ID: 1167239448

View in Genome Browser
Species Human (GRCh38)
Location 19:48334365-48334387
Sequence GATCTATTTGGGGATTTTTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 564
Summary {0: 1, 1: 0, 2: 3, 3: 31, 4: 529}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167239437_1167239448 12 Left 1167239437 19:48334330-48334352 CCTCTTCAGTACGGGTCCCCAGA 0: 1
1: 0
2: 1
3: 4
4: 72
Right 1167239448 19:48334365-48334387 GATCTATTTGGGGATTTTTGGGG 0: 1
1: 0
2: 3
3: 31
4: 529
1167239432_1167239448 22 Left 1167239432 19:48334320-48334342 CCTACCCAGACCTCTTCAGTACG 0: 1
1: 0
2: 0
3: 4
4: 85
Right 1167239448 19:48334365-48334387 GATCTATTTGGGGATTTTTGGGG 0: 1
1: 0
2: 3
3: 31
4: 529
1167239441_1167239448 -5 Left 1167239441 19:48334347-48334369 CCCAGAGCTCAGTCGAGGGATCT 0: 1
1: 0
2: 0
3: 14
4: 103
Right 1167239448 19:48334365-48334387 GATCTATTTGGGGATTTTTGGGG 0: 1
1: 0
2: 3
3: 31
4: 529
1167239436_1167239448 17 Left 1167239436 19:48334325-48334347 CCAGACCTCTTCAGTACGGGTCC 0: 1
1: 0
2: 0
3: 1
4: 51
Right 1167239448 19:48334365-48334387 GATCTATTTGGGGATTTTTGGGG 0: 1
1: 0
2: 3
3: 31
4: 529
1167239435_1167239448 18 Left 1167239435 19:48334324-48334346 CCCAGACCTCTTCAGTACGGGTC 0: 1
1: 0
2: 0
3: 1
4: 37
Right 1167239448 19:48334365-48334387 GATCTATTTGGGGATTTTTGGGG 0: 1
1: 0
2: 3
3: 31
4: 529
1167239442_1167239448 -6 Left 1167239442 19:48334348-48334370 CCAGAGCTCAGTCGAGGGATCTA 0: 1
1: 0
2: 1
3: 7
4: 65
Right 1167239448 19:48334365-48334387 GATCTATTTGGGGATTTTTGGGG 0: 1
1: 0
2: 3
3: 31
4: 529
1167239440_1167239448 -4 Left 1167239440 19:48334346-48334368 CCCCAGAGCTCAGTCGAGGGATC 0: 1
1: 0
2: 1
3: 8
4: 102
Right 1167239448 19:48334365-48334387 GATCTATTTGGGGATTTTTGGGG 0: 1
1: 0
2: 3
3: 31
4: 529

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167239448 Original CRISPR GATCTATTTGGGGATTTTTG GGG Intronic
902837400 1:19055683-19055705 GTTCTAATTGTGGCTTTTTGAGG - Intergenic
902969897 1:20040399-20040421 GATAAATTTGGGGCATTTTGTGG - Intronic
903622541 1:24708289-24708311 AATCTCTCTGGGGACTTTTGGGG - Intergenic
904854752 1:33489343-33489365 CATGTGTTTGGGGATGTTTGGGG - Intronic
905112612 1:35607623-35607645 GTTCTATTTGTAGTTTTTTGAGG - Intronic
905202765 1:36324817-36324839 GATGTATTTGAGTATTGTTGTGG + Intronic
905347456 1:37320599-37320621 GTTCTATTTTGAGTTTTTTGAGG - Intergenic
906478980 1:46188154-46188176 TCTCTATCTGGGCATTTTTGTGG - Intergenic
906906399 1:49898559-49898581 GCTCTATTTTTAGATTTTTGAGG - Intronic
907204955 1:52761727-52761749 GTTCTATTTGTAGTTTTTTGAGG + Intronic
907633015 1:56103273-56103295 GTTCTATTTGTAGTTTTTTGAGG + Intergenic
907963333 1:59304538-59304560 TAGCTATTTGGAGTTTTTTGTGG + Intronic
908231293 1:62107440-62107462 CTTCGCTTTGGGGATTTTTGTGG - Intronic
908343601 1:63208015-63208037 GCTCTATTTGCAGTTTTTTGAGG + Intergenic
908486870 1:64603589-64603611 AATCTGTTTTGGGATTTTTCTGG + Intronic
909002096 1:70230469-70230491 AATGGATTTGGGGATTTTTTAGG + Intronic
909124098 1:71643152-71643174 CAAATATTTGGGGATTTGTGTGG - Intronic
909423709 1:75496122-75496144 GGGCTATTTGGGGTTGTTTGTGG - Intronic
911001716 1:93172700-93172722 GTTGTATTTGTGGTTTTTTGAGG - Intronic
911043416 1:93609553-93609575 TATTTATTTAGGTATTTTTGTGG - Intronic
911279794 1:95910037-95910059 TAGCTATTTGGGGTCTTTTGTGG + Intergenic
911707175 1:101026786-101026808 GATCCATTTTGAGTTTTTTGGGG - Intergenic
911976003 1:104495820-104495842 GTTCTATTTTTGGCTTTTTGAGG - Intergenic
912012478 1:104985156-104985178 TGTCTATTTGGGGTCTTTTGTGG + Intergenic
912046176 1:105460913-105460935 AATCTATTTGAAGATTTTTTTGG + Intergenic
912139915 1:106711799-106711821 GTTCTATTTTAGGTTTTTTGAGG - Intergenic
913381201 1:118212264-118212286 GTTCTATTTTTAGATTTTTGAGG + Intergenic
913929778 1:124941590-124941612 GATCTGCTTGTGGATATTTGGGG - Intergenic
913929870 1:124943297-124943319 GATCTGCTTGTGGATATTTGGGG - Intergenic
913929906 1:124943978-124944000 GATCTGCTTGTGGATATTTGGGG - Intergenic
913930072 1:124947383-124947405 GATCTGCTTGTGGATATTTGGGG - Intergenic
913930219 1:124950785-124950807 GATCTGCTTGTGGATATTTGGGG - Intergenic
913936604 1:125059725-125059747 GAGATATTTGGATATTTTTGAGG + Intergenic
913936631 1:125060237-125060259 TGTATATTTGGAGATTTTTGAGG + Intergenic
915160848 1:153919530-153919552 GTCCTGTTTGGGGATTTTGGTGG - Intronic
916638831 1:166704330-166704352 ATTCTATTTGGAGTTTTTTGAGG - Intergenic
916973269 1:170047661-170047683 GATCTATATGAGGAATTTTGAGG + Intronic
917475928 1:175369059-175369081 GCTCTTTTTGGGGCTTTGTGTGG + Intronic
917917443 1:179717162-179717184 TAGCTATTTGGGGTCTTTTGTGG + Intergenic
918061940 1:181069482-181069504 CATTTGTTTGGGGATTTTTGGGG + Intergenic
918770242 1:188547996-188548018 GTTCTATTTTTAGATTTTTGAGG + Intergenic
919412936 1:197269047-197269069 CTTCTATTTGGGGAAGTTTGTGG - Intronic
920596237 1:207273285-207273307 GTTCTATTTTTAGATTTTTGAGG + Intergenic
920618737 1:207522900-207522922 AATGTATTTAGGGGTTTTTGTGG + Intronic
920834545 1:209497294-209497316 GTTCTATTTGTAGTTTTTTGAGG + Intergenic
921138086 1:212280614-212280636 TGGCTATTTGGGAATTTTTGTGG + Intergenic
921243446 1:213210957-213210979 GATGTATTTGGTGCTTTTTAGGG + Intronic
922434262 1:225587788-225587810 GATATATTTGTCTATTTTTGAGG - Intronic
