ID: 1167251107

View in Genome Browser
Species Human (GRCh38)
Location 19:48398855-48398877
Sequence AAGGTGCGCGCGACCGGGGC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 145}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167251093_1167251107 30 Left 1167251093 19:48398802-48398824 CCTCGCTGCCCATCGTGGCCGTG 0: 1
1: 0
2: 0
3: 4
4: 145
Right 1167251107 19:48398855-48398877 AAGGTGCGCGCGACCGGGGCGGG 0: 1
1: 0
2: 2
3: 8
4: 145
1167251099_1167251107 -3 Left 1167251099 19:48398835-48398857 CCGCGCTCGTGCTCACGCCCAAG 0: 1
1: 0
2: 0
3: 2
4: 44
Right 1167251107 19:48398855-48398877 AAGGTGCGCGCGACCGGGGCGGG 0: 1
1: 0
2: 2
3: 8
4: 145
1167251095_1167251107 22 Left 1167251095 19:48398810-48398832 CCCATCGTGGCCGTGCACGGCGG 0: 1
1: 0
2: 0
3: 3
4: 150
Right 1167251107 19:48398855-48398877 AAGGTGCGCGCGACCGGGGCGGG 0: 1
1: 0
2: 2
3: 8
4: 145
1167251097_1167251107 21 Left 1167251097 19:48398811-48398833 CCATCGTGGCCGTGCACGGCGGC 0: 1
1: 0
2: 1
3: 31
4: 285
Right 1167251107 19:48398855-48398877 AAGGTGCGCGCGACCGGGGCGGG 0: 1
1: 0
2: 2
3: 8
4: 145
1167251098_1167251107 12 Left 1167251098 19:48398820-48398842 CCGTGCACGGCGGCGCCGCGCTC 0: 1
1: 0
2: 0
3: 11
4: 78
Right 1167251107 19:48398855-48398877 AAGGTGCGCGCGACCGGGGCGGG 0: 1
1: 0
2: 2
3: 8
4: 145

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167251107 Original CRISPR AAGGTGCGCGCGACCGGGGC GGG Exonic