ID: 1167244571

View in Genome Browser
Species Human (GRCh38)
Location 19:48365465-48365487
Sequence AGGGGGCTTCTGTGGGCCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167244571_1167244579 3 Left 1167244571 19:48365465-48365487 CCTGGGGCCCACAGAAGCCCCCT No data
Right 1167244579 19:48365491-48365513 CACACACAACCTCATTCCCTGGG 0: 1
1: 2
2: 2
3: 23
4: 240
1167244571_1167244578 2 Left 1167244571 19:48365465-48365487 CCTGGGGCCCACAGAAGCCCCCT No data
Right 1167244578 19:48365490-48365512 GCACACACAACCTCATTCCCTGG 0: 1
1: 0
2: 3
3: 19
4: 164

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167244571 Original CRISPR AGGGGGCTTCTGTGGGCCCC AGG (reversed) Intronic
No off target data available for this crispr