ID: 1167243936

View in Genome Browser
Species Human (GRCh38)
Location 19:48362771-48362793
Sequence TACCCAAGGCCACAACATAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 146}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167243936_1167243943 24 Left 1167243936 19:48362771-48362793 CCACTATGTTGTGGCCTTGGGTA 0: 1
1: 0
2: 1
3: 14
4: 146
Right 1167243943 19:48362818-48362840 CATTATCTCATCTGTAAAATGGG 0: 2
1: 52
2: 429
3: 2170
4: 7050
1167243936_1167243944 25 Left 1167243936 19:48362771-48362793 CCACTATGTTGTGGCCTTGGGTA 0: 1
1: 0
2: 1
3: 14
4: 146
Right 1167243944 19:48362819-48362841 ATTATCTCATCTGTAAAATGGGG 0: 2
1: 95
2: 809
3: 3341
4: 8564
1167243936_1167243942 23 Left 1167243936 19:48362771-48362793 CCACTATGTTGTGGCCTTGGGTA 0: 1
1: 0
2: 1
3: 14
4: 146
Right 1167243942 19:48362817-48362839 CCATTATCTCATCTGTAAAATGG 0: 2
1: 43
2: 363
3: 2089
4: 7300

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167243936 Original CRISPR TACCCAAGGCCACAACATAG TGG (reversed) Intronic
901800895 1:11707423-11707445 TGCCCAGGGCCACACCCTAGTGG - Intronic
902728365 1:18352142-18352164 TACCCCAGGCCTCAGCAGAGGGG - Intronic
902752125 1:18524035-18524057 TAGCCAAGGCCAGATCATGGAGG + Intergenic
907230582 1:52995028-52995050 GGCCAAAGGCCACTACATAGAGG + Intronic
907842125 1:58168603-58168625 TGCCCAAAGCCCCATCATAGGGG + Intronic
908444606 1:64189123-64189145 TGGCCAAGTCCACTACATAGTGG - Intergenic
910397720 1:86808600-86808622 TGCCCAAAGCCCCATCATAGGGG - Intergenic
916939300 1:169663098-169663120 TGCCCAAAGCCCCATCATAGTGG + Intronic
917446026 1:175106427-175106449 TGCCCAAGGCCCCATCGTAGTGG - Intronic
919790935 1:201290511-201290533 TACCCAAGGCCACCTCCTTGAGG - Intronic
921385345 1:214563171-214563193 TACCAAAAGCCACAAAATGGTGG - Intergenic
1063321925 10:5059149-5059171 TGCCCAAAGCCCCATCATAGTGG - Intronic
1068500112 10:57833774-57833796 TGCCCAAAGCCCCATCATAGAGG + Intergenic
1071220939 10:83463974-83463996 TGCCCAAAGCCCCATCATAGGGG + Intergenic
1071886569 10:89957715-89957737 TACCTAATGCCACAAAACAGGGG - Intergenic
1072212406 10:93258596-93258618 CACCCAAGGCCAAACCATATTGG + Intergenic
1072464424 10:95650018-95650040 TACCCAGGGCTAGAGCATAGTGG - Intronic
1074225855 10:111483682-111483704 CACTCAAGGGCACAACAAAGTGG - Intergenic
1075934285 10:126326434-126326456 TAGCCAGGGCCAAAACACAGGGG + Intronic
1076020293 10:127066850-127066872 TACCCAAGGCCACAAGAGCTGGG + Intronic
1076703884 10:132290777-132290799 TACCCAAGGCCACCACATCCAGG + Intronic
1078831521 11:14981650-14981672 TTGCCAAGGCCACAACAGAATGG + Intronic
1078876999 11:15409084-15409106 TCCCCAAGGGCACATCATGGTGG + Intergenic
1079949949 11:26789488-26789510 TACCCAAGGTTACAATATAAAGG - Intergenic
1081494509 11:43594987-43595009 TACCCAAGGCCACATAATAATGG - Intronic
1083117906 11:60481830-60481852 TTCCCAAGGTCACACAATAGAGG + Intergenic
1084302697 11:68261836-68261858 CACCCAAGGCCAGTACATGGTGG - Exonic
1085040209 11:73322445-73322467 TGCCCAAGGCCACACAGTAGTGG + Intronic
1085181676 11:74541785-74541807 TAGCCAAGTCCACCACACAGTGG - Intronic
1086350877 11:85942333-85942355 TGGCCAAGTCCACCACATAGTGG - Intergenic