922556880 1:226539307-226539329 GCCCTATTTGGTGATTTTTGGGG + Intergenic
923796072 1:237156982-237157004 GTTCTATTTTTGGTTTTTTGAGG - Intronic
924108146 1:240670103-240670125 GTTCTATTTTGAGTTTTTTGAGG + Intergenic
924427063 1:243961459-243961481 GATGTATTTGGAGACTTTTGGGG + Intergenic
1062903709 10:1165678-1165700 GTTCTATTTGTGTTTTTTTGAGG + Intergenic
1064311459 10:14215689-14215711 GTTCTATTTGAGGATCTTGGGGG + Intronic
1064610480 10:17094894-17094916 TAGCTATTTGGGGTCTTTTGTGG - Intronic
1066968099 10:42288765-42288787 TTGCTATTTGGGGTTTTTTGTGG + Intergenic
1068662878 10:59641443-59641465 GTTCTATTTGCAGTTTTTTGAGG + Intergenic
1068835604 10:61549023-61549045 GTTCTATTTTTAGATTTTTGAGG + Intergenic
1069076952 10:64047819-64047841 TAGCTATTTGGGAACTTTTGTGG - Intergenic
1069229497 10:65991229-65991251 TGGCTATTTGGGGACTTTTGTGG + Intronic
1069409094 10:68133900-68133922 GATATATTTGGTGATTGCTGGGG - Intronic
1070046437 10:72841940-72841962 GATTTACTTGGGGATATTTCGGG + Intronic
1070060184 10:72974652-72974674 GTTCTATTTGTGGTTTTTTGAGG + Intergenic
1070192586 10:74126085-74126107 AATCTATTTTGTGATTTGTGGGG - Intronic
1070317368 10:75327643-75327665 GTTCTATTTGTAGTTTTTTGAGG + Intergenic
1070508191 10:77135441-77135463 GTTCTATTTTTGGGTTTTTGTGG - Intronic
1070822234 10:79365642-79365664 TATTTTGTTGGGGATTTTTGTGG - Intergenic
1071451704 10:85798415-85798437 GTTCTATTTGTAGTTTTTTGAGG + Intronic
1072366657 10:94717924-94717946 TGGCTATTTGGGTATTTTTGTGG + Intronic
1074347996 10:112707127-112707149 GAACCATTGGGGGTTTTTTGTGG + Intronic
1074626800 10:115198975-115198997 TAGCTCTTTGGGGCTTTTTGTGG + Intronic
1075859860 10:125666075-125666097 GATCTAAGTGGGGTTTTTTTTGG + Intronic
1075990267 10:126831875-126831897 GTTCTATTTGTAGCTTTTTGAGG - Intergenic
1078167993 11:8907049-8907071 GCTGTATTTGGGACTTTTTGAGG - Intronic
1079342654 11:19625597-19625619 GTTCTATTTGTAGTTTTTTGAGG + Intronic
1079572299 11:21958970-21958992 GCTCTATTTTTAGATTTTTGAGG - Intergenic
1079691916 11:23428891-23428913 GCTCTATTTGGGGTCTTTTATGG + Intergenic
1080706493 11:34700162-34700184 GCTCTATTTTTAGATTTTTGAGG + Intergenic
1081209517 11:40314494-40314516 GTTCTATTTGTAGATTTTTGAGG - Intronic
1081317087 11:41643219-41643241 CAACTATTTGGGAATTTTTGTGG + Intergenic
1081369317 11:42279941-42279963 TGGCTATTTGGGCATTTTTGTGG - Intergenic
1081422634 11:42889343-42889365 GCTCTATTTGTAGTTTTTTGAGG - Intergenic
1082902456 11:58270137-58270159 GATCAAATTGGCCATTTTTGAGG - Intergenic
1085865425 11:80285522-80285544 GAGGTATTTGAGTATTTTTGTGG - Intergenic
1086328002 11:85724397-85724419 GATTTATTGGTAGATTTTTGTGG - Intronic
1086577034 11:88350238-88350260 CATCTATGTATGGATTTTTGTGG + Intergenic
1086958182 11:92955638-92955660 GCTCTATTTGCAGTTTTTTGAGG - Intergenic
1086989847 11:93290893-93290915 GATCTTTTTGTGGATATTTTAGG + Intergenic
1087265604 11:96057519-96057541 GCTCTATTAGGAGCTTTTTGAGG - Intronic
1087551591 11:99657334-99657356 CATCTATTTTGGGAATTTGGGGG + Intronic
1088056435 11:105585578-105585600 GTTCTATTTGTAGTTTTTTGAGG + Intergenic
1088323443 11:108577287-108577309 GTTCTATTTGTAGTTTTTTGAGG + Intronic
1088546149 11:110961081-110961103 GATCTGTTTGGGAAATTTTAGGG - Intergenic
1088602084 11:111489379-111489401 GTTCTATTTGTAGTTTTTTGAGG - Intronic
1091258014 11:134208137-134208159 GATATTTTTGGGGATGCTTGGGG - Intronic
1091836915 12:3592530-3592552 CCTCTATTTGCGGAGTTTTGAGG - Intronic
1093566344 12:20609571-20609593 TGGCTATTTGGGGTTTTTTGTGG - Intronic
1093606247 12:21092665-21092687 GATCTATTTTTAAATTTTTGAGG + Intronic
1093620528 12:21284007-21284029 GCTCTATTTTGAGTTTTTTGAGG - Intronic
1093848536 12:24006800-24006822 GACCTATTTGGGGCTATTTGAGG - Intergenic
1094019934 12:25903408-25903430 GTTTCATTTGGGGAGTTTTGGGG - Intergenic
1094749578 12:33390315-33390337 GATCTAGTTGGGGATTCATGAGG + Intronic
1095056684 12:37614467-37614489 TGGCTATTTGGAGATTTTTGAGG + Intergenic
1095900382 12:47321690-47321712 GTTCTATTTGTAGTTTTTTGAGG - Intergenic
1096135437 12:49196258-49196280 GATAGATTTGGGGACTTTTAGGG + Intronic
1097646026 12:62235720-62235742 GATCTATTTTAGGTTTTTGGAGG + Intronic
1097756514 12:63412965-63412987 GCTCTATTTTTAGATTTTTGAGG + Intergenic
1097931887 12:65196329-65196351 GTTCTGTTTGGGGTTTTTTTTGG - Intronic
1098409102 12:70160493-70160515 TAGCTATTTGGGGTCTTTTGAGG - Intergenic
1098797228 12:74905380-74905402 CATATATTTGGTGATTTTTCAGG - Intergenic
1099732944 12:86527466-86527488 TGTCTATTTGGGGTATTTTGTGG + Intronic
1101395668 12:104344823-104344845 GCTCTATTTGCAGATTTTTGAGG - Intronic
1101499745 12:105291826-105291848 GATCTATTTTTAGTTTTTTGAGG - Intronic
1101859492 12:108471500-108471522 GATCTGATTTGGGTTTTTTGGGG + Intergenic
1101895941 12:108756817-108756839 TATCTATTTGGGATGTTTTGAGG - Intergenic
1102629991 12:114269642-114269664 CAGCTACTTTGGGATTTTTGTGG - Intergenic
1102985466 12:117274408-117274430 GTTCTATTTGCAGTTTTTTGAGG - Intronic
1103513758 12:121493227-121493249 GATTTTTTTGGGGTTTTTTTTGG - Intronic
1103839315 12:123849898-123849920 GTTCTTTTGAGGGATTTTTGGGG + Intronic
1104459228 12:128940970-128940992 GATCTAATTAGGGGTTATTGGGG - Intronic
1104848399 12:131858605-131858627 GTTGTATTTGGAGATTTGTGAGG + Intergenic
