ID: 1167254342

View in Genome Browser
Species Human (GRCh38)
Location 19:48418416-48418438
Sequence ACTTTGTCCTGGGGGTGCTA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 192
Summary {0: 1, 1: 2, 2: 0, 3: 26, 4: 163}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167254342 Original CRISPR ACTTTGTCCTGGGGGTGCTA GGG Intronic
903209935 1:21812241-21812263 ACTGTGTCCAGGGGTTGCCATGG - Intergenic
903850538 1:26303139-26303161 CCTTTGGCCTGGTGGTGCTTGGG + Intronic
904591142 1:31616227-31616249 ACTTTGTCCTTGGGCAGGTATGG - Intergenic
905405278 1:37728309-37728331 ACTTTCTCCTGTGGGTGACAGGG + Intronic
907438180 1:54462659-54462681 AGTTTGTCCTGGCGCTGCTGAGG - Intergenic
909201150 1:72691867-72691889 ATTTTGTCCTGGGGGTTCTTTGG + Intergenic
911885596 1:103294920-103294942 TCTTTCTCCTGGGAGTGTTATGG + Intergenic
912133404 1:106629652-106629674 ACTTTGTCCCTTGGGTGGTATGG - Intergenic
915144832 1:153790318-153790340 ACAGTGTCCTGGGCGTGCTTGGG + Intergenic
915349787 1:155217119-155217141 GTTTTGTCCTGGGGGTGGGAGGG - Intergenic
915353044 1:155238396-155238418 GTTTTGTCCTGGGGGTGGGAGGG - Intronic
915593720 1:156884659-156884681 TCTTTGGCCTGGGGATGCAAGGG - Intergenic
916058751 1:161085079-161085101 ACCTTGGCCTTGGAGTGCTAAGG + Intronic
917169542 1:172155703-172155725 ACTCTGTCCTGGAGATACTAAGG + Intronic
917667267 1:177237471-177237493 ATTGTGTCCTGGGGATGCTTGGG - Intronic
917748945 1:178037545-178037567 ACTTCGTCCTGGGATAGCTAGGG - Intergenic
920295082 1:204951126-204951148 AGTTTCTCCTCGGGATGCTATGG + Intronic
921671357 1:217927311-217927333 AGTGTGTCCTGGGAGTGGTAGGG + Intergenic
1064230584 10:13527040-13527062 ACTTTGTCCTGTGAGGTCTAAGG - Intronic
1064316923 10:14266148-14266170 TCTTTGTCCTGGGGGTGGGAGGG + Intronic
1064375291 10:14789919-14789941 GCTTTGTCCTGAGGGTTCTTAGG + Intergenic
1065329271 10:24576962-24576984 TCTTTGTCCTGGGTGTTCTGAGG - Intergenic
1068053521 10:51982675-51982697 CCATTGTGCTGGGGGTGCTGAGG + Intronic
1070820436 10:79350988-79351010 ACTCTGTCCTGGGTCTGCAAGGG + Intronic
1072805856 10:98423768-98423790 ACTTGGTCCTGCAGGTGCTGGGG + Exonic
1074398617 10:113121847-113121869 GTTTTGTCATGGGGGTGCTGAGG + Intronic
1074440207 10:113471350-113471372 CCTTTGTCCTTGGGGTTCAATGG - Intergenic
1075577475 10:123588530-123588552 ACTTTGCCCAGGGGGTGCAGTGG + Intergenic
1081642095 11:44763108-44763130 ACTTTCTCCTGGGGTTGTAAGGG + Intronic
1081957489 11:47106249-47106271 ACTTTGTCTTAGGGGTGGGAAGG + Intronic
1083270167 11:61568121-61568143 ACTTTTTCCTGGGGCGGGTATGG - Intronic
1086137191 11:83453641-83453663 GCTTTGTCCTAAGAGTGCTAAGG + Intergenic
1088716546 11:112554470-112554492 ACTTTGTCCTGGGGCAGTCAGGG + Intergenic
1089504822 11:118956251-118956273 ATTTTGTCCTGGGGGTGGGAGGG - Intronic
