ID: 1167251093

View in Genome Browser
Species Human (GRCh38)
Location 19:48398802-48398824
Sequence CACGGCCACGATGGGCAGCG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 145}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167251093_1167251107 30 Left 1167251093 19:48398802-48398824 CCTCGCTGCCCATCGTGGCCGTG 0: 1
1: 0
2: 0
3: 4
4: 145
Right 1167251107 19:48398855-48398877 AAGGTGCGCGCGACCGGGGCGGG 0: 1
1: 0
2: 2
3: 8
4: 145
1167251093_1167251101 24 Left 1167251093 19:48398802-48398824 CCTCGCTGCCCATCGTGGCCGTG 0: 1
1: 0
2: 0
3: 4
4: 145
Right 1167251101 19:48398849-48398871 ACGCCCAAGGTGCGCGCGACCGG 0: 1
1: 0
2: 0
3: 2
4: 19
1167251093_1167251102 25 Left 1167251093 19:48398802-48398824 CCTCGCTGCCCATCGTGGCCGTG 0: 1
1: 0
2: 0
3: 4
4: 145
Right 1167251102 19:48398850-48398872 CGCCCAAGGTGCGCGCGACCGGG 0: 1
1: 0
2: 0
3: 1
4: 43
1167251093_1167251106 29 Left 1167251093 19:48398802-48398824 CCTCGCTGCCCATCGTGGCCGTG 0: 1
1: 0
2: 0
3: 4
4: 145
Right 1167251106 19:48398854-48398876 CAAGGTGCGCGCGACCGGGGCGG 0: 1
1: 0
2: 0
3: 4
4: 48
1167251093_1167251103 26 Left 1167251093 19:48398802-48398824 CCTCGCTGCCCATCGTGGCCGTG 0: 1
1: 0
2: 0
3: 4
4: 145
Right 1167251103 19:48398851-48398873 GCCCAAGGTGCGCGCGACCGGGG 0: 1
1: 0
2: 0
3: 2
4: 53
1167251093_1167251100 11 Left 1167251093 19:48398802-48398824 CCTCGCTGCCCATCGTGGCCGTG 0: 1
1: 0
2: 0
3: 4
4: 145
Right 1167251100 19:48398836-48398858 CGCGCTCGTGCTCACGCCCAAGG 0: 1
1: 0
2: 0
3: 6
4: 44

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167251093 Original CRISPR CACGGCCACGATGGGCAGCG AGG (reversed) Exonic