1105460013 13:20575913-20575935 GATCTATTTTTAGTTTTTTGAGG + Intronic
1105831479 13:24166068-24166090 GGCCTATTTAGGGATTTATGTGG + Intronic
1105860807 13:24410603-24410625 GTTCTATTTTTGGTTTTTTGAGG + Intergenic
1105922770 13:24981329-24981351 GTTCTATTTTTGGTTTTTTGAGG - Intergenic
1106462388 13:29982607-29982629 GTTCTATTTGTAGGTTTTTGAGG + Intergenic
1106857025 13:33864611-33864633 GATCTGTTTGGAGAGTTATGGGG + Intronic
1107008498 13:35643108-35643130 GATATATTTGGAAATTTTTAAGG + Intronic
1107318748 13:39162962-39162984 GCTCTATTTTCAGATTTTTGAGG + Intergenic
1108902255 13:55425832-55425854 GTTCTATTTGGTGTATTTTGTGG - Intergenic
1110261427 13:73489723-73489745 GAACTAGGTGGTGATTTTTGCGG + Intergenic
1110477762 13:75937634-75937656 TATCTTTTTGTGGATTTATGGGG + Intergenic
1111128863 13:83948507-83948529 GGTCTATATGTGGCTTTTTGTGG - Intergenic
1111142724 13:84142284-84142306 GATCTATTTGTAGTTTTCTGAGG + Intergenic
1111310985 13:86485685-86485707 GTTCTATTTGTAGTTTTTTGAGG - Intergenic
1111339687 13:86867561-86867583 GAAATATTTGAGGATTTTTTTGG + Intergenic
1111356154 13:87105467-87105489 GATCTATTTATAGTTTTTTGAGG - Intergenic
1111426385 13:88089623-88089645 GCTCTATTTTCAGATTTTTGAGG + Intergenic
1111538190 13:89631949-89631971 TAATTATTTGAGGATTTTTGAGG + Intergenic
1112009164 13:95279688-95279710 GTGCTTTTTGTGGATTTTTGTGG + Intronic
1112814759 13:103259268-103259290 TTTCTATTTGGGGTCTTTTGTGG + Intergenic
1113498144 13:110749803-110749825 GATGTATTCGAGGAGTTTTGGGG + Intergenic
1114335680 14:21687278-21687300 GAACTATTTGGTTATTTTTATGG + Intergenic
1114576296 14:23716934-23716956 GAGCTATTTGAGGGTTTTTTGGG - Intergenic
1115139092 14:30147156-30147178 AATCTATTTGGGAACTTTTGAGG - Intronic
1115413960 14:33109628-33109650 GAGCAATTTGGGGCTTCTTGTGG + Intronic
1115930542 14:38487413-38487435 GCTCTATTTCTAGATTTTTGAGG - Intergenic
1115956150 14:38782043-38782065 TATCTATCTGGGGTCTTTTGTGG - Intergenic
1116236695 14:42287335-42287357 GATTTATTTATGGATATTTGGGG + Intergenic
1116253157 14:42514079-42514101 GATCTCTGTAGGGCTTTTTGAGG - Intergenic
1116386020 14:44330884-44330906 TGTTTATTTGGTGATTTTTGAGG - Intergenic
1116548452 14:46202291-46202313 GATCTATTTTTAGTTTTTTGAGG - Intergenic
1116650108 14:47579573-47579595 GATATATTATGGGATTTTAGCGG - Intronic
1118103505 14:62631681-62631703 GATAAATTTGGGGATGTTGGTGG + Intergenic
1118128131 14:62932068-62932090 GATCTAATTGGGTTATTTTGTGG - Intronic
1118263645 14:64271948-64271970 GCTCTATTTGTAGTTTTTTGAGG + Intronic
1118360201 14:65049886-65049908 AATGTGTATGGGGATTTTTGGGG - Intronic
1118506421 14:66417747-66417769 GATCTATTTATGATTTTTTGAGG - Intergenic
1118556456 14:67028412-67028434 GTTCTATTTGTAGTTTTTTGAGG + Intronic
1119121386 14:72082122-72082144 GGGCTATTTGGGGTCTTTTGTGG + Intronic
1119990594 14:79192457-79192479 GAAGTATTTGGGGATATTTTAGG + Intronic
1121153979 14:91665867-91665889 TATCCGTTTGGGGGTTTTTGTGG - Intronic
1121386514 14:93532025-93532047 GATCTATTTCATGATTTCTGAGG + Intronic
1123179175 14:106451976-106451998 GTTCTATTTGTAGTTTTTTGAGG + Intergenic
1123505436 15:20938631-20938653 GTTCTATTTGCAGTTTTTTGAGG + Intergenic
1123562675 15:21512341-21512363 GTTCTATTTGCAGTTTTTTGAGG + Intergenic
1123598920 15:21949625-21949647 GTTCTATTTGCAGTTTTTTGAGG + Intergenic
1123663103 15:22583113-22583135 GATTTATTTGTGTATTTTGGTGG - Intergenic
1123714528 15:23016777-23016799 GTTCTATTTGTAGTTTTTTGAGG - Intronic
1124055832 15:26240261-26240283 GTTCTATTTGTAGTTTTTTGAGG + Intergenic
1124091331 15:26605358-26605380 GATCTATTTTTAGTTTTTTGAGG - Intronic
1124259179 15:28172413-28172435 GATTTATTTGTGGATTTTGGTGG - Intronic
1124316905 15:28677416-28677438 GATTTATTTGTGTATTTTGGTGG - Intergenic
1125837113 15:42762255-42762277 GTTCTATTTGTAGTTTTTTGAGG - Intronic
1126250265 15:46559293-46559315 GCTCTATTTTTAGATTTTTGAGG + Intergenic
1126919271 15:53502803-53502825 GCTCTATTTGGGGTTTTGAGGGG + Intergenic
1126927619 15:53608098-53608120 GATCTATTTTTAGTTTTTTGAGG - Intronic
1126975315 15:54171700-54171722 GCTCTATTTCTAGATTTTTGAGG - Intronic
1127406347 15:58651792-58651814 GTTCTATTTGTAGTTTTTTGAGG + Intronic
1127491069 15:59464362-59464384 GTTCTATTTGTAGTTTTTTGAGG + Intronic
1128359543 15:66952049-66952071 GTTCTATTTGTAGGTTTTTGAGG + Intergenic
1128816511 15:70613567-70613589 GAGAAACTTGGGGATTTTTGTGG - Intergenic
1128845986 15:70895172-70895194 TACATATTTGGGGTTTTTTGTGG + Intronic
1129511442 15:76126155-76126177 GTTCTATTTTGAGTTTTTTGAGG - Intronic
1129597774 15:76978202-76978224 GTTCTATTTTTAGATTTTTGAGG + Intergenic
1130124933 15:81085299-81085321 GAACTATTTGGGAAGTTCTGGGG - Intronic
1131323031 15:91414497-91414519 GATCTATTTTTAGTTTTTTGAGG + Intergenic
1131444338 15:92484213-92484235 GGTCTATTTTTGGTTTTTTGAGG - Intronic
1131649777 15:94386353-94386375 AAGCTATCTGTGGATTTTTGTGG + Intronic
1132037261 15:98495066-98495088 GTTCTATTTTTAGATTTTTGAGG + Intronic
1132219912 15:100097571-100097593 GATGTCTTTGGGGAGTTGTGGGG - Intronic
1202971025 15_KI270727v1_random:239474-239496 GTTCTATTTGCAGTTTTTTGAGG + Intergenic
1133828962 16:9304280-9304302 GAACTGTTTGGTCATTTTTGTGG - Intergenic
1134296447 16:12950573-12950595 GATCTATTTTTCGTTTTTTGAGG - Intronic