1092925343 12:13267133-13267155 GTCACATGGCCACAACATAGTGG + Intergenic
1093760527 12:22904262-22904284 TTCCCCAGGCCATAAGATAGGGG + Intergenic
1096460101 12:51817622-51817644 TCCCCAGAGCCACAAAATAGGGG - Intergenic
1101518767 12:105462496-105462518 TACCCAAGGGCAAAGCAAAGGGG - Intergenic
1106111906 13:26785066-26785088 AACTCAAGGCCACTGCATAGGGG - Intergenic
1107419036 13:40229027-40229049 TTTCCAAGGCCACAAAATGGAGG + Intergenic
1109232329 13:59773524-59773546 AACCCAAGGACATAACACAGAGG + Intronic
1113125561 13:106975074-106975096 TACCTAAGGCGACAGCACAGAGG + Intergenic
1113874591 13:113586037-113586059 TATCCAAGGCCACAACTTGTGGG - Intronic
1115535881 14:34372925-34372947 TACCAAAGGCCAACACAGAGAGG - Intronic
1120667189 14:87320412-87320434 TTCCCAAGGGCAAAACATAAAGG + Intergenic
1121124130 14:91395096-91395118 TACCCAAGGCCACAAATCTGAGG + Intronic
1124914610 15:33957676-33957698 AACCCCATGCAACAACATAGGGG + Intronic
1126507772 15:49427804-49427826 TACCCGAGCCCAAAACATTGTGG - Intronic
1129974497 15:79810928-79810950 TACCCTTGGCCACAGCATAATGG + Intergenic
1130378743 15:83354097-83354119 AACACAAGGACACAACAGAGGGG - Intergenic
1130781740 15:87047028-87047050 TTCCCAAGAGCACAAAATAGTGG - Intergenic
1133243879 16:4433605-4433627 TACCCAAGGCTGCAAGATAGAGG + Intronic
1135404434 16:22188226-22188248 TGTCCAAGGCCACACCATACTGG + Intronic
1136027105 16:27475537-27475559 CACCCAAGACCCCAACAGAGAGG - Intronic
1142183401 16:88682594-88682616 TACCCAAAGCCTCAGCATGGAGG - Intronic
1143166126 17:4897999-4898021 TATCCAAGGCCACTACATTGAGG - Exonic
1144054723 17:11529645-11529667 TACCAAAGGACAAACCATAGAGG + Intronic
1144088236 17:11830030-11830052 AACCCAAGTCCACCACAGAGAGG - Intronic
1147669713 17:42169935-42169957 TCCCCAGGGCCAGCACATAGTGG + Intronic
1148898517 17:50855997-50856019 TACCAAAGGGAAAAACATAGAGG - Intergenic
1148961336 17:51395863-51395885 TTACCAAGGCCTCAGCATAGAGG - Intergenic
1149213371 17:54328286-54328308 TGCCCAAAGCCCCAGCATAGTGG - Intergenic
1151277302 17:73045116-73045138 TACCCAAGGCTACCCCAGAGAGG - Intronic
1151562120 17:74876146-74876168 TGCCTAAGGCCACACCACAGAGG + Intergenic
1151567803 17:74909510-74909532 TGCCCAAAGCCCCATCATAGTGG + Intergenic
1155015915 18:21839381-21839403 TAACCAAGGCAACATGATAGTGG - Intronic
1156001938 18:32394836-32394858 TGCCCAAGACCACACCATGGTGG - Intronic
1157103837 18:44754872-44754894 TACCCAAAGCCCCAACATAGTGG + Intronic
1157311038 18:46553376-46553398 TTCCCAAGGCCACATAACAGTGG + Intronic
1157858117 18:51119429-51119451 TGCCCAAAGCCCCATCATAGTGG - Intergenic
1159352873 18:67298520-67298542 TAGCCAAGTCCACCACATAGTGG - Intergenic
1162059137 19:8084232-8084254 CACCCAAGTCCACAACACACAGG + Intronic
1163571067 19:18082614-18082636 TTCCCAAGACCACAGCCTAGTGG - Intronic
1163976797 19:20860533-20860555 TCCCCAAGGCCACAACACGCGGG + Intronic
1165127531 19:33610805-33610827 CTCCCAATGCCACCACATAGAGG + Intergenic
1167243936 19:48362771-48362793 TACCCAAGGCCACAACATAGTGG - Intronic
927043983 2:19258502-19258524 TACCCAAGGCCACAGTGTAAGGG + Intergenic
