ID: 1167253960

View in Genome Browser
Species Human (GRCh38)
Location 19:48416011-48416033
Sequence CAGCGCGCAGACATGGCCAT CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 68
Summary {0: 1, 1: 1, 2: 3, 3: 3, 4: 60}

Found 15 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167253954_1167253960 -5 Left 1167253954 19:48415993-48416015 CCACCCCAGGTGTTCTACCAGCG 0: 1
1: 0
2: 0
3: 3
4: 81
Right 1167253960 19:48416011-48416033 CAGCGCGCAGACATGGCCATCGG 0: 1
1: 1
2: 3
3: 3
4: 60
1167253946_1167253960 15 Left 1167253946 19:48415973-48415995 CCGCCCACTCCTCATCGCCCCCA 0: 1
1: 1
2: 2
3: 44
4: 628
Right 1167253960 19:48416011-48416033 CAGCGCGCAGACATGGCCATCGG 0: 1
1: 1
2: 3
3: 3
4: 60
1167253956_1167253960 -9 Left 1167253956 19:48415997-48416019 CCCAGGTGTTCTACCAGCGCGCA 0: 1
1: 0
2: 0
3: 2
4: 14
Right 1167253960 19:48416011-48416033 CAGCGCGCAGACATGGCCATCGG 0: 1
1: 1
2: 3
3: 3
4: 60
1167253953_1167253960 -4 Left 1167253953 19:48415992-48416014 CCCACCCCAGGTGTTCTACCAGC 0: 1
1: 0
2: 9
3: 406
4: 7964
Right 1167253960 19:48416011-48416033 CAGCGCGCAGACATGGCCATCGG 0: 1
1: 1
2: 3
3: 3
4: 60
1167253943_1167253960 18 Left 1167253943 19:48415970-48415992 CCCCCGCCCACTCCTCATCGCCC 0: 1
1: 0
2: 3
3: 41
4: 613
Right 1167253960 19:48416011-48416033 CAGCGCGCAGACATGGCCATCGG 0: 1
1: 1
2: 3
3: 3
4: 60
1167253951_1167253960 -2 Left 1167253951 19:48415990-48416012 CCCCCACCCCAGGTGTTCTACCA 0: 1
1: 0
2: 1
3: 29
4: 230
Right 1167253960 19:48416011-48416033 CAGCGCGCAGACATGGCCATCGG 0: 1
1: 1
2: 3
3: 3
4: 60
1167253948_1167253960 11 Left 1167253948 19:48415977-48415999 CCACTCCTCATCGCCCCCACCCC 0: 1
1: 0
2: 10
3: 185
4: 1688
Right 1167253960 19:48416011-48416033 CAGCGCGCAGACATGGCCATCGG 0: 1
1: 1
2: 3
3: 3
4: 60
1167253947_1167253960 12 Left 1167253947 19:48415976-48415998 CCCACTCCTCATCGCCCCCACCC 0: 1
1: 0
2: 2
3: 49
4: 686
Right 1167253960 19:48416011-48416033 CAGCGCGCAGACATGGCCATCGG 0: 1
1: 1
2: 3
3: 3
4: 60
1167253957_1167253960 -10 Left 1167253957 19:48415998-48416020 CCAGGTGTTCTACCAGCGCGCAG 0: 1
1: 0
2: 0
3: 5
4: 45
Right 1167253960 19:48416011-48416033 CAGCGCGCAGACATGGCCATCGG 0: 1
1: 1
2: 3
3: 3
4: 60
1167253945_1167253960 16 Left 1167253945 19:48415972-48415994 CCCGCCCACTCCTCATCGCCCCC 0: 1
1: 0
2: 3
3: 36
4: 531
Right 1167253960 19:48416011-48416033 CAGCGCGCAGACATGGCCATCGG 0: 1
1: 1
2: 3
3: 3
4: 60
1167253952_1167253960 -3 Left 1167253952 19:48415991-48416013 CCCCACCCCAGGTGTTCTACCAG 0: 1
1: 0
2: 4
3: 157
4: 4461
Right 1167253960 19:48416011-48416033 CAGCGCGCAGACATGGCCATCGG 0: 1
1: 1
2: 3
3: 3
4: 60
1167253942_1167253960 25 Left 1167253942 19:48415963-48415985 CCGGGTTCCCCCGCCCACTCCTC 0: 1
1: 1
2: 2
3: 44
4: 464
Right 1167253960 19:48416011-48416033 CAGCGCGCAGACATGGCCATCGG 0: 1
1: 1
2: 3
3: 3
4: 60
1167253955_1167253960 -8 Left 1167253955 19:48415996-48416018 CCCCAGGTGTTCTACCAGCGCGC 0: 1
1: 0
2: 1
3: 5
4: 59
Right 1167253960 19:48416011-48416033 CAGCGCGCAGACATGGCCATCGG 0: 1
1: 1
2: 3
3: 3
4: 60
1167253950_1167253960 6 Left 1167253950 19:48415982-48416004 CCTCATCGCCCCCACCCCAGGTG 0: 1
1: 1
2: 2
3: 43
4: 413
Right 1167253960 19:48416011-48416033 CAGCGCGCAGACATGGCCATCGG 0: 1
1: 1
2: 3
3: 3
4: 60
1167253944_1167253960 17 Left 1167253944 19:48415971-48415993 CCCCGCCCACTCCTCATCGCCCC 0: 1
1: 0
2: 0
3: 31
4: 397
Right 1167253960 19:48416011-48416033 CAGCGCGCAGACATGGCCATCGG 0: 1
1: 1
2: 3
3: 3
4: 60

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167253960 Original CRISPR CAGCGCGCAGACATGGCCAT CGG Exonic
903009056 1:20317653-20317675 CTGCGAGCAGACATGGCCCACGG - Exonic
905246008 1:36614481-36614503 CTCCATGCAGACATGGCCATGGG + Intergenic
905745886 1:40416926-40416948 TAGCCTGCAGGCATGGCCATGGG - Exonic
916750068 1:167715236-167715258 CAGCGCGTGTACAGGGCCATCGG - Intergenic
919820502 1:201469120-201469142 CAGCGCGCAGACAGAGCCCAGGG - Exonic
922749015 1:228062149-228062171 CAGGGCCCAGAGATGGGCATGGG - Intergenic
1070747321 10:78941907-78941929 CAGTGTGCAGACATGCACATGGG - Intergenic
1087221206 11:95548180-95548202 CAACCTGCAGACAAGGCCATGGG - Intergenic
1087780373 11:102295262-102295284 CAGCAGGTGGACATGGCCATGGG - Intergenic
1088680307 11:112235886-112235908 CAGCAGGCAGATATGGCCATGGG + Intronic
1090381312 11:126329481-126329503 CAGTGGGAAGACATGGCCACTGG - Intronic
1101995767 12:109523886-109523908 CAGGGTGCAGACATGGCCCAGGG - Intronic
1104849978 12:131868210-131868232 CAGTCCGCGCACATGGCCATGGG - Intergenic
1104928287 12:132325001-132325023 CAGCTTGCAGACATGGCTGTGGG + Intronic
1106846299 13:33741386-33741408 CAGAGCACAGACATGCACATAGG - Intergenic
1119552860 14:75528162-75528184 TGGCCCTCAGACATGGCCATAGG + Intronic
1122052683 14:99070770-99070792 CAGTGCCCTGACAGGGCCATGGG - Intergenic
1122844738 14:104486659-104486681 CAGCGGTCAGACACAGCCATGGG + Intronic
1125341795 15:38682858-38682880 CTGCCCACAGACATGGCCGTGGG - Intergenic
1126822710 15:52520544-52520566 CAAGGCTCAGACATGGTCATTGG - Intronic
1128543470 15:68552440-68552462 CAAGGGGCAGCCATGGCCATAGG + Intergenic
1129411354 15:75352233-75352255 CAGCAAGCAGGCATGGGCATGGG + Intronic
1132293311 15:100718206-100718228 CAGCGCGCTGCCTTGGCCCTGGG - Intergenic
1135771741 16:25223085-25223107 CAGCTCACAGACAAGGCCGTTGG - Intronic
1136061233 16:27728117-27728139 CAGCGCCCAGACCCTGCCATGGG - Intronic
1136707307 16:32201045-32201067 CAGAGCTCAGAGCTGGCCATGGG - Intergenic
1136760604 16:32728372-32728394 CAGAGCTCAGAGCTGGCCATGGG + Intergenic
1136807499 16:33142014-33142036 CAGAGCTCAGAGCTGGCCATGGG - Intergenic
1137412836 16:48244229-48244251 CAGCGCGAAGCCATGGCTTTTGG + Intronic
1137676038 16:50304337-50304359 CTGCGGGCAGACATGGACATGGG - Intronic
1137694656 16:50453595-50453617 CAGTGCCCAGGCATGGCCAGCGG + Intergenic
1141523157 16:84594791-84594813 CAGCCCGAAGCCTTGGCCATGGG - Intronic
1203062758 16_KI270728v1_random:988687-988709 CAGAGCTCAGAGCTGGCCATGGG + Intergenic
1151556592 17:74849902-74849924 AAGCGGGCAGACATGGCCATCGG - Exonic
1158625105 18:59064113-59064135 CAGCTCGGGGACATGGTCATGGG - Intergenic
1158779033 18:60624346-60624368 CAGGTCACAGACTTGGCCATAGG - Intergenic
1161040926 19:2110429-2110451 CAGAGGGCAGACTTGGCCACTGG + Intronic
1164594545 19:29525061-29525083 CAGCGCGTAGTCATAGTCATAGG - Intergenic
1167253960 19:48416011-48416033 CAGCGCGCAGACATGGCCATCGG + Exonic
925390317 2:3489912-3489934 CGCAGCGCAGACATGGCCGTCGG - Intergenic
932263432 2:70345868-70345890 CAGCTCGCTCCCATGGCCATGGG + Intergenic
934166669 2:89300181-89300203 GAGAGGGCAGAGATGGCCATGGG - Intergenic
934200612 2:89882276-89882298 GAGAGGGCAGAGATGGCCATGGG + Intergenic
938187048 2:129240811-129240833 GATCGGGCAGACATGGCCTTTGG + Intergenic
945376874 2:209087507-209087529 CAGGGAGCAGTCATGTCCATTGG + Intergenic
947490421 2:230590053-230590075 CCCCTTGCAGACATGGCCATGGG + Intergenic
1174646620 20:52091695-52091717 CCGCGCCCAGCCACGGCCATAGG - Intronic
1175764563 20:61583366-61583388 AAGCACCCAGACATGACCATGGG - Intronic
1180784586 22:18539692-18539714 CAGTGTGCAGACATGGCCATGGG + Intergenic
1181128164 22:20713745-20713767 CAGCGTGCAGACATGGCCATGGG + Intronic
1181241489 22:21479049-21479071 CAGTGTGCAGACATGGCCATGGG + Intergenic
1183098236 22:35567406-35567428 CAGTGTGCAGACCTGGCCATGGG - Intergenic
1184170939 22:42759388-42759410 CAGGGGGCAGACACTGCCATGGG - Intergenic
1184707414 22:46224184-46224206 CCGTGCGCAGACAAGGACATGGG - Intronic
957623237 3:82623038-82623060 CAACGCGAACACATGGACATAGG - Intergenic
969619159 4:8270255-8270277 CAGCGCGCACACGTTGGCATAGG - Exonic
974121692 4:57646065-57646087 TAGAGCCCAGACATGTCCATGGG + Intergenic
977919944 4:102631942-102631964 CAGCACGCAGACATGTCTCTCGG + Exonic
981630256 4:146810207-146810229 CAGCGAGAAGACATGGACACAGG + Intronic
997530814 5:134580099-134580121 CAGTGCCCAGACAGGGTCATGGG + Exonic
999150453 5:149422959-149422981 CAGCCCGCAGCAGTGGCCATGGG - Intergenic
1002805856 6:573369-573391 CAGGGCGAAGGCATGGCCCTGGG - Intronic
1005675413 6:28149487-28149509 CAGCTCGCGTACATGGACATAGG + Exonic
1018381561 6:163262598-163262620 CGATGCTCAGACATGGCCATCGG + Intronic
1018538936 6:164855787-164855809 CAGAGTGCAGGCTTGGCCATGGG + Intergenic
1020248246 7:6447439-6447461 CAGCGCCGAGACCTGGCCCTGGG - Intronic
1035293883 7:157857080-157857102 CAGCACGAGGGCATGGCCATCGG + Intronic
1200886887 Y:8279964-8279986 CAGCCCGCCGCCATCGCCATAGG - Intergenic