1134602525 16:15544740-15544762 GGGCTATTGGGTGATTTTTGTGG - Intronic
1134758448 16:16691016-16691038 AATCAATTTCAGGATTTTTGTGG - Intergenic
1134987624 16:18668162-18668184 AATCAATTTCAGGATTTTTGTGG + Intergenic
1135677244 16:24426491-24426513 GCTCTATTTTTAGATTTTTGAGG + Intergenic
1136651343 16:31674283-31674305 TGTCTATTTGGGGTCTTTTGTGG + Intergenic
1137077661 16:35994046-35994068 GGGCTATTTGGGGGGTTTTGAGG + Intergenic
1137658052 16:50178005-50178027 TATGTATTTTGGGATTTTTCTGG + Intronic
1137666811 16:50254865-50254887 TAGCTATTTGGGGTCTTTTGTGG - Intronic
1137948021 16:52752908-52752930 GAAGTATTTGGGGAGCTTTGAGG - Intergenic
1138630219 16:58288044-58288066 GATCTATTTAGGATTTGTTGAGG - Intronic
1138849964 16:60615885-60615907 GATCCATTTGGTCAGTTTTGGGG + Intergenic
1139322863 16:66129567-66129589 TATCTTTTTGGGGAATTTTATGG - Intergenic
1140421047 16:74819141-74819163 GCTCTACTTGTGGTTTTTTGAGG + Intergenic
1140605593 16:76532933-76532955 GTTCTATTTGTAGTTTTTTGAGG - Intronic
1140889364 16:79271990-79272012 GACCTATTTGGAGAATTTGGAGG - Intergenic
1141709255 16:85688563-85688585 GATCTGTTTGGGGGCTTTTTTGG - Intronic
1143441021 17:6974124-6974146 GTTCTCTTTGGGGTTATTTGTGG - Intronic
1143447918 17:7019719-7019741 GATTTTTTTGGGATTTTTTGGGG - Intergenic
1144626021 17:16844876-16844898 GCCTTATTTGGGGATTTTTCTGG - Intergenic
1144880413 17:18427844-18427866 GCCTTATTTGGGGATTTTTCTGG + Intergenic
1145026307 17:19470425-19470447 GCTCTATTTCTGGATTTTTGAGG + Intergenic
1145151822 17:20516543-20516565 GCCTTATTTGGGGATTTTTCTGG - Intergenic
1145775966 17:27528919-27528941 GTTTTGTTTTGGGATTTTTGTGG - Intronic
1146163191 17:30570815-30570837 GCCTTATTTGGGGATTTTTCTGG - Intergenic
1146238764 17:31193984-31194006 GTTCTATTTGCAGTTTTTTGAGG - Intronic
1147285430 17:39399200-39399222 GATCTCATTGAGAATTTTTGTGG - Intronic
1147580173 17:41623574-41623596 GCCTTATTTGGGGATTTTTCTGG - Intronic
1149146022 17:53493737-53493759 GTTCTATTTGTAGATTTTTGAGG - Intergenic
1149217347 17:54372866-54372888 GTTCAATTTGGGTAATTTTGGGG + Intergenic
1149231698 17:54542181-54542203 GCTCTATTTTTGGTTTTTTGAGG - Intergenic
1149722342 17:58858873-58858895 GTTCTATTTGTAGCTTTTTGAGG + Intronic
1150871403 17:68915721-68915743 GCTCTATTTTTAGATTTTTGTGG - Intronic
1151000861 17:70374468-70374490 GAACTATTTGGAGAATATTGGGG - Intergenic
1152194752 17:78911008-78911030 GTTCTATTTGTAGTTTTTTGAGG + Intronic
1153331342 18:3878686-3878708 GATCTATTCAGGGTTTTGTGGGG - Intronic
1153369839 18:4302690-4302712 GGCTTATTTGGGAATTTTTGTGG + Intronic
1153706424 18:7750071-7750093 TATGTATTTGTGGATTTTTATGG - Intronic
1153878063 18:9394001-9394023 GTTCTATTTGTGGTTTTTTGAGG - Intronic
1155763343 18:29593786-29593808 TAGCTATTTGGGGTCTTTTGAGG - Intergenic
1156292359 18:35759068-35759090 GTTCTATTTTTGGTTTTTTGAGG - Intergenic
1156993386 18:43437636-43437658 GTTCTATTTTTAGATTTTTGAGG + Intergenic
1157082367 18:44539665-44539687 GATTTATTTTTGGAATTTTGGGG - Intergenic
1157143783 18:45139541-45139563 GTTCTATTTGCAGTTTTTTGAGG + Intergenic
1157280355 18:46342880-46342902 CATCTATTTGTTGTTTTTTGGGG + Intronic
1157405178 18:47416823-47416845 GCTTTATTTGTGGATTTTTTGGG + Intergenic
1158949596 18:62480930-62480952 TATCTATTTGAGGATATTTAAGG - Intergenic
1159041626 18:63328771-63328793 AACATATTTGGGGATTTTTATGG + Exonic
1159758647 18:72397328-72397350 GATTTATTTGGGGTTTTTGGTGG - Intergenic
1160361107 18:78280023-78280045 GATCTTGCTGAGGATTTTTGTGG + Intergenic
1160609405 18:80073757-80073779 GATCCAGTTGGACATTTTTGTGG + Intronic
1163907869 19:20162845-20162867 GCCCTATTTGGTGAGTTTTGGGG - Intergenic
1164347863 19:27289012-27289034 GGTGTATTTGGGGCGTTTTGAGG + Intergenic
1164565938 19:29326109-29326131 TTTTTATTTGGGGATTTTTCTGG + Intergenic
1164892407 19:31835867-31835889 GCTCTATTTTTAGATTTTTGAGG - Intergenic
1165006774 19:32813881-32813903 GACTTATTTGGGGATTTGTTAGG + Intronic
1166586207 19:43951502-43951524 GCCCTATTTGGGGGTTTCTGGGG + Intronic
1167239448 19:48334365-48334387 GATCTATTTGGGGATTTTTGGGG + Intronic
1168363639 19:55765381-55765403 TAGCTATTTGGGGTCTTTTGTGG + Intergenic
925521365 2:4749410-4749432 GATGAATCTGGGGTTTTTTGTGG + Intergenic
925801044 2:7600527-7600549 GCTCTTTGTGGGGATTTTTTTGG - Intergenic
926234948 2:11033760-11033782 TATCTATGTTGGCATTTTTGAGG - Intergenic
926852556 2:17215539-17215561 TATCTAATTGTAGATTTTTGTGG + Intergenic
928271886 2:29863722-29863744 GATCTATTTTTATATTTTTGAGG - Intronic
928551437 2:32374941-32374963 GATCCATTTGGGGAGTGTTGAGG + Intronic
929292964 2:40214343-40214365 GATATATTTGGGGAGAGTTGCGG - Intronic
930251628 2:49041236-49041258 TATGTATTTGAGTATTTTTGTGG + Intronic
931031684 2:58182517-58182539 GATAAATTTTGGAATTTTTGAGG + Intronic
931660027 2:64551550-64551572 GATGAATTTGGGGAATTTGGTGG + Exonic
932786102 2:74605154-74605176 GATCTTTTTGGAGAGTTTTTTGG + Intronic
933014260 2:77104397-77104419 AAGCTATTTGGGGATTCTGGTGG - Intronic
933807119 2:86007537-86007559 GTTCTATTTGTAGTTTTTTGAGG - Intergenic
935916300 2:107954544-107954566 TTTCTTTTGGGGGATTTTTGAGG + Intergenic
936406158 2:112205855-112205877 AAATTATTTGGGGATTTTTATGG + Intergenic
936588344 2:113778716-113778738 TGGCTATTTGGGGTTTTTTGTGG - Intergenic