1089683091 11:120130361-120130383 ACCTTGTCCTCGGGGTGGTAAGG - Intronic
1095455011 12:42374069-42374091 ACATTGTCCTGGGGGTGGGTGGG + Intronic
1095819218 12:46459218-46459240 GCTTTCCCCTGGGGCTGCTAGGG - Intergenic
1097125082 12:56768073-56768095 ACTTTATCCTGTGGGTGACAGGG + Intronic
1098296263 12:69007154-69007176 ACTTTCTCCTGTGTGTGCTGAGG + Intergenic
1103624665 12:122208638-122208660 ACGTTGGCCTGGGGGTGCTGTGG + Intronic
1103936499 12:124480231-124480253 CCTTTGCCCTGAGGCTGCTAAGG + Intronic
1105443266 13:20432584-20432606 ACTCTGTCCTGGGGAGGCCAGGG - Intronic
1106365414 13:29074322-29074344 GCTTAGTCCGGGTGGTGCTAGGG + Intronic
1108493557 13:51003779-51003801 ACTTTGTCCTGAGGGTCGTAGGG - Intergenic
1109326487 13:60873422-60873444 ACTTTGTCTTGAGGGTGCTGGGG + Intergenic
1113469115 13:110531821-110531843 CCCTGGTCCTGGGGGTGCTCCGG + Intronic
1122286937 14:100657927-100657949 ACTTTGTCCTGGGTGTGAAAGGG + Intergenic
1126316572 15:47376366-47376388 AGTTTGTGCAGGGGGTGCTGAGG - Intronic
1131960242 15:97782644-97782666 ACTTTGATCTTGGGGTGATATGG + Intergenic
1136026991 16:27474960-27474982 ACTCTGTCTTGGGTGTGCTGAGG + Intronic
1136397601 16:30001533-30001555 ACCCTGACGTGGGGGTGCTAGGG + Intronic
1138592056 16:58005850-58005872 TCATTTTGCTGGGGGTGCTAAGG + Intronic
1138835804 16:60433328-60433350 ACTTTGTATTGGGGCTGTTAGGG + Intergenic
1139371941 16:66474421-66474443 ACTCTGTCCTGAGGGTGATGGGG - Intronic
1139613044 16:68072625-68072647 ACTTTGTCCTGAGCGTGCCGTGG + Intronic
1139699764 16:68700903-68700925 GCTTTGTCCTGAGGGTGCCATGG - Intronic
1139764092 16:69212286-69212308 ACTTTGAAGTGGGGGTGGTAGGG - Intronic
1141216838 16:82033094-82033116 ACTCTGTCCTGGGGCTCCCAAGG - Intergenic
1141453324 16:84120211-84120233 TCTTTTTCCTGGGGCTGCTCAGG - Intergenic
1143490690 17:7283758-7283780 ACAATGTCCTGGCGGTGCTGGGG + Exonic
1143965974 17:10756723-10756745 TCTTTGTCCTGGGGGTGGAGTGG + Intergenic
1146032214 17:29376080-29376102 ACTTTGTCTTTTGGGTGCCATGG - Intergenic
1146744254 17:35313968-35313990 ACGCTGGCCTGGGGGTGGTAGGG + Intergenic
1149648057 17:58254756-58254778 ACTGGGTCCTGGGGCTGTTAGGG + Intronic
1152471255 17:80491133-80491155 ACTTTGTCCTGGGCAGGCTATGG + Intergenic
1152918967 17:83056167-83056189 GCTTTATTATGGGGGTGCTATGG - Intergenic
1154147212 18:11876112-11876134 ACTTTTCTCTGGGGGTGCTATGG - Intronic
1157720534 18:49920489-49920511 ACTATGTCCTGGGCCTCCTAGGG + Intronic
1157769932 18:50337116-50337138 ATTTTGTCCTGGGGGCCCTTTGG + Intergenic
1161121746 19:2530847-2530869 ACTTTTTCCTGGGGTTGGGAGGG + Intronic
1161422177 19:4182096-4182118 ACTTTATCCTGAGGGTGATGGGG - Intronic
1161642767 19:5434787-5434809 ACTTTGTCCTGAGGGCGATAGGG + Intergenic
1163171546 19:15534987-15535009 ACTTTATCCTGGGAGTGATAGGG + Intronic