929543046 2:42837033-42837055 TACCCAAGGCCACAATTTACGGG - Intergenic
929714925 2:44300356-44300378 TACCAAGGGCCACAAAATAGAGG + Intronic
930038298 2:47101655-47101677 TGCCCAAAGCCCCATCATAGTGG + Intronic
937589536 2:123596437-123596459 TACCCAAGGCTACAACAGTCAGG + Intergenic
939057471 2:137382100-137382122 TAGCCAAGTCCACCACGTAGTGG - Intronic
941715068 2:168755153-168755175 TATCCAAGGTCACAAGACAGAGG - Intronic
943319958 2:186433913-186433935 TGGCCAAGTCCACTACATAGTGG - Intergenic
946226039 2:218264645-218264667 GACCCAAGCCCACCACCTAGGGG + Intronic
1168926145 20:1581015-1581037 CACCGAAGGCCAGAAGATAGGGG + Intronic
1173561596 20:44009865-44009887 TACCAAAGGCGGCAACACAGTGG - Intronic
1177651741 21:23967525-23967547 TAGCCAAATCTACAACATAGTGG + Intergenic
1180918499 22:19506098-19506120 TTTCCAAGGCCACACAATAGTGG + Intronic
1181712535 22:24699665-24699687 TTCCCAAAGCCACAACACTGAGG + Intergenic
1182241868 22:28922673-28922695 CACCCAAGGCCAGAACGCAGAGG - Intronic
1184301474 22:43563233-43563255 TACCCAAGGTAACAAGATAGGGG - Intronic
952524248 3:34193506-34193528 TAACCAAGGCCACTACTAAGTGG - Intergenic
952868130 3:37871817-37871839 TACCCAACTGAACAACATAGGGG - Intronic
953845263 3:46421707-46421729 TGGCCAAGTCCACCACATAGTGG + Intergenic
959598655 3:108154562-108154584 TGCCCAAGGCCACATAATAGTGG - Intergenic
961906084 3:130264315-130264337 GACCCAAGGCCAGCACAAAGAGG - Intergenic
966304176 3:178512506-178512528 TACCCAAAACCACAACTTTGTGG + Intronic
966719190 3:183044630-183044652 TACCTAAGGCCACAGCATTCTGG - Intronic
967583418 3:191186594-191186616 TGCCCAAAGCCCCATCATAGGGG + Intergenic
969408388 4:7010790-7010812 TACCCAGGGCCCGAACACAGAGG - Intronic
969442860 4:7227599-7227621 CACCCCAGGCCACCACACAGAGG - Intronic
970581383 4:17477210-17477232 TACCCACAGCCACACCATAAGGG + Intronic
971250114 4:24967504-24967526 TGGCCAAGTCCACTACATAGTGG - Intronic
971555992 4:28013644-28013666 TAGCCAAGTCCACTGCATAGTGG + Intergenic
972072371 4:35038215-35038237 TACCCCAGGCCCCAACAGTGCGG - Intergenic
973897137 4:55424540-55424562 CACCCACGGCTACACCATAGGGG - Exonic
974235687 4:59179262-59179284 TAGCCTAGGCCACATCATGGTGG - Intergenic
975470211 4:74757244-74757266 TGCCCCAGGCCACAAGAGAGAGG + Intronic
976020120 4:80612819-80612841 TGCCCAAGGCCACAATATTAGGG - Intronic
976811638 4:89106092-89106114 TGGCCAAGTCCACCACATAGTGG - Intronic
977831319 4:101597062-101597084 TCCCCAAGGCCAAAACAAATGGG + Intronic
982700904 4:158659060-158659082 TGCCCAAAGCCCCATCATAGGGG + Intergenic
983492163 4:168400514-168400536 TGCCCTAGGCCACAACCTGGAGG - Intronic
988508594 5:31846089-31846111 AACCCAAAGCCACCACAGAGGGG - Intronic
990810206 5:59714616-59714638 TAATCAAGTCCACCACATAGTGG - Intronic
992049130 5:72927396-72927418 TGCCCAAAGCCCCATCATAGTGG + Intergenic
992896570 5:81251050-81251072 GACCCTGAGCCACAACATAGGGG - Intronic
994589968 5:101760267-101760289 TGGCCGAGGCCACCACATAGTGG + Intergenic
994936539 5:106259841-106259863 TACCCAGGGACACAACACTGTGG - Intergenic
995374169 5:111454840-111454862 TACCTAAGCCCTTAACATAGTGG - Intronic
996680152 5:126222462-126222484 TGCCCAAAGCCCCATCATAGTGG + Intergenic