936603244 2:113921012-113921034 GTTCTATTTGTGGTTTTTTGAGG + Intronic
936718838 2:115224203-115224225 GATCTAATTGGGGATTTGAATGG + Intronic
937406762 2:121636927-121636949 GATCTATGTGGATATATTTGGGG - Intronic
937745316 2:125405211-125405233 GTTCTATTTGTAGCTTTTTGAGG + Intergenic
938137035 2:128767891-128767913 AATGTATTTGGGGCTTTGTGTGG + Intergenic
938677346 2:133651610-133651632 GTTCTATTTTTTGATTTTTGAGG - Intergenic
939212086 2:139188737-139188759 TGGCTATTTGGGGAATTTTGTGG + Intergenic
939369336 2:141277908-141277930 ATTTTATTTTGGGATTTTTGAGG - Intronic
939703695 2:145425564-145425586 TAGCTATTTGGGGTCTTTTGTGG - Intergenic
940082121 2:149814988-149815010 GATCTCTTTGAGGTTTTGTGAGG - Intergenic
940455940 2:153900369-153900391 GAACTGTTTGTGTATTTTTGTGG + Intronic
940634090 2:156276247-156276269 GCTCCATTTGGAGATTTTTTTGG - Intergenic
940796133 2:158081413-158081435 GATCTATTTTTAGTTTTTTGAGG - Intronic
940923681 2:159339514-159339536 GTTCTATTTTTAGATTTTTGAGG - Intronic
941131455 2:161654848-161654870 TAGCTATTTGGGGTTCTTTGTGG + Intronic
941256310 2:163235754-163235776 TGGCTATTTGGGGTTTTTTGTGG + Intergenic
941275297 2:163483409-163483431 GATTAAATTGGGGATTTTGGGGG - Intergenic
941277289 2:163505585-163505607 GTTCTATTTTTAGATTTTTGAGG + Intergenic
942943563 2:181648177-181648199 AATCTAATTGGGAATCTTTGTGG - Intronic
943055462 2:182972521-182972543 GATCTATTTTCAAATTTTTGAGG - Intronic
944102333 2:196041221-196041243 GGGCTATTTGGGGTCTTTTGTGG - Intronic
944754640 2:202747984-202748006 GCTCTATTTGGGGACTTTTGTGG - Intronic
945378445 2:209109027-209109049 GATCTATTTTTAGTTTTTTGAGG - Intergenic
945464829 2:210156947-210156969 AATCTATTTGCTTATTTTTGAGG - Intronic
945713888 2:213334400-213334422 GATCTATTTTTAGATTTTTGAGG - Intronic
945915010 2:215694426-215694448 GATCTATTTTTAGTTTTTTGTGG - Intergenic
947377631 2:229512646-229512668 GTTCTTTTTGGTGATTTGTGAGG - Intronic
1169363584 20:4972542-4972564 AAGCTATGTGGGGGTTTTTGGGG + Intronic
1169584669 20:7067704-7067726 AATCTTGTTGGGGTTTTTTGTGG - Intergenic
1169902055 20:10562957-10562979 ATTCTATTTGTAGATTTTTGAGG + Intronic
1170146261 20:13178351-13178373 GTTCTATTTGAGGTTTTTTGGGG - Intergenic
1170176919 20:13481465-13481487 GCTCTATTTTTAGATTTTTGAGG + Intronic
1171335337 20:24380514-24380536 GCTCTATTTGCAGTTTTTTGAGG - Intergenic
1173410854 20:42808338-42808360 GCTCTGTCTGGGCATTTTTGAGG + Intronic
1175023893 20:55880975-55880997 GATCCTTTTGAGGATCTTTGAGG - Intergenic
1175701788 20:61143737-61143759 GATCTATTTTTAGTTTTTTGAGG + Intergenic
1176042986 20:63075479-63075501 ATTCTATTTGGAGTTTTTTGAGG + Intergenic
1177209900 21:18058297-18058319 GTTCTATTTCTGGTTTTTTGAGG - Intronic
1177390450 21:20461935-20461957 GATCTATTTTGAATTTTTTGTGG - Intergenic
1177569460 21:22869456-22869478 GCTCTATTTTTAGATTTTTGAGG + Intergenic
1178080652 21:29060720-29060742 GAGCTATGTGAGGCTTTTTGTGG - Intronic
1178328005 21:31660578-31660600 GACCCTTTTGGGGATTTTTGAGG + Intronic
1178515511 21:33243527-33243549 CATCTATGTGGGCATTTTTTTGG + Intronic
1178986740 21:37311286-37311308 GATCTATTTTTAGTTTTTTGAGG + Intergenic
1179240405 21:39585044-39585066 TAGCTATTTGGGGTCTTTTGTGG - Intronic
1180284893 22:10735973-10735995 GATATATTTTGGGAGATTTGAGG - Intergenic
1180645235 22:17333324-17333346 GAACTAGTTGGGGAGGTTTGGGG - Intergenic
1181894782 22:26097641-26097663 GCTCTATTTGTGTTTTTTTGAGG + Intergenic
1182219142 22:28743995-28744017 CACATATTTGGGGATTATTGGGG - Intronic
1182971919 22:34587148-34587170 GTTCTATTTGTAGTTTTTTGTGG + Intergenic
1184018437 22:41803259-41803281 AAGGTATTTGGGGTTTTTTGAGG - Intronic
1184305369 22:43596769-43596791 TAGCTATTTGGGGTCTTTTGTGG - Intronic
1184505521 22:44898949-44898971 GATCTATTTGGGTCTATTTCTGG + Intronic
949374329 3:3371009-3371031 GATCTACTTGTGGATTCTGGAGG + Intergenic
949617343 3:5768459-5768481 GAGCTATTTGGGGAAGTTCGTGG - Intergenic
949843345 3:8344291-8344313 GTTCTATTTGTAGTTTTTTGAGG + Intergenic
950907938 3:16556069-16556091 GAATTAGTTGGGCATTTTTGTGG - Intergenic
951480438 3:23155890-23155912 GCTCTATTTGTAGTTTTTTGAGG - Intergenic
951778561 3:26337759-26337781 GCTCTATTTTTAGATTTTTGAGG + Intergenic
951993692 3:28703833-28703855 GATTTATATGTAGATTTTTGGGG + Intergenic
952608376 3:35177808-35177830 AATCTATTTGGGAATCTTTGGGG + Intergenic
954487299 3:50864910-50864932 TAGCTATTTGGGGTCTTTTGTGG + Intronic
955384160 3:58465574-58465596 TATCTATTTTAGGAATTTTGAGG + Intergenic
956387959 3:68741117-68741139 TAGCTATTTGGGGTCTTTTGTGG + Intronic
957710436 3:83850937-83850959 TATCTCCCTGGGGATTTTTGTGG + Intergenic
957846143 3:85738040-85738062 GAACTATTTGGTGATTGTTCAGG - Intronic
957963313 3:87289059-87289081 GTTCTATTTTTAGATTTTTGAGG - Intergenic
958744469 3:98115678-98115700 GATCTGTTTGGGGACTTTTGAGG + Intergenic
958772288 3:98439408-98439430 GAACAATTTTGGGATTATTGGGG - Intergenic
959029074 3:101276760-101276782 AGTTTATTTTGGGATTTTTGGGG + Intronic
959204563 3:103288862-103288884 GCTCTGTTTTTGGATTTTTGAGG + Intergenic
959328307 3:104967790-104967812 GCTCTATTTTTAGATTTTTGAGG + Intergenic
959458227 3:106590658-106590680 AATTTATTTGAGTATTTTTGGGG + Intergenic
959639974 3:108621704-108621726 GATCTATTTTCAGTTTTTTGAGG - Intronic
