948226 9:81710155-81710177 GCTCCCCACATCTCAGACGATGG - Intergenic
1056152457 9:83803868-83803890 GCTCCCCACATCTCAGACGATGG - Intronic
1056166754 9:83948088-83948110 GCTCCCCACATCTCAGACGATGG - Intronic
1056297289 9:85205733-85205755 GTTTCCCAGAGCTCTGTTGATGG + Intergenic
1056409556 9:86312235-86312257 GCTCCCCACATCTCAGACGATGG - Intronic
1056512696 9:87320773-87320795 GGTCCCCAGCCCCCAGTCCATGG - Intergenic
1056564448 9:87759280-87759302 GCTCCCCACATCTCAGACGATGG + Intergenic
1056624919 9:88245363-88245385 GCTCCCCACATCTCAGACGATGG + Intergenic
1056670826 9:88626097-88626119 GCTCCCCACATCTCAGACGATGG - Intergenic
1057087878 9:92227716-92227738 GCTCCCCACATCTCAGACGATGG + Intronic
1057155147 9:92831839-92831861 GCTCCCCACATCTCAGACGATGG + Intergenic
1057716226 9:97498313-97498335 GCTCCCCACATCTCAGACGATGG + Intergenic
1058018809 9:100067806-100067828 GCTCCCCACATCTCAGACGATGG - Intronic
1058390393 9:104489768-104489790 GCTCCCCACATCTCAGACGATGG + Intergenic
1058660000 9:107257888-107257910 GCTCCCCACATCTCAGACGATGG + Intergenic
1058661289 9:107271506-107271528 GCTCCCCACATCTCAGACGATGG - Intergenic
1058722473 9:107775971-107775993 GCTCCCCACATCTCAGACGATGG - Intergenic
1058972668 9:110097541-110097563 GCTCCCCACATCTCAGGCGATGG + Intronic
1059118157 9:111617642-111617664 GCTCCCCACATCTCAGACGATGG + Intergenic
1059120736 9:111640541-111640563 GCTCCCCACATCTCAGACGATGG - Intronic
1059210931 9:112514006-112514028 GCTCCCCACATCTCAGACGATGG - Intronic
1059707828 9:116840758-116840780 GCTCCCCACATCTCAGACGATGG + Intronic
1059879959 9:118678352-118678374 GCTCCCCACATCTCAGACGATGG + Intergenic
1060041481 9:120304914-120304936 GCTCCCCACATCTCAGACGATGG - Intergenic
1060064851 9:120495359-120495381 GCTCCCCACATCTCAGACGATGG - Intronic
1060369697 9:123057433-123057455 GCTCCCCACATCTCAGACGATGG + Intronic
1060625528 9:125108447-125108469 GCTCCCCACATCTCAGACGATGG - Intronic
1060669828 9:125459195-125459217 GCTCCCCACATCTCAGACGATGG + Intronic
1060682298 9:125577134-125577156 GCTCCCCACATCTCAGACGATGG - Intronic
1060687006 9:125623411-125623433 GCTCCCCACATCTCAGACGATGG - Intronic
1061143049 9:128780132-128780154 GCTCCCCACATCTCAGACGATGG - Intergenic
1061294537 9:129669751-129669773 GGTCCCCAGGGCTCAGCTCAGGG + Intronic
1061316849 9:129801751-129801773 CATCCCCAGTGCTCAGTCTAGGG + Intergenic
1061517515 9:131098216-131098238 GGTCCCCAGAGCCCTGTAGCTGG - Intronic
1061635787 9:131907833-131907855 GCTCCCCACATCTCAGACGATGG - Intronic
1061914814 9:133744626-133744648 GCTCCCCACATCTCAGACGATGG - Intergenic
1061984018 9:134118763-134118785 GCTCCCCACATCTCAGACGATGG + Intergenic
1203562589 Un_KI270744v1:71390-71412 GCTCCCCACATCTCAGACGATGG - Intergenic
1185584584 X:1235380-1235402 GCTCCCCACATCTCAGACGATGG - Intergenic
1186786853 X:12963262-12963284 GCTCCCCACATCTCAGACGATGG - Intergenic
1187183773 X:16965606-16965628 GCTCCCCACATCTCAGACGATGG + Intronic
1187212561 X:17245107-17245129 GCTCCCCACATCTCAGACGATGG + Intergenic
1187976623 X:24709770-24709792 GCTCCCCACATCTCAGACGATGG + Intronic
1188086376 X:25905831-25905853 GCTCCCCACATCTCAGACGATGG - Intergenic
1188368030 X:29334696-29334718 GCTCCCCACATCTCAGACGATGG + Intronic
1188477045 X:30602106-30602128 GCTCCCCACATCTCAGACGATGG - Intergenic
1189505816 X:41612275-41612297 GCTCCCCACATCTCAGACGATGG - Intronic
1189587303 X:42474364-42474386 GCTCCCCACATCTCAGACGATGG + Intergenic
1189825325 X:44911447-44911469 GCTCCCCACATCTCAGACGATGG + Intronic
1189955760 X:46275324-46275346 GCTCCCCACATCTCAGACGATGG - Intergenic
1190184493 X:48222364-48222386 GCTCCCCACATCTCAGACGATGG - Intronic
1190505315 X:51119914-51119936 GCTCCCCACATCTCAGACGATGG + Intergenic
1190680971 X:52827168-52827190 GCTCCCCACATCTCAGACGATGG + Intergenic
1190769578 X:53504023-53504045 GCTCCCCACATCTCAGACGATGG - Intergenic
1190778926 X:53578137-53578159 GCTCCCCACATCTCAGACGATGG - Intronic
1191618240 X:63190036-63190058 GCTCCCCACATCTCAGACGATGG + Intergenic
1191835321 X:65457057-65457079 GCTCCCCACATCTCAGACGATGG - Intronic
1192106950 X:68326478-68326500 GCTCCCCACATCTCAGACGATGG - Intronic
1192252095 X:69421970-69421992 GCTCCCCACATCTCAGACGATGG - Intergenic
1192352938 X:70372024-70372046 GCTCCCCACATCTCAGACGATGG + Intronic
1192464122 X:71341910-71341932 GCTCCCCACATCTCAGACGATGG + Intergenic
1192567658 X:72178559-72178581 GCTCCCCACATCTCAGACGATGG - Intergenic
1192610208 X:72559645-72559667 GCTCCCCACATCTCAGACGATGG - Intronic
1192621152 X:72681140-72681162 GCTCCCCACATCTCAGACGATGG - Intronic
1192739875 X:73882261-73882283 GCTCCCCACATCTCAGACGATGG - Intergenic
1192761263 X:74098345-74098367 GCTCCCCACATCTCAGACGATGG - Intergenic
1192813551 X:74569196-74569218 GCTCCCCACATCTCAGACGATGG + Intergenic
1192969941 X:76218601-76218623 GCTCCCCACATCTCAGACGATGG + Intergenic
1193132457 X:77932285-77932307 GCTCCCCACATCTCAGACGATGG + Intronic
1193164664 X:78265820-78265842 GCTCCCCACATCTCAGACGATGG + Intergenic
1193345301 X:80397310-80397332 GCTCCCCACATCTCAGACGATGG + Intronic
1193372301 X:80712724-80712746 GCTCCCCACATCTCAGACGATGG - Intronic
1193924321 X:87465925-87465947 GCTCCCCACATCTCAGACGATGG - Intergenic
1194035284 X:88863793-88863815 GGCCCCCACAGCTCAGTGGCAGG - Intergenic
1195009752 X:100723659-100723681 GCTCCCCACATCTCAGACGATGG - Intronic
1195036249 X:100973094-100973116 GCTCCCCACATCTCAGACGATGG + Intronic
1196404543 X:115347970-115347992 GCTCCCCACATCTCAGACGATGG + Intergenic
1196741349 X:119028661-119028683 GGCCCCCACAGCGCAGTGGAGGG + Intergenic
1196778496 X:119361971-119361993 GCTCCCCACATCTCAGACGATGG - Intergenic
1197241848 X:124128954-124128976 GCTCCCCACATCTCAGACGATGG + Intronic
1197452887 X:126641293-126641315 GCTCCCCACATCTCAGACGATGG - Intergenic
1197735881 X:129850397-129850419 GCTCCCCACATCTCAGACGATGG - Intergenic
1198600863 X:138283042-138283064 GCTCCCCACATCTCAGACGATGG + Intergenic
1200387455 X:155907939-155907961 GCTCCCCACATCTCAGACGATGG + Intronic
1200952948 Y:8918317-8918339 GCTCCCCACATCTCAGACGATGG + Intergenic