1163534426 19:17869041-17869063 ATTTTGTTCTGAGGGTGCTGGGG - Intergenic
1163562386 19:18027357-18027379 ACTTTCTCCTGAGGGTAATAGGG - Intergenic
1164896896 19:31884726-31884748 ACTTTGTTTTGGGAGGGCTAGGG - Intergenic
1166132518 19:40754745-40754767 ACTTTGCCCTGAGGGTGTTGGGG + Intronic
1166212551 19:41316437-41316459 ACTTTGTCCTGGGGTTTAGATGG - Exonic
1166360334 19:42250474-42250496 ACTTTATCCTGGAGCTGCTGCGG - Exonic
1166365500 19:42276315-42276337 ACTGTATCCTGAGGGTACTAGGG + Intronic
1166388922 19:42397980-42398002 ACTTTGTCCTGAGGGTGAGGGGG + Intergenic
1166558228 19:43715814-43715836 ACTTTGTCCTTGGGGGGTGATGG + Intergenic
1167077699 19:47259296-47259318 ACTTTGTCCTGAGGGCACTGGGG + Intronic
1167236587 19:48319359-48319381 ACTTTGTCCTGCAGGTACTGGGG - Intronic
1167254342 19:48418416-48418438 ACTTTGTCCTGGGGGTGCTAGGG + Intronic
1167267062 19:48488498-48488520 ACTTTGTCCTGGGGGTGCCAGGG - Intronic
1167376911 19:49117358-49117380 ACTTTGTCCCATGGGTGCTGGGG + Intronic
1167411691 19:49347732-49347754 GCTTTGCCCTGGGGCTGCTGGGG - Intronic
1167476201 19:49702719-49702741 ACTCTTTCCTGGGGGTACTAGGG + Intronic
1167573921 19:50308701-50308723 ACCTTGTCCCGGGGGTACTGGGG + Intronic
1167631990 19:50631054-50631076 ACTTTGTCCTGAGGGCACTGAGG - Intronic
1167667700 19:50832264-50832286 ACTTTATCCTGGTGGTGCCAAGG - Intronic
1167747979 19:51364011-51364033 ACTCTGTCCTGAGGGTGCTGGGG + Intronic
1168270258 19:55245898-55245920 AGCTTGTCTTGGGGGTGGTAAGG - Intronic
925019121 2:554616-554638 ACCGTGTCCTGGGGGTGACATGG + Intergenic
926438296 2:12860093-12860115 ACATTTTCCTGGCAGTGCTATGG - Intergenic
926945164 2:18179807-18179829 ACTTTTGCCTGCAGGTGCTAGGG - Intronic
929556495 2:42928810-42928832 GCTTTCTCCTGGGGGAGCCAAGG - Intergenic
932948885 2:76269963-76269985 GCTTTGTCCTGGGTGTTCCAGGG + Intergenic
935229523 2:101083742-101083764 ACCTTGTCCTGGGGCTGCCCAGG + Intronic
935647616 2:105353308-105353330 ACTACGTTCTGAGGGTGCTATGG - Intergenic
938208338 2:129442683-129442705 ACTTTTGCCTGGGGTTTCTATGG - Intergenic
944596430 2:201265629-201265651 GCTTTGTCCTGGAGGTGATGAGG - Intronic
947634420 2:231672921-231672943 ACTGTGTGCAGGGGGTGCTCTGG - Intergenic
948125639 2:235563086-235563108 GCTTTGCCCTGGGGCTGCTGTGG + Intronic
948207521 2:236170038-236170060 TCTTTGTCCGGGTGGTGGTAGGG - Intergenic
1168971523 20:1934442-1934464 ACTTGGTGCTGGGGAAGCTATGG - Intronic
1170335509 20:15266685-15266707 ACTTTGTCCTGGGAGTGATGGGG - Intronic
1170564114 20:17585214-17585236 ACTTTATCTTGTGGGTGCTTGGG + Intronic
1171349459 20:24491557-24491579 ACCTTGTCCTGGGTCTGCTATGG - Intronic
1172971906 20:38879858-38879880 ATCTTGTCCTGGTGGTGCTAAGG + Intronic
1173331490 20:42079491-42079513 GCTCTCTCCTGGGGGTTCTAAGG + Exonic
1175318800 20:58071123-58071145 TCTATGTCCTGGAGGTGCTCGGG + Intergenic