961953654 3:130776894-130776916 GTTCTATTTTTAGATTTTTGTGG - Intergenic
962144945 3:132830759-132830781 GAAATATTTGGGGATGTTTTGGG - Intergenic
962213412 3:133498770-133498792 ATTCTATGTGGGGTTTTTTGGGG + Intergenic
962626431 3:137230000-137230022 GAGCTATCTGGGGACTTTAGAGG + Intergenic
962717686 3:138141356-138141378 CATATATTTTGGGATTTATGGGG - Intergenic
962920261 3:139943940-139943962 GATCTATTTTGGGAGGTCTGGGG - Intronic
963615631 3:147533823-147533845 AATTTATTTAGAGATTTTTGAGG + Intergenic
964151902 3:153535756-153535778 GCTCTATTTATAGATTTTTGAGG - Intergenic
965430083 3:168575532-168575554 GATCTATTTGTGAATATTTCAGG - Intergenic
965726603 3:171723516-171723538 GCTCTATTTTGAGTTTTTTGAGG + Intronic
965956257 3:174373749-174373771 GTTCTATTTGTAGTTTTTTGAGG - Intergenic
966967493 3:185009591-185009613 GATGCATTTGGAGTTTTTTGCGG + Intronic
967701724 3:192600894-192600916 GTTCTATTTGTAGTTTTTTGAGG - Intronic
969101704 4:4774527-4774549 GCCCTCTTTGGGGATTTTTTTGG + Intergenic
970708599 4:18835246-18835268 GAACTTTTTGGTGATTTTTTGGG + Intergenic
971523627 4:27587393-27587415 GCTCTATTTTTAGATTTTTGAGG - Intergenic
971583194 4:28369503-28369525 AATCTATTTTGGGTTTATTGGGG + Intronic
971894646 4:32576709-32576731 GTTCTATTTGTAGTTTTTTGAGG - Intergenic
971918423 4:32905754-32905776 GTTCTATTTTGAAATTTTTGAGG - Intergenic
972753222 4:42014328-42014350 GTTCTATTTTTGGTTTTTTGAGG - Intronic
972955438 4:44384260-44384282 GCTGTATTTGTGGTTTTTTGAGG - Intronic
973841610 4:54866992-54867014 GATCTATTTGTCTATTTTTATGG + Intergenic
974009509 4:56594028-56594050 GATCAATTTTCGGCTTTTTGAGG + Intronic
974301461 4:60072942-60072964 GCTCTATTTTCAGATTTTTGAGG - Intergenic
974589943 4:63933616-63933638 TGTCTATTTGGGGTCTTTTGTGG - Intergenic
975227162 4:71887448-71887470 GTTCTATTTTCAGATTTTTGAGG + Intergenic
975428128 4:74254282-74254304 AATCTATTTGGAGTTTTTTAGGG - Intronic
975833437 4:78394676-78394698 TGGCTATTTGGGGATTTTTGTGG + Intronic
976013624 4:80522969-80522991 GAACTATTTGGGGTTCTTTATGG + Intronic
976126463 4:81838321-81838343 GATCTTTGTGGGGTTGTTTGGGG + Intronic
976495534 4:85725637-85725659 GATGCATTTGTGGATTTTTCAGG + Intronic
976776515 4:88712244-88712266 GATCTATTTTTAGTTTTTTGAGG + Intergenic
977410736 4:96658947-96658969 GTTCTATTTGTAGTTTTTTGAGG - Intergenic
977630881 4:99241375-99241397 GCTCTATTTTTGGTTTTTTGAGG + Intergenic
977781089 4:100981611-100981633 GATCCATTTGGGGAAACTTGTGG - Intergenic
977821997 4:101483119-101483141 TAGCTATTTGGGGTCTTTTGTGG + Intronic
978292715 4:107164293-107164315 TAGCTATTTGGGGTCTTTTGCGG - Intronic
978584991 4:110267755-110267777 TATCCATTTGCAGATTTTTGTGG - Intergenic
979173481 4:117631889-117631911 TAGCTATTTGGGGTCTTTTGTGG - Intergenic
981285806 4:143018130-143018152 GATCTATTTAGGAATCTTTGAGG + Intergenic
981453319 4:144924632-144924654 GTTCTATTTTTGGCTTTTTGAGG + Intergenic
981555897 4:145993210-145993232 CACTTATTTGAGGATTTTTGTGG + Intergenic
981575459 4:146199558-146199580 TAGCTATTTGGGGTCTTTTGTGG + Intronic
981992318 4:150937036-150937058 GAAATATTTGGGGCTTTTTTTGG - Intronic
982016342 4:151157536-151157558 GTTCTATTTGTAGTTTTTTGAGG - Intronic
982267903 4:153556811-153556833 GATCAGTTTGGGGATTCTTAGGG + Intronic
982916063 4:161210944-161210966 TAACTATTTGGGGTCTTTTGTGG + Intergenic
984365583 4:178794980-178795002 AAACTAATTTGGGATTTTTGTGG - Intergenic
984758644 4:183345550-183345572 GATCTCTTGGGGGGTTGTTGTGG + Intergenic
985867649 5:2527731-2527753 GTTCTATTTGTAGCTTTTTGAGG - Intergenic
987116995 5:14733641-14733663 CCTCTATTTGGTAATTTTTGAGG + Intronic
989348906 5:40461658-40461680 GATTTATTTGGGGTCTTCTGTGG - Intergenic
989536930 5:42574766-42574788 CATCTCTTTTTGGATTTTTGCGG + Intronic
989671209 5:43918565-43918587 GATCTATTTTTGATTTTTTGAGG + Intergenic
989912371 5:49672571-49672593 GATCTGTATGTGGATATTTGGGG + Intergenic
989928039 5:49907092-49907114 GATCTGTATGTGGATATTTGGGG + Intergenic
989945361 5:50220401-50220423 TGTATATTTGGAGATTTTTGAGG - Intergenic
990091239 5:52052293-52052315 CAAGTATTTGGGGATTTTTCTGG - Intronic
990752398 5:59031176-59031198 GTTCTATTTTTAGATTTTTGAGG - Intronic
991337018 5:65560028-65560050 TTTCTATTTTGGGTTTTTTGAGG - Intronic
991444572 5:66685323-66685345 ATTCTTTTTGGGGGTTTTTGGGG - Intronic
992196164 5:74341274-74341296 GAGCTATTTTGTGTTTTTTGTGG + Intergenic
993995439 5:94717118-94717140 AATGTATTTGGGGCTATTTGAGG - Intronic
994326495 5:98452776-98452798 GTTCTATTTTTAGATTTTTGAGG - Intergenic
994581643 5:101649945-101649967 CATCTATTTAGGGATATATGTGG + Intergenic
994604182 5:101945315-101945337 TGGCTATTTGGGGATTTTTGTGG + Intergenic
995535673 5:113133670-113133692 GTTCTATTTTGAGTTTTTTGAGG + Intronic
995817062 5:116182622-116182644 AATCTATTTGGGGAGGTTTAAGG + Intronic
996800456 5:127397065-127397087 GCACTATTTGGGGGTTGTTGGGG + Intronic
997219689 5:132150852-132150874 GGTCTATTTGGGGATGGTGGTGG - Intergenic
998026025 5:138817410-138817432 AATCTCTTTGGGGACTTTTTGGG + Intronic
998106457 5:139472053-139472075 GATCTATTTAGGAATTTTGCTGG + Intergenic
998288908 5:140893292-140893314 GTTCTATTTGTAGTTTTTTGAGG + Intronic
998289613 5:140900754-140900776 GCTCTATTTTTGGCTTTTTGAGG + Intronic
998793326 5:145790092-145790114 GTTCTATTTTGTGTTTTTTGAGG - Intronic