996996306 5:129700562-129700584 TACCAAAGGTCACAAAATTGTGG - Intronic
999903845 5:156117702-156117724 TGCCCAAGGACACAACTTGGGGG + Intronic
1000411194 5:160936333-160936355 TGGCCAAGTCCACTACATAGTGG + Intergenic
1001023499 5:168204185-168204207 TACCCAATGCCACAGCATTTGGG + Intronic
1001171792 5:169426446-169426468 TAACCAAGGCAAGAAAATAGAGG - Intergenic
1002086757 5:176780704-176780726 CAGCCAAGGTCACAACACAGTGG + Intergenic
1005271004 6:24163624-24163646 TACCAAAGGCCATAGCACAGTGG - Intergenic
1005813365 6:29532258-29532280 TACCCAAGGCCAAAGCCCAGAGG + Intergenic
1009651297 6:66480591-66480613 TAGCTAAGTCCACCACATAGTGG + Intergenic
1010723786 6:79311396-79311418 TAGCCAAGTCTACCACATAGTGG + Intergenic
1012905242 6:105056574-105056596 TATCCAAGGCCACAAAATGCTGG - Intronic
1013175422 6:107672843-107672865 TACCCAAGGCCACTAGACTGAGG + Intergenic
1014752447 6:125270272-125270294 TGACCAAGTCCACCACATAGTGG - Intronic
1015596773 6:134874009-134874031 TGGCCAAGTCCACTACATAGGGG + Intergenic
1017955231 6:159171551-159171573 TACCCACGGCCACATAATAGTGG + Intronic
1028646760 7:93107015-93107037 TACCCAACAACACAACAAAGAGG - Intronic
1040648838 8:49428190-49428212 TGCCCAAAGCCCCATCATAGGGG + Intergenic
1040668093 8:49655825-49655847 TGCCCAAAGCCCCATCATAGGGG - Intergenic
1040921557 8:52626178-52626200 CTCCCAAGGCAACAACACAGGGG + Intronic
1040953160 8:52955805-52955827 TGCCCAAAGCCCCATCATAGGGG + Intergenic
1042906949 8:73781531-73781553 TGTCCAAGCCCAAAACATAGTGG + Intronic
1047957110 8:129984491-129984513 CACCCAAGGCCACATGATACTGG + Intronic
1052569268 9:30199572-30199594 TAGCCAAGTCCACCACATAGTGG - Intergenic
1052869792 9:33493069-33493091 TATGCAAGGACACTACATAGGGG + Intergenic
1055531100 9:77184848-77184870 TACCAAAGTCCACAACAGGGAGG + Intronic
1056393031 9:86156184-86156206 TGCCCAAAGCCCCATCATAGGGG - Intergenic
1057688597 9:97262003-97262025 TATGCAAGGACACCACATAGGGG - Intergenic
1057876941 9:98764498-98764520 TATCAAATGCCACAGCATAGAGG - Intronic
1059965608 9:119610536-119610558 TACCCAAGGCCACAGCTTCAGGG - Intergenic
1060561484 9:124548633-124548655 TGCCCCAGGACACAACACAGAGG - Intronic
1189128906 X:38478338-38478360 TATCCAAGGCTACCACAAAGTGG + Intronic
1191901919 X:66050318-66050340 TATCCCAGGACAGAACATAGGGG - Intergenic
1192236918 X:69301938-69301960 TACCACAGGCCACAACAGGGAGG + Intergenic
1193508468 X:82371460-82371482 TGGCCAAGTCCACCACATAGTGG + Intergenic
1193862805 X:86691856-86691878 TACCCAAGCCTTCAAAATAGTGG + Intronic
1194659132 X:96609277-96609299 CAGCCAAGGCTACAACATTGTGG - Intergenic
1195439315 X:104883753-104883775 TACCCAAAGCCCCATCACAGGGG + Intronic
1196882046 X:120207421-120207443 TAGCCAAGTCCACCACACAGTGG - Intergenic
1199552697 X:149076070-149076092 TAGCCAAGTCTACAACATAGTGG - Intergenic
1201429447 Y:13890031-13890053 TGCCCAAAGCCCCATCATAGTGG + Intergenic
1201487332 Y:14507401-14507423 TGCCCAAAGCCCCATCATAGTGG + Intergenic
1201496642 Y:14596234-14596256 TGCCCAAGGCCCCATCATAGTGG - Intronic
1201555501 Y:15261889-15261911 TGCCCAAAGCCCCATCATAGTGG + Intergenic
1202060347 Y:20880918-20880940 TACCTAAGCCCACAAAATAGAGG - Intergenic