1175393485 20:58642652-58642674 ACCTTGTCCTTGGGGCACTACGG + Intergenic
1175884320 20:62280306-62280328 AGTGTGTCCTGGGGCTGGTATGG + Intronic
1177836365 21:26190009-26190031 ACTTTGTTGGGGGGGTGCTCAGG - Intergenic
1181911620 22:26242854-26242876 ACTTTGTCATGGTGGCCCTAGGG - Intronic
1182416857 22:30226861-30226883 ACTTGGTCCTGAAGGTACTAGGG + Intergenic
1183192590 22:36331314-36331336 ACTTTCTCGTGGCGGTGCCAGGG - Intronic
1184928111 22:47658520-47658542 TCTTTCTCCTGGAGTTGCTAGGG + Intergenic
1185338866 22:50282874-50282896 ACTTCGTCCTGGGGGAGGGAGGG + Exonic
949409784 3:3751098-3751120 ACTATGGCCTGTGGGTGCTAAGG - Intronic
949487379 3:4553001-4553023 ACTTTGTGTTGGGGATGCTGGGG - Intronic
951061355 3:18210604-18210626 ACTTTGTCCTGAAGATGATAGGG + Intronic
952325888 3:32320456-32320478 ACCTTGGCCTGAGGGTGGTAGGG + Intronic
952468767 3:33621168-33621190 ATTTTGTCCTGGAGGCACTATGG - Intronic
952946345 3:38479983-38480005 ACTGTGTCCTGGGGATGGCATGG + Intronic
954571650 3:51645946-51645968 ATCTGGTCCTGGGAGTGCTAAGG + Intronic
956524792 3:70146116-70146138 ACTTTGTACTGGGTGAGCTTTGG - Intergenic
956849465 3:73215234-73215256 ACTTTGTCTTGATGGTGCTTTGG - Intergenic
962610626 3:137073310-137073332 ACTTTCTCCTGTAGGTGCTGGGG + Intergenic
963791961 3:149592507-149592529 ACTTTGTCGTTGGGATGCTTTGG - Intronic
968226390 3:196974990-196975012 ACTTTTTCCTGGGAGTGATGAGG + Intergenic
968436120 4:590426-590448 ATTTTGGCCTGGAGGTGCAAGGG - Intergenic
968657102 4:1783427-1783449 ATTTTGTCTCGGGGGAGCTAAGG + Intergenic
968788655 4:2643679-2643701 CATCTGTCCTGGGGGTGCTTTGG + Intronic
971373117 4:26034141-26034163 GCTCTGTCCTGGGGATGCTGGGG + Intergenic
972691497 4:41403194-41403216 AATTTCTCCTGGGGGTGGTGGGG + Intronic
978591551 4:110329730-110329752 ACTATGTCCTGGGGCTGCATAGG - Intergenic
979192692 4:117882263-117882285 ACTTTGTCCTGGGAGGCCCATGG + Intergenic
979473694 4:121130021-121130043 ACTTTGTCTTGGTTGTGATATGG - Intergenic
987059924 5:14232902-14232924 ACTTGGAGCTGGGGGTGCCAGGG + Intronic
988388829 5:30600891-30600913 ACTCTGTCCTGGGGGCATTATGG - Intergenic
989112417 5:37919426-37919448 ACCTGGTCCTAGGGTTGCTAAGG - Intergenic
989130887 5:38105721-38105743 ACTCTGTCCTGGGGTTGTTCTGG + Intergenic
994041509 5:95264682-95264704 ACTGTGGCCAGGGGGTGCTTTGG - Intronic
994097858 5:95863291-95863313 AGTTTGTCCTGGAGGTCCTAAGG + Intergenic
995565855 5:113432793-113432815 ATTTTCTTCTGGGGGTGCTGGGG + Exonic
995735400 5:115295704-115295726 ACATTCTCATGGGGGTGCGAGGG + Intronic
996829638 5:127726566-127726588 ATTTTCTCCTGTGGGTGCTGGGG + Intergenic
998517457 5:142769529-142769551 ACTATGTGCTGTGTGTGCTACGG - Intergenic
1002254705 5:177950591-177950613 CCTTTGTACTGGGGATGCTCAGG + Intergenic
1007414570 6:41684189-41684211 AACTGGTCCTGGGGGTGCTCAGG - Exonic