998906413 5:146909869-146909891 AATCTGTTTGGGCTTTTTTGTGG - Intronic
999488900 5:152028443-152028465 GTTCTATTTGTAGTTTTTTGAGG + Intergenic
999817048 5:155187641-155187663 GTTCTATTTTTAGATTTTTGTGG + Intergenic
1001790382 5:174452069-174452091 GTTCTATTTGTAGTTTTTTGAGG - Intergenic
1002126012 5:177044658-177044680 GGTCTACTTGGAGATTTTTAAGG - Intronic
1003028882 6:2583252-2583274 GTTCTATTTGTAGTTTTTTGAGG + Intergenic
1003199275 6:3943960-3943982 GCTCTTTTTAGGGATTGTTGTGG - Intergenic
1003301492 6:4887275-4887297 GATCAATTTGGAGAGTTTTATGG + Intronic
1004356860 6:14937037-14937059 GTTCTGTTTTGGGATTTTTGAGG + Intergenic
1004798718 6:19120154-19120176 TAGCTATTTGGGATTTTTTGTGG - Intergenic
1005294889 6:24415825-24415847 GATCTGGTTTGGGTTTTTTGTGG + Intronic
1006792436 6:36712791-36712813 GTTCTATTTGGTGATCTCTGGGG - Intronic
1006863034 6:37186269-37186291 GTTCTATTTTTGGTTTTTTGAGG + Intergenic
1007014839 6:38455217-38455239 GATCTGTTTTGTGATTGTTGTGG - Intronic
1007939343 6:45763427-45763449 AAGCTATTTGTGCATTTTTGTGG - Intergenic
1009685637 6:66952972-66952994 CATTTATTTTGGGATGTTTGTGG - Intergenic
1010156865 6:72804707-72804729 GCTCTATTTGTAGTTTTTTGAGG + Intronic
1010483987 6:76387678-76387700 GTTCTATTTTTAGATTTTTGAGG + Intergenic
1010548477 6:77189328-77189350 GCTCTATTTTTAGATTTTTGAGG - Intergenic
1010601371 6:77831347-77831369 GTTCTATTTTTAGATTTTTGAGG - Intronic
1010873167 6:81066730-81066752 GAACTATTAGGGGAAATTTGTGG - Intergenic
1011111158 6:83837841-83837863 TCTCTTTATGGGGATTTTTGGGG + Intergenic
1011204514 6:84877098-84877120 GATCTTTTGGGGTAGTTTTGTGG - Intergenic
1011947454 6:92924039-92924061 GTTCTATTTGTAGTTTTTTGAGG + Intergenic
1012356110 6:98316440-98316462 GCTTTAATTGGGGATTTCTGTGG - Intergenic
1012530833 6:100234144-100234166 GTTTTATTTTGGGTTTTTTGAGG + Intergenic
1012755561 6:103226330-103226352 GATCTAGTTTTGGTTTTTTGAGG - Intergenic
1014292019 6:119570021-119570043 AATCTATATGGAGTTTTTTGGGG + Intergenic
1014474575 6:121856592-121856614 GGTCTTATTTGGGATTTTTGCGG - Intergenic
1015287247 6:131500610-131500632 TGTCTATTTGGGGTCTTTTGTGG + Intergenic
1015668201 6:135655847-135655869 TTTCTATTTGGAGTTTTTTGAGG + Intergenic
1015959943 6:138637822-138637844 GTTCTATTTTTAGATTTTTGAGG - Intronic
1015991910 6:138953789-138953811 GTTCTATTTGTAGCTTTTTGAGG - Intronic
1016001482 6:139046264-139046286 GTACTAATTGGGGTTTTTTGAGG - Intergenic
1016161835 6:140892391-140892413 GATTTATTTGGTCATTATTGTGG - Intergenic
1016383011 6:143504313-143504335 GATTTGTTTGGGCATTTGTGTGG - Intronic
1016955049 6:149618514-149618536 GATCTCTTTGGAGTCTTTTGTGG - Intronic
1017573034 6:155768360-155768382 GTTCTATTTGTAGATTTTTGAGG + Intergenic
1017661124 6:156674645-156674667 TAACTATTTGGGGTCTTTTGTGG - Intergenic
1018536171 6:164822367-164822389 GATCTCTTTTTAGATTTTTGGGG - Intergenic
1018655246 6:166027778-166027800 CATCTATCTGGGGATATCTGAGG - Intergenic
1019470492 7:1217893-1217915 CATCTATCTGGGGGTTTTGGGGG - Intergenic
1020241071 7:6395522-6395544 GGGATATTTGGTGATTTTTGTGG + Intronic
1021609494 7:22443857-22443879 GTTCAATTGGGTGATTTTTGTGG - Intronic
1021875982 7:25049705-25049727 GATCTATTTCTGATTTTTTGTGG + Intergenic
1023797671 7:43807355-43807377 GAGCTATGTTGGGATATTTGGGG + Intergenic
1024199629 7:47092644-47092666 GTTCTATTTGTAGTTTTTTGAGG - Intergenic
1024813359 7:53238797-53238819 GCTATTTTTGGGGATTTTTCTGG - Intergenic
1024894969 7:54248268-54248290 AAATTCTTTGGGGATTTTTGAGG - Intergenic
1026698876 7:72621311-72621333 GAAGTATTTGGGGTTTATTGTGG - Intronic
1026710421 7:72733889-72733911 TGGCTATTTGGGGATTTTAGTGG - Intronic
1027386979 7:77668536-77668558 GTATTATTTGGGGATATTTGGGG - Intergenic
1027809155 7:82871055-82871077 GTTCTATTTTTGGTTTTTTGAGG - Intronic
1029939066 7:104460394-104460416 GTTCTATTTTTGGCTTTTTGAGG + Intronic
1030478447 7:110069763-110069785 TATCTATTTTGGGTCTTTTGTGG + Intergenic
1030618325 7:111761762-111761784 GATATATTTAGGGGTTTGTGGGG - Intronic
1030803317 7:113881428-113881450 AATCTATTTGGAATTTTTTGGGG - Intronic
1031078446 7:117235135-117235157 GCTCTATTTTAAGATTTTTGAGG + Intergenic
1031597286 7:123662785-123662807 GACTTTTTTGGGGAGTTTTGGGG - Exonic
1031795014 7:126162173-126162195 GTTCTATTTGCAGTTTTTTGAGG - Intergenic
1031843247 7:126772596-126772618 GATCTATAGTGGTATTTTTGAGG - Intronic
1031902104 7:127422401-127422423 TATCTATTTGGGACCTTTTGTGG - Intronic
1032116176 7:129119276-129119298 GTTCTATTTGTAGTTTTTTGAGG + Intergenic
1033412896 7:141136046-141136068 TGTCTATTTGGGGCCTTTTGTGG - Intronic
1034341406 7:150358849-150358871 GATATCTTTGGGGCTCTTTGGGG - Intergenic
1035627778 8:1085740-1085762 TATATATTTGAGGTTTTTTGTGG + Intergenic
1036481427 8:9143052-9143074 GTTCTAGTTGTGGTTTTTTGAGG + Intronic
1036532828 8:9611714-9611736 GTTCTCTATGGGGATTTATGTGG - Intronic
1036684251 8:10898707-10898729 GCTCTATTTTGGGATCTTCGTGG - Exonic
1037218649 8:16488962-16488984 GATCTTATGGAGGATTTTTGGGG - Intronic
1037382472 8:18301544-18301566 GATCTATTTTTAGGTTTTTGAGG + Intergenic
1038384025 8:27123722-27123744 GTTCTATTTTGGCATTTTTCAGG - Intergenic
1039306085 8:36264503-36264525 GATCTGTTGGGGGCTTTGTGAGG + Intergenic
1039338069 8:36616096-36616118 GTTCTATTTGTAGTTTTTTGAGG - Intergenic
