ID: 1167244018

View in Genome Browser
Species Human (GRCh38)
Location 19:48363306-48363328
Sequence GAGCAGCTGCTCCTTGGAGA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 406
Summary {0: 1, 1: 0, 2: 1, 3: 34, 4: 370}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167244007_1167244018 24 Left 1167244007 19:48363259-48363281 CCCCAGGCTCTTGGGCCTGGGAC 0: 1
1: 1
2: 3
3: 34
4: 353
Right 1167244018 19:48363306-48363328 GAGCAGCTGCTCCTTGGAGAAGG 0: 1
1: 0
2: 1
3: 34
4: 370
1167244009_1167244018 22 Left 1167244009 19:48363261-48363283 CCAGGCTCTTGGGCCTGGGACAG 0: 1
1: 0
2: 4
3: 44
4: 407
Right 1167244018 19:48363306-48363328 GAGCAGCTGCTCCTTGGAGAAGG 0: 1
1: 0
2: 1
3: 34
4: 370
1167244012_1167244018 9 Left 1167244012 19:48363274-48363296 CCTGGGACAGGCGGTACCTGTAT 0: 1
1: 0
2: 1
3: 3
4: 60
Right 1167244018 19:48363306-48363328 GAGCAGCTGCTCCTTGGAGAAGG 0: 1
1: 0
2: 1
3: 34
4: 370
1167244016_1167244018 -7 Left 1167244016 19:48363290-48363312 CCTGTATTAGGAGGCGGAGCAGC 0: 1
1: 0
2: 0
3: 0
4: 68
Right 1167244018 19:48363306-48363328 GAGCAGCTGCTCCTTGGAGAAGG 0: 1
1: 0
2: 1
3: 34
4: 370
1167244008_1167244018 23 Left 1167244008 19:48363260-48363282 CCCAGGCTCTTGGGCCTGGGACA 0: 1
1: 0
2: 2
3: 52
4: 334
Right 1167244018 19:48363306-48363328 GAGCAGCTGCTCCTTGGAGAAGG 0: 1
1: 0
2: 1
3: 34
4: 370

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167244018 Original CRISPR GAGCAGCTGCTCCTTGGAGA AGG Exonic