ID: 1167255023

View in Genome Browser
Species Human (GRCh38)
Location 19:48422123-48422145
Sequence GCATCCCAGAAAATATCCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 135}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167255023_1167255030 11 Left 1167255023 19:48422123-48422145 CCTTGGGATATTTTCTGGGATGC 0: 1
1: 0
2: 1
3: 10
4: 135
Right 1167255030 19:48422157-48422179 ATTCTGGGGTGAGACTGATGGGG 0: 1
1: 0
2: 2
3: 30
4: 203
1167255023_1167255027 -3 Left 1167255023 19:48422123-48422145 CCTTGGGATATTTTCTGGGATGC 0: 1
1: 0
2: 1
3: 10
4: 135
Right 1167255027 19:48422143-48422165 TGCAGTATTTCTGGATTCTGGGG 0: 1
1: 0
2: 2
3: 25
4: 269
1167255023_1167255025 -5 Left 1167255023 19:48422123-48422145 CCTTGGGATATTTTCTGGGATGC 0: 1
1: 0
2: 1
3: 10
4: 135
Right 1167255025 19:48422141-48422163 GATGCAGTATTTCTGGATTCTGG 0: 1
1: 0
2: 1
3: 21
4: 194
1167255023_1167255028 9 Left 1167255023 19:48422123-48422145 CCTTGGGATATTTTCTGGGATGC 0: 1
1: 0
2: 1
3: 10
4: 135
Right 1167255028 19:48422155-48422177 GGATTCTGGGGTGAGACTGATGG 0: 1
1: 0
2: 0
3: 20
4: 297
1167255023_1167255029 10 Left 1167255023 19:48422123-48422145 CCTTGGGATATTTTCTGGGATGC 0: 1
1: 0
2: 1
3: 10
4: 135
Right 1167255029 19:48422156-48422178 GATTCTGGGGTGAGACTGATGGG 0: 1
1: 0
2: 2
3: 21
4: 242
1167255023_1167255026 -4 Left 1167255023 19:48422123-48422145 CCTTGGGATATTTTCTGGGATGC 0: 1
1: 0
2: 1
3: 10
4: 135
Right 1167255026 19:48422142-48422164 ATGCAGTATTTCTGGATTCTGGG 0: 1
1: 0
2: 2
3: 20
4: 239

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167255023 Original CRISPR GCATCCCAGAAAATATCCCA AGG (reversed) Intronic
901423371 1:9165486-9165508 GCCGCCCAGAAAATACTCCAGGG - Intergenic
904626594 1:31809443-31809465 CCACCCCAGAAAATATTCCCTGG + Intronic
906550778 1:46664956-46664978 GTATCAGAGAAAATTTCCCATGG - Intronic
909040550 1:70644526-70644548 GCATCCCAGGAAATATCACAGGG + Intergenic
912122234 1:106485773-106485795 TTATCCCAGAAAAGTTCCCAAGG - Intergenic
915527299 1:156483704-156483726 GGGTCTCAGAGAATATCCCATGG + Intronic
917435248 1:175014686-175014708 GGATCCCAGAAAGTTGCCCATGG + Exonic
917958826 1:180126526-180126548 ACATCCTAGAAAAGACCCCAAGG + Intergenic
919587966 1:199463043-199463065 TCATCTCACAGAATATCCCAAGG + Intergenic
921124629 1:212166495-212166517 GAATGCCAGAAAATATGCCATGG + Intergenic
923202268 1:231724198-231724220 GCATCCCAGGAGACAGCCCAGGG - Intronic
923858886 1:237873004-237873026 GCATCACATAAAATAATCCATGG + Intergenic
924765696 1:247030373-247030395 GCATCCCAGAAATTTTGACAAGG - Intergenic
1064429831 10:15261280-15261302 GCATCTCAGAAAAGAGCCCCAGG - Intronic
1064622843 10:17231876-17231898 TAATCCCAGTAAATATTCCAGGG - Intronic
1066022228 10:31315576-31315598 GCCTCCCAGGAGATATCACAGGG - Intergenic