1039610693 8:38916816-38916838 GATCTATTTTTAGTTTTTTGAGG + Intronic
1040695325 8:49990467-49990489 GTTCTTTTAGGGGATTTTTTTGG - Intronic
1040767581 8:50932269-50932291 GATCTATTTAGGTTTTTTTGGGG - Intergenic
1041017674 8:53608031-53608053 CATGTAATTGGGCATTTTTGAGG - Intergenic
1041341931 8:56855358-56855380 GATATTTTTTGAGATTTTTGAGG + Intergenic
1042634567 8:70859453-70859475 GATCTATTTTTAGTTTTTTGAGG - Intergenic
1043918890 8:85958212-85958234 GGGCTATTTGGGGATTTTTGTGG + Intergenic
1044175530 8:89116253-89116275 GATTGCTTTGGGGACTTTTGTGG - Intergenic
1044493922 8:92853691-92853713 TAGCTATTTGGGGTCTTTTGTGG - Intergenic
1044840396 8:96332174-96332196 GATCACTTTGGGAATATTTGGGG + Intronic
1045991332 8:108312035-108312057 GATCTATTTTTAGGTTTTTGAGG - Intronic
1046456871 8:114477249-114477271 GGTCTATTTTTAGATTTTTGAGG - Intergenic
1047197018 8:122730874-122730896 AATCTATTTGGAGAGTTTTGGGG - Intergenic
1047475408 8:125223520-125223542 GCTCTATTTGTAGTTTTTTGAGG + Intronic
1048427298 8:134334626-134334648 GATTTCTGTGGGTATTTTTGAGG + Intergenic
1048736039 8:137503051-137503073 GATCTCTCTGGAGAGTTTTGTGG - Intergenic
1048774273 8:137928348-137928370 CATCTATTTGGTGAGATTTGGGG + Intergenic
1049067705 8:140330987-140331009 TAGCTATTTGAGGATTTTTAAGG - Intronic
1049397379 8:142407517-142407539 GGCCTATTTGGGGATTGATGGGG - Intergenic
1050531387 9:6592859-6592881 GATCAATTTTCGGCTTTTTGAGG - Exonic
1050806742 9:9690035-9690057 GTTCTATTTGTAGATATTTGAGG + Intronic
1052094909 9:24371943-24371965 GCTCTATTTTTAGATTTTTGAGG - Intergenic
1052204502 9:25822739-25822761 GCTCTATTTTTAGATTTTTGAGG + Intergenic
1052760457 9:32585228-32585250 GTTCTATTTGTAGTTTTTTGAGG + Intergenic
1053308581 9:37001263-37001285 GATCCAGGTGGAGATTTTTGGGG - Intronic
1054726805 9:68660533-68660555 GTTCTATTTGTAGTTTTTTGAGG - Intergenic
1054950941 9:70851061-70851083 GATCTACATGGAGAATTTTGGGG - Intronic
1055037624 9:71835444-71835466 GGTCTATTTTTAGATTTTTGAGG - Intergenic
1055588256 9:77780655-77780677 GTTCTATTTGTAGTTTTTTGAGG + Intronic
1056171517 9:83989790-83989812 GATCTATTTTGATTTTTTTGAGG - Intronic
1056210978 9:84365065-84365087 GCTCTATTTTTAGATTTTTGAGG + Intergenic
1057006016 9:91560636-91560658 GTTGCATTTGGGGATTTCTGTGG + Intergenic
1057924598 9:99133352-99133374 GTTCTATTTGTTGATATTTGTGG + Intronic
1059086751 9:111311262-111311284 ATTCTATTTGTGGTTTTTTGAGG + Intergenic
1059509677 9:114832953-114832975 TAGCTATTTGGGGTCTTTTGTGG + Intergenic
1059510057 9:114836684-114836706 TAGCTATTTGGGGTCTTTTGTGG + Intergenic
1059692851 9:116702411-116702433 GATATATTTGGAGACTTGTGAGG - Intronic
1060164292 9:121396787-121396809 GCTCTATTTGTAGTTTTTTGAGG + Intergenic
1060761413 9:126253012-126253034 AATTTTTTTAGGGATTTTTGGGG + Intergenic
1061456633 9:130702971-130702993 GATTTATTTGTGAATTTCTGTGG + Intronic
1061535462 9:131245702-131245724 CAACTATTTGGAGATTTTTCTGG - Intergenic
1185783053 X:2865833-2865855 GTTCTATTTGTAGTTTTTTGAGG - Intronic
1186229776 X:7440633-7440655 GTTCTGTTTGTGGTTTTTTGAGG - Intergenic
1186685608 X:11921992-11922014 GATTTATTCGGAGATTTTAGTGG + Intergenic
1187451026 X:19396394-19396416 TATCTATTTGGGGAAATTTCTGG - Intronic
1188076380 X:25780624-25780646 TATCTATTCAAGGATTTTTGTGG + Intergenic
1188650085 X:32621658-32621680 CATCTGGTTGGGGATTTTTGGGG + Intronic
1188875733 X:35427900-35427922 GCTCTATTTTGAGGTTTTTGAGG - Intergenic
1189478106 X:41372583-41372605 TAAGTATTTGGGGATTTTTAAGG - Intergenic
1190459368 X:50656721-50656743 TAGCTATTTGGGGTCTTTTGTGG + Intronic
1192188220 X:68971683-68971705 TATCTACTTGGGGTCTTTTGAGG - Intergenic
1192725295 X:73744527-73744549 TTGCTATTTGGGGACTTTTGTGG + Intergenic
1193490082 X:82138652-82138674 GATCTATTTTTAGTTTTTTGAGG - Intergenic
1193955644 X:87857725-87857747 GAACAATTTTGGGATTTTTTGGG + Intergenic
1194190390 X:90828273-90828295 TGTCTATTTGGGCTTTTTTGTGG + Intergenic
1194986761 X:100498539-100498561 TAGCTATTTGGGGTCTTTTGTGG - Intergenic
1195116284 X:101702059-101702081 GCTCTATTTTTAGATTTTTGAGG - Intergenic
1195662176 X:107390024-107390046 GCTCATTTTGGGGAATTTTGGGG + Intergenic
1196008436 X:110860244-110860266 TAGCTATTTAGGGACTTTTGTGG - Intergenic
1196534991 X:116833275-116833297 GATCTTTTTGGGTATTTGTTAGG - Intergenic
1196592459 X:117502927-117502949 GTTCTATTTTGAGTTTTTTGAGG - Intergenic
1196626575 X:117884051-117884073 GCTCAATTTTTGGATTTTTGAGG - Intergenic
1197032394 X:121833176-121833198 GTTCTATTTTTAGATTTTTGAGG - Intergenic
1197203271 X:123767629-123767651 GAGTTTTTTGGGGATTTGTGGGG + Intergenic
1197444879 X:126540721-126540743 TGGCTATTTGTGGATTTTTGTGG - Intergenic
1197587068 X:128361780-128361802 GATCTATTTTTAGTTTTTTGAGG + Intergenic
1197846893 X:130812824-130812846 GCTTTATTTGGGGTCTTTTGTGG - Intronic
1197921811 X:131602678-131602700 TAGCTATTTGGGGACTTTTGGGG + Intergenic
1198120456 X:133587490-133587512 GTTCTATTTGTAGTTTTTTGAGG + Intronic
1198548027 X:137714115-137714137 GAGCTATTTGGAGTCTTTTGTGG + Intergenic
1199816403 X:151401481-151401503 TGGCTATTTGGGGCTTTTTGTGG + Intronic
1200208531 X:154334870-154334892 GATGTGATTGGGGATCTTTGAGG + Intergenic
1202597668 Y:26559439-26559461 GTTCTATTTTTGGTTTTTTGAGG + Intergenic