ID: 1167239445

View in Genome Browser
Species Human (GRCh38)
Location 19:48334355-48334377
Sequence TCAGTCGAGGGATCTATTTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 46
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 40}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167239435_1167239445 8 Left 1167239435 19:48334324-48334346 CCCAGACCTCTTCAGTACGGGTC 0: 1
1: 0
2: 0
3: 1
4: 37
Right 1167239445 19:48334355-48334377 TCAGTCGAGGGATCTATTTGGGG 0: 1
1: 0
2: 0
3: 5
4: 40
1167239436_1167239445 7 Left 1167239436 19:48334325-48334347 CCAGACCTCTTCAGTACGGGTCC 0: 1
1: 0
2: 0
3: 1
4: 51
Right 1167239445 19:48334355-48334377 TCAGTCGAGGGATCTATTTGGGG 0: 1
1: 0
2: 0
3: 5
4: 40
1167239437_1167239445 2 Left 1167239437 19:48334330-48334352 CCTCTTCAGTACGGGTCCCCAGA 0: 1
1: 0
2: 1
3: 4
4: 72
Right 1167239445 19:48334355-48334377 TCAGTCGAGGGATCTATTTGGGG 0: 1
1: 0
2: 0
3: 5
4: 40
1167239432_1167239445 12 Left 1167239432 19:48334320-48334342 CCTACCCAGACCTCTTCAGTACG 0: 1
1: 0
2: 0
3: 4
4: 85
Right 1167239445 19:48334355-48334377 TCAGTCGAGGGATCTATTTGGGG 0: 1
1: 0
2: 0
3: 5
4: 40

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167239445 Original CRISPR TCAGTCGAGGGATCTATTTG GGG Intronic
901112133 1:6806427-6806449 TCAATCTGAGGATCTATTTGGGG + Intronic
911453962 1:98099828-98099850 TAAGTGGAAGTATCTATTTGGGG + Intergenic
916800779 1:168214262-168214284 TTAGTCATGGGATATATTTGGGG + Intergenic
917278053 1:173351914-173351936 TCTGTTCAGGGATCTTTTTGCGG - Intergenic
918536028 1:185575421-185575443 TAAGTAGAGGGATACATTTGTGG - Intergenic
921342775 1:214151063-214151085 GATGTCGAGAGATCTATTTGAGG + Intergenic
923785021 1:237058184-237058206 TCAGTCTAGGGATATATTGGAGG + Intronic
1064302581 10:14135821-14135843 TCAGTCCAATGTTCTATTTGCGG - Intronic
1065021191 10:21502664-21502686 TCAGTCCAGGAATCTGTTTAGGG - Intergenic
1072746792 10:97945733-97945755 TCAGTAGAGCACTCTATTTGTGG - Intronic
1074477888 10:113789280-113789302 TCAAGGGAGGGATATATTTGGGG + Intergenic
1078250195 11:9610394-9610416 TCAGGTTAGGGATTTATTTGAGG + Intergenic
1078386421 11:10896886-10896908 TCAGCAGAGGATTCTATTTGAGG - Intergenic
1078434054 11:11309927-11309949 TAAGTAGAGAGATCTATTTAAGG - Intronic
1088744734 11:112795994-112796016 TCAGGCCAGTGATCTCTTTGGGG - Intergenic
1091048764 11:132349288-132349310 ACAGTCAAGGGGTCCATTTGAGG - Intergenic
1122994125 14:105253454-105253476 TCAGGCGAGGGAATTCTTTGGGG - Intronic
1155065097 18:22262367-22262389 TCAGTCGGGGAATCTGATTGGGG - Intergenic
1161641038 19:5423537-5423559 TATGGCCAGGGATCTATTTGGGG + Intergenic
1167239445 19:48334355-48334377 TCAGTCGAGGGATCTATTTGGGG + Intronic
927302397 2:21530286-21530308 TCAATCTAGACATCTATTTGGGG + Intergenic
933231416 2:79811794-79811816 TCAATCTATGGATCTATCTGGGG + Intronic
941920253 2:170843005-170843027 TCAGTCTAGGCATCTCTTTTCGG + Intronic
945636530 2:212360079-212360101 TTTGTAAAGGGATCTATTTGTGG + Intronic
946510430 2:220349903-220349925 TCAGTTCAGGGATCCATTTGTGG + Intergenic
1169366803 20:4999180-4999202 ACAAACCAGGGATCTATTTGGGG - Intronic
955948501 3:64218696-64218718 GCAGCTGAGGGATTTATTTGAGG + Intronic
958655907 3:97003469-97003491 TTAGTGGAGAGATCTATTTGGGG + Intronic
964203588 3:154145816-154145838 CAATTTGAGGGATCTATTTGGGG + Intronic
964785132 3:160388034-160388056 ACAGGCCAGGGATTTATTTGTGG + Intronic
971719112 4:30221920-30221942 TCAGTAGAGAGGTGTATTTGGGG + Intergenic
974883561 4:67788165-67788187 TCAGTCCATGGATATTTTTGTGG + Intergenic
987974287 5:24992312-24992334 TCAGTCTGGGGAAATATTTGTGG - Intergenic
993859506 5:93118210-93118232 CCATTCGATGGATCTATTTGTGG + Intergenic
994408703 5:99379181-99379203 TCAAGCAAGGGATATATTTGGGG - Intergenic
1009706249 6:67256207-67256229 TCACTTGAGGGGTCCATTTGAGG - Intergenic
1022320842 7:29286324-29286346 TCAGAGGAGGAATCTTTTTGGGG + Intronic
1025991661 7:66502289-66502311 TCTGTAGAGGGATCTATTAGTGG + Intergenic
1041334044 8:56759688-56759710 TTAGTCGAGATTTCTATTTGAGG + Intergenic
1043032740 8:75157902-75157924 TCAGACAAGGGGTGTATTTGAGG - Intergenic
1053125565 9:35578017-35578039 TGAGTCGAGGGATCTTTTCTGGG - Intergenic
1056643824 9:88392862-88392884 TCTGTCTAGGGATGAATTTGGGG + Intronic
1059887454 9:118761964-118761986 TGAGAAGAGGGATATATTTGAGG - Intergenic
1197972434 X:132129569-132129591 TCAGTCCAGGTATGTATGTGAGG - Intergenic
1199351510 X:146807237-146807259 TCAGTATAGGTATATATTTGTGG - Intergenic
1199352397 X:146817256-146817278 TCAGTATAGGTATATATTTGTGG + Intergenic