ID: 1167254424

View in Genome Browser
Species Human (GRCh38)
Location 19:48418727-48418749
Sequence GCTCCCACGCTCCTCATGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167254424_1167254429 -4 Left 1167254424 19:48418727-48418749 CCCATCATGAGGAGCGTGGGAGC No data
Right 1167254429 19:48418746-48418768 GAGCTGGTCTGGGCTCAGCATGG 0: 1
1: 0
2: 6
3: 51
4: 539
1167254424_1167254435 28 Left 1167254424 19:48418727-48418749 CCCATCATGAGGAGCGTGGGAGC No data
Right 1167254435 19:48418778-48418800 AATGGCCTGAGGAGATGGCTGGG 0: 1
1: 0
2: 2
3: 18
4: 198
1167254424_1167254431 10 Left 1167254424 19:48418727-48418749 CCCATCATGAGGAGCGTGGGAGC No data
Right 1167254431 19:48418760-48418782 TCAGCATGGGACATGATGAATGG 0: 1
1: 0
2: 2
3: 8
4: 138
1167254424_1167254432 17 Left 1167254424 19:48418727-48418749 CCCATCATGAGGAGCGTGGGAGC No data
Right 1167254432 19:48418767-48418789 GGGACATGATGAATGGCCTGAGG No data
1167254424_1167254430 -3 Left 1167254424 19:48418727-48418749 CCCATCATGAGGAGCGTGGGAGC No data
Right 1167254430 19:48418747-48418769 AGCTGGTCTGGGCTCAGCATGGG 0: 1
1: 0
2: 1
3: 30
4: 246
1167254424_1167254436 29 Left 1167254424 19:48418727-48418749 CCCATCATGAGGAGCGTGGGAGC No data
Right 1167254436 19:48418779-48418801 ATGGCCTGAGGAGATGGCTGGGG 0: 1
1: 0
2: 3
3: 30
4: 327
1167254424_1167254434 27 Left 1167254424 19:48418727-48418749 CCCATCATGAGGAGCGTGGGAGC No data
Right 1167254434 19:48418777-48418799 GAATGGCCTGAGGAGATGGCTGG 0: 1
1: 0
2: 1
3: 22
4: 257
1167254424_1167254433 23 Left 1167254424 19:48418727-48418749 CCCATCATGAGGAGCGTGGGAGC No data
Right 1167254433 19:48418773-48418795 TGATGAATGGCCTGAGGAGATGG 0: 1
1: 0
2: 0
3: 23
4: 294

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167254424 Original CRISPR GCTCCCACGCTCCTCATGAT GGG (reversed) Intronic
No off target data available for this crispr