1066613074 10:37269941-37269963 ACATCCCAGAAAATGTCTAATGG + Intronic
1069581696 10:69571068-69571090 GCATCCTAGGAATTTTCCCAAGG - Intergenic
1071512496 10:86271321-86271343 GCATTCCAGAATAAAGCCCAAGG + Intronic
1072357625 10:94626825-94626847 GCATCCCAGCTAATTTCCCATGG + Intergenic
1072785639 10:98278878-98278900 GCATCACAGAAGAAATCTCAAGG - Intergenic
1081598586 11:44476310-44476332 GGAGCCCAGAAAACATCCAATGG + Intergenic
1084488733 11:69466151-69466173 GCACGCCAGAAGATATGCCATGG + Intergenic
1089088284 11:115842750-115842772 TCATCCGAGAAAGAATCCCAAGG - Intergenic
1090535561 11:127637438-127637460 GTATTCCAGAACATAGCCCAGGG - Intergenic
1092972216 12:13707265-13707287 GCATCTCAGAAGATCTCACAGGG + Intronic
1095277245 12:40301036-40301058 GCATCACACAAAAAATCTCACGG - Intronic
1096346967 12:50857308-50857330 GCTTCCTAGAATTTATCCCAAGG - Intronic
1097436041 12:59552553-59552575 GTATCACAGACAATATCACAGGG - Intergenic
1099997854 12:89798422-89798444 TCTTCTCAGAAAATATGCCAAGG + Intergenic
1108829576 13:54460869-54460891 GGCTCCCAGAAAGTGTCCCAAGG - Intergenic
1111728737 13:92045456-92045478 CAAGCCCATAAAATATCCCAGGG - Intronic
1112159097 13:96849687-96849709 ACATCCCTGAAAATAACCAATGG - Intergenic
1112738863 13:102451665-102451687 GCATCCCAGAAGAACTCTCATGG - Intergenic
1115878248 14:37885660-37885682 GGACCTCAGTAAATATCCCATGG - Intronic
1116890712 14:50265451-50265473 GCATCCCAGAATTTTTCCTATGG - Exonic
1118295558 14:64565881-64565903 GAACCCCAGATAAAATCCCAGGG + Intronic
1120025517 14:79579703-79579725 GCATGCAACAAAATATCACATGG - Intronic
1122017358 14:98807636-98807658 CCTTCCCACAAAAGATCCCATGG + Intergenic
1124458862 15:29870564-29870586 TCATTCCAGAGAATTTCCCAGGG - Intronic
1127721168 15:61701349-61701371 GCAGACCATAAAATATCCCCTGG - Intergenic
1128183241 15:65623384-65623406 GCTTCCCAGAGAATATGGCATGG - Intronic
1129063721 15:72883263-72883285 GAATCCCAGAATAAATCTCAAGG - Intergenic
1131869143 15:96743709-96743731 GCATGCCATTAAATATCACATGG - Intergenic
1134347082 16:13401110-13401132 CCATCCCACAGAATCTCCCAAGG + Intergenic
1139236905 16:65349321-65349343 CCATCCCAGTAAATATGCCATGG + Intergenic
1141137824 16:81478119-81478141 CCACCCCAGAAAGTATCCCAGGG + Intronic
1145011421 17:19370498-19370520 CCATCCCAGAACATTCCCCAAGG - Intronic
1145258589 17:21341487-21341509 GGATCCCAGAATGTATCCCCTGG - Intergenic
1145318036 17:21746518-21746540 GGATCCCAGAATGTATCCCCTGG + Intergenic
1147483383 17:40788511-40788533 AAATAGCAGAAAATATCCCAAGG + Intergenic
1149576784 17:57719330-57719352 GCATCTCCGACAATACCCCAAGG + Intergenic
1153604646 18:6819651-6819673 GGCTCCCAGCAAAAATCCCAAGG - Intronic
1159877109 18:73824950-73824972 ACATCCCAGAAAAGATCCTTTGG - Intergenic
1159962152 18:74563733-74563755 GCCTCCTAGAAAATAACCCAGGG - Intronic
1162281301 19:9700157-9700179 GCACTCCAGAAAACATCCCATGG + Intronic