1010546699 6:77166840-77166862 ACTTTTTTCTAGGGGTACTAGGG + Intergenic
1010774535 6:79869871-79869893 ACTTTCTCCTGGAGGGGCTGCGG + Intergenic
1012034221 6:94111107-94111129 ACTTTGCCCTGGGGGTCCCATGG - Intergenic
1012131568 6:95499992-95500014 CCTGTGTCCTGGGGGTGACAGGG - Intergenic
1013886998 6:114980001-114980023 ACTTTGTCTTGGAGGTGTCAGGG - Intergenic
1014315242 6:119856328-119856350 AATTTCTCCTGTGGGTGATATGG + Intergenic
1014817040 6:125947472-125947494 ACTTTGCCTTGGGGGTGGCAAGG - Intergenic
1015753857 6:136588574-136588596 ACTATGTGCTGGGGATGCTGTGG - Intronic
1017216875 6:151918376-151918398 GATTTCTCCTGGGGGTGCAAAGG - Intronic
1019106775 6:169674701-169674723 ACTTTATCATTGGGGTTCTACGG - Intronic
1019602291 7:1890776-1890798 ACTTTGTCCTTGGGGAGCTGAGG + Intronic
1020582765 7:10026244-10026266 ACTTCTTGCTGTGGGTGCTAGGG + Intergenic
1022959559 7:35413536-35413558 ACTTTCTCTTGGGGGTGCCTTGG + Intergenic
1023505929 7:40899677-40899699 ACTGTGTTGTGGGGGTGATATGG - Intergenic
1025254461 7:57374132-57374154 ACTTTGTCCTGTGGGTAAAAGGG + Intergenic
1026071292 7:67122828-67122850 ACTTTGTCCTCAGTGTGCTAAGG - Intronic
1026705600 7:72689460-72689482 ACTTTGTCCTCAGTGTGCTAAGG + Intronic
1029176723 7:98669924-98669946 ACTTAGTCCTGGGGAGGCAAAGG - Intergenic
1032617628 7:133492038-133492060 TTTTTGTCCTGCGGGTGATAAGG + Intronic
1033139135 7:138809341-138809363 GCTTTGTCCTGGACGTGCTCTGG + Intronic
1033894514 7:146054435-146054457 ACTTTACCTTGAGGGTGCTAAGG - Intergenic
1038781327 8:30570555-30570577 GCTTTGTCCTGGAGATGCTGTGG - Intronic
1041206126 8:55499418-55499440 ACTCTGTCCTTGGGGTCCCAAGG - Intronic
1041707270 8:60859825-60859847 ATTTTGTCCTGGAGGTAATAGGG + Intronic
1047386038 8:124410166-124410188 GCTAGGTACTGGGGGTGCTATGG - Intergenic
1048825044 8:138416140-138416162 ATTTTGTCCTGGGGGATCAAGGG - Intronic
1049393399 8:142383410-142383432 ACTCTGTCCTGGGTGTGCTTGGG - Intronic
1050265419 9:3884519-3884541 ACTAGGTCTTGGGGGTGCTGAGG + Intronic
1056460168 9:86801649-86801671 ACTCTGTCCTCAGGCTGCTAAGG + Intergenic
1057303599 9:93900121-93900143 ACTTTGTCCTGGGGGTACTAGGG - Intergenic
1057877829 9:98771364-98771386 ATTTTGTCCTGGATGTGCTGAGG - Intronic
1058542058 9:106021743-106021765 ACTTTGTCCTGGTGCTGCCTGGG + Intergenic
1060297276 9:122351271-122351293 GTTTTGTCCTGGGGGTAATAGGG - Intergenic
1060543534 9:124447491-124447513 ACTTTCTCCTGGAGGCACTAGGG + Intergenic
1060971108 9:127738658-127738680 ACAGTGTCCTTGGGGTGCTCTGG + Exonic
1061573847 9:131494170-131494192 GCTCTGTCCTGGAGGTGCCAGGG + Intronic
1062428078 9:136515210-136515232 ACTCTGCCCTGGGGCTGCTGAGG - Intronic
1185761000 X:2690328-2690350 ACCTTGTCCTGGGGATTCTGGGG + Intergenic
1199546572 X:149012538-149012560 ACTTTATCCTGGGAGTGATGGGG - Intergenic