ID: 1167251098

View in Genome Browser
Species Human (GRCh38)
Location 19:48398820-48398842
Sequence GAGCGCGGCGCCGCCGTGCA CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 90
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 78}

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167251098_1167251107 12 Left 1167251098 19:48398820-48398842 CCGTGCACGGCGGCGCCGCGCTC 0: 1
1: 0
2: 0
3: 11
4: 78
Right 1167251107 19:48398855-48398877 AAGGTGCGCGCGACCGGGGCGGG 0: 1
1: 0
2: 2
3: 8
4: 145
1167251098_1167251115 29 Left 1167251098 19:48398820-48398842 CCGTGCACGGCGGCGCCGCGCTC 0: 1
1: 0
2: 0
3: 11
4: 78
Right 1167251115 19:48398872-48398894 GGCGGGGCGGGGCCACAGGAGGG 0: 1
1: 0
2: 16
3: 72
4: 687
1167251098_1167251114 28 Left 1167251098 19:48398820-48398842 CCGTGCACGGCGGCGCCGCGCTC 0: 1
1: 0
2: 0
3: 11
4: 78
Right 1167251114 19:48398871-48398893 GGGCGGGGCGGGGCCACAGGAGG 0: 2
1: 1
2: 25
3: 141
4: 1062
1167251098_1167251108 13 Left 1167251098 19:48398820-48398842 CCGTGCACGGCGGCGCCGCGCTC 0: 1
1: 0
2: 0
3: 11
4: 78
Right 1167251108 19:48398856-48398878 AGGTGCGCGCGACCGGGGCGGGG 0: 1
1: 0
2: 1
3: 15
4: 160
1167251098_1167251102 7 Left 1167251098 19:48398820-48398842 CCGTGCACGGCGGCGCCGCGCTC 0: 1
1: 0
2: 0
3: 11
4: 78
Right 1167251102 19:48398850-48398872 CGCCCAAGGTGCGCGCGACCGGG 0: 1
1: 0
2: 0
3: 1
4: 43
1167251098_1167251113 25 Left 1167251098 19:48398820-48398842 CCGTGCACGGCGGCGCCGCGCTC 0: 1
1: 0
2: 0
3: 11
4: 78
Right 1167251113 19:48398868-48398890 CCGGGGCGGGGCGGGGCCACAGG 0: 1
1: 2
2: 16
3: 177
4: 930
1167251098_1167251109 16 Left 1167251098 19:48398820-48398842 CCGTGCACGGCGGCGCCGCGCTC 0: 1
1: 0
2: 0
3: 11
4: 78
Right 1167251109 19:48398859-48398881 TGCGCGCGACCGGGGCGGGGCGG 0: 1
1: 1
2: 1
3: 25
4: 301
1167251098_1167251106 11 Left 1167251098 19:48398820-48398842 CCGTGCACGGCGGCGCCGCGCTC 0: 1
1: 0
2: 0
3: 11
4: 78
Right 1167251106 19:48398854-48398876 CAAGGTGCGCGCGACCGGGGCGG 0: 1
1: 0
2: 0
3: 4
4: 48
1167251098_1167251101 6 Left 1167251098 19:48398820-48398842 CCGTGCACGGCGGCGCCGCGCTC 0: 1
1: 0
2: 0
3: 11
4: 78
Right 1167251101 19:48398849-48398871 ACGCCCAAGGTGCGCGCGACCGG 0: 1
1: 0
2: 0
3: 2
4: 19
1167251098_1167251103 8 Left 1167251098 19:48398820-48398842 CCGTGCACGGCGGCGCCGCGCTC 0: 1
1: 0
2: 0
3: 11
4: 78
Right 1167251103 19:48398851-48398873 GCCCAAGGTGCGCGCGACCGGGG 0: 1
1: 0
2: 0
3: 2
4: 53
1167251098_1167251100 -7 Left 1167251098 19:48398820-48398842 CCGTGCACGGCGGCGCCGCGCTC 0: 1
1: 0
2: 0
3: 11
4: 78
Right 1167251100 19:48398836-48398858 CGCGCTCGTGCTCACGCCCAAGG 0: 1
1: 0
2: 0
3: 6
4: 44
1167251098_1167251110 17 Left 1167251098 19:48398820-48398842 CCGTGCACGGCGGCGCCGCGCTC 0: 1
1: 0
2: 0
3: 11
4: 78
Right 1167251110 19:48398860-48398882 GCGCGCGACCGGGGCGGGGCGGG 0: 2
1: 1
2: 10
3: 131
4: 727
1167251098_1167251116 30 Left 1167251098 19:48398820-48398842 CCGTGCACGGCGGCGCCGCGCTC 0: 1
1: 0
2: 0
3: 11
4: 78
Right 1167251116 19:48398873-48398895 GCGGGGCGGGGCCACAGGAGGGG 0: 1
1: 0
2: 3
3: 85
4: 651
1167251098_1167251111 18 Left 1167251098 19:48398820-48398842 CCGTGCACGGCGGCGCCGCGCTC 0: 1
1: 0
2: 0
3: 11
4: 78
Right 1167251111 19:48398861-48398883 CGCGCGACCGGGGCGGGGCGGGG 0: 1
1: 1
2: 11
3: 115
4: 729

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167251098 Original CRISPR GAGCGCGGCGCCGCCGTGCA CGG (reversed) Exonic