1164738922 19:30562279-30562301 GGAAACCAGAACATATCCCAGGG - Intronic
1165789650 19:38483757-38483779 GGAACCCAGACAATACCCCAAGG + Intronic
1166259110 19:41625749-41625771 ACATTCAAGCAAATATCCCAGGG - Exonic
1167255023 19:48422123-48422145 GCATCCCAGAAAATATCCCAAGG - Intronic
1168672359 19:58250252-58250274 GCAACTCAGAATATTTCCCAAGG - Intronic
927499657 2:23574226-23574248 CCATCCCAGGAAAGATCTCATGG - Intronic
929038221 2:37717374-37717396 ACATTCCAGCAAGTATCCCAAGG - Intronic
931825230 2:65993587-65993609 GCTTCACATTAAATATCCCAGGG - Intergenic
933401417 2:81801901-81801923 TCATTCCAGAAAGTATCACAAGG + Intergenic
933574576 2:84053006-84053028 GTGTCAAAGAAAATATCCCATGG - Intergenic
937925575 2:127165186-127165208 ACAGCCCAGAAAATGCCCCAGGG + Intergenic
939538753 2:143466114-143466136 GGGTCCCAGCAAATATCCCCAGG + Intronic
939971681 2:148669354-148669376 GCATCCCAGAACAAAGCTCAAGG - Intronic
940265705 2:151833932-151833954 ACATCCCAGAAAATATTGTAAGG + Exonic
943429367 2:187778704-187778726 TAATCCCAGAAAATATTCCCTGG + Intergenic
944480660 2:200154288-200154310 GCATCCCAGAAAATAGCAACAGG + Intergenic
945026969 2:205629099-205629121 GCAGCCTGGAAAATATCCTAAGG - Intergenic
946635062 2:221715943-221715965 GCATCCAAGAAAAATTTCCAGGG - Intergenic
948294882 2:236853281-236853303 GAATCCAAACAAATATCCCATGG + Intergenic
1169976383 20:11333339-11333361 GCATCCTAGAAAACCTCCCAAGG + Intergenic
1172518876 20:35554614-35554636 GCTCCCCAGAAGAAATCCCATGG - Intronic
1173164723 20:40679317-40679339 GCATCCCAGCAAATGTGCCAAGG - Intergenic
1177504646 21:22004468-22004490 GCATCCCATAAAATATATTATGG - Intergenic
950661036 3:14467156-14467178 CAAACCCAGAAAATCTCCCAGGG - Intronic
951564838 3:24002927-24002949 GAAACCCAGAAAGTGTCCCAAGG - Intergenic
951839063 3:27013951-27013973 CTTTCTCAGAAAATATCCCAGGG - Intergenic
953063154 3:39444495-39444517 GCATGCCAGAAAATATTCTAAGG - Intergenic
956432345 3:69199848-69199870 GCAGCCCAGAAAACATAGCAAGG - Intronic
956637460 3:71380449-71380471 GCTTCCCAGAAAATATTGCTTGG + Intronic
960951386 3:123000747-123000769 GCATCCCTCAAAAAATGCCATGG - Intronic
963426050 3:145125426-145125448 ACAGCCCAGAAAGTATCACATGG - Intergenic
965489674 3:169320980-169321002 ACTTACCAGAAAATAACCCAGGG + Intronic
965606570 3:170503412-170503434 GCATCCAAGAAAATATCATCAGG - Intronic
967701256 3:192594722-192594744 ACATGGCAGAAAATATCACATGG - Intronic
969100054 4:4762042-4762064 TCATCCTCGAAAATATCCCTGGG - Intergenic
970365572 4:15354675-15354697 GAATTCCAGAAAATCTTCCAGGG + Intronic
971598235 4:28559440-28559462 AAAGCCCAGCAAATATCCCAGGG - Intergenic
972891195 4:43558030-43558052 CCATCCCACAACAGATCCCAAGG - Intergenic
974653271 4:64783238-64783260 GTAGCTCAGAAACTATCCCATGG + Intergenic
975163898 4:71155161-71155183 CCAACCCAGATAