ID: 1167239444

View in Genome Browser
Species Human (GRCh38)
Location 19:48334354-48334376
Sequence CTCAGTCGAGGGATCTATTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 41
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 37}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167239432_1167239444 11 Left 1167239432 19:48334320-48334342 CCTACCCAGACCTCTTCAGTACG 0: 1
1: 0
2: 0
3: 4
4: 85
Right 1167239444 19:48334354-48334376 CTCAGTCGAGGGATCTATTTGGG 0: 1
1: 0
2: 0
3: 3
4: 37
1167239431_1167239444 30 Left 1167239431 19:48334301-48334323 CCTGAGGAGGCGGGGAGGTCCTA 0: 1
1: 0
2: 0
3: 6
4: 127
Right 1167239444 19:48334354-48334376 CTCAGTCGAGGGATCTATTTGGG 0: 1
1: 0
2: 0
3: 3
4: 37
1167239437_1167239444 1 Left 1167239437 19:48334330-48334352 CCTCTTCAGTACGGGTCCCCAGA 0: 1
1: 0
2: 1
3: 4
4: 72
Right 1167239444 19:48334354-48334376 CTCAGTCGAGGGATCTATTTGGG 0: 1
1: 0
2: 0
3: 3
4: 37
1167239436_1167239444 6 Left 1167239436 19:48334325-48334347 CCAGACCTCTTCAGTACGGGTCC 0: 1
1: 0
2: 0
3: 1
4: 51
Right 1167239444 19:48334354-48334376 CTCAGTCGAGGGATCTATTTGGG 0: 1
1: 0
2: 0
3: 3
4: 37
1167239435_1167239444 7 Left 1167239435 19:48334324-48334346 CCCAGACCTCTTCAGTACGGGTC 0: 1
1: 0
2: 0
3: 1
4: 37
Right 1167239444 19:48334354-48334376 CTCAGTCGAGGGATCTATTTGGG 0: 1
1: 0
2: 0
3: 3
4: 37

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167239444 Original CRISPR CTCAGTCGAGGGATCTATTT GGG Intronic
902922963 1:19678403-19678425 CTCAGTCTAGGACTCTAGTTGGG + Intronic
903818373 1:26081844-26081866 CTCGCTCCTGGGATCTATTTTGG - Intergenic
907635556 1:56131359-56131381 CACAGTCGAGGCCTCTGTTTTGG - Intergenic
908232584 1:62120706-62120728 CACAATTGAGGGTTCTATTTTGG + Intronic
916800778 1:168214261-168214283 CTTAGTCATGGGATATATTTGGG + Intergenic
1065021192 10:21502665-21502687 CTCAGTCCAGGAATCTGTTTAGG - Intergenic
1088744735 11:112795995-112796017 CTCAGGCCAGTGATCTCTTTGGG - Intergenic
1093912451 12:24763165-24763187 CTAAGTTAAGGGTTCTATTTAGG + Intergenic
1095844406 12:46730026-46730048 CACAGTGGAGGCCTCTATTTTGG - Intergenic
1110749956 13:79101501-79101523 CTGAGTCTAGGCATGTATTTAGG + Intergenic
1111977265 13:94979544-94979566 TTCAGTTGAGGCATATATTTGGG - Intergenic
1112704111 13:102046945-102046967 CTCAGCAGATGGATCTATTGGGG + Intronic
1115300928 14:31884197-31884219 CTCAGTCCAGAGATATACTTGGG - Intergenic
1124383355 15:29186180-29186202 CTCAGGAGAGGGTTCTGTTTAGG - Intronic
1132151185 15:99460757-99460779 CTCAGTAGAGGGATAGAATTAGG + Intergenic
1149180764 17:53933087-53933109 ATCAGTGAAGGCATCTATTTGGG + Intergenic
1160669816 19:355847-355869 CCCAGACGATGGATGTATTTTGG + Intergenic
1162354735 19:10175425-10175447 CCCTGTCTAGGGCTCTATTTAGG - Intronic
1167239444 19:48334354-48334376 CTCAGTCGAGGGATCTATTTGGG + Intronic
935901616 2:107799054-107799076 ATCATTAAAGGGATCTATTTGGG + Intergenic
939518699 2:143202326-143202348 CTTAGTAGAGGGATCTAGCTTGG + Intronic
946766269 2:223043970-223043992 TTCAGTCAACGGATCTTTTTTGG + Intergenic
948150027 2:235737832-235737854 CACAGTCTAGGGATCTAGTGAGG + Intronic
1178052341 21:28761923-28761945 CTCAGTCTAGTGATCTCATTGGG - Intergenic
953819168 3:46189361-46189383 CTGAGCTGAGGGATTTATTTAGG - Intronic
957733451 3:84175304-84175326 CCCAGTCTAGGGAAATATTTAGG - Intergenic
958655906 3:97003468-97003490 CTTAGTGGAGAGATCTATTTGGG + Intronic
959632942 3:108529578-108529600 CTCAGTCAAGAGACCTATGTTGG - Intergenic
962450427 3:135510948-135510970 CTGAGTCGATAAATCTATTTGGG - Intergenic
970813637 4:20126936-20126958 CTCAGTAAAGGGATGTATTAAGG + Intergenic
971992746 4:33921218-33921240 CTTAGGCGAGGTATCTATTAAGG + Intergenic
978137076 4:105275468-105275490 CTCAGCCGATGGATCTGTATAGG + Exonic
1001433789 5:171683771-171683793 CGCAGTCTAGGGATGTTTTTTGG - Intergenic
1017032472 6:150236427-150236449 CTCAGTCCTGGGCACTATTTTGG - Intronic
1017723486 6:157260841-157260863 CTCCGTCGCGGGACCTGTTTTGG + Intergenic
1041615884 8:59906623-59906645 ATCAGTAGAGGGTTCTATTTGGG - Intergenic
1047055379 8:121158509-121158531 CTCTGTAGAAGGACCTATTTTGG - Intergenic
1047531991 8:125685347-125685369 CCTACTCCAGGGATCTATTTAGG + Intergenic
1048950022 8:139489004-139489026 CTCAGTAGAGGTATCTACATTGG + Intergenic
1053125566 9:35578018-35578040 GTGAGTCGAGGGATCTTTTCTGG - Intergenic
1186401051 X:9260360-9260382 CTGAGTCTATAGATCTATTTGGG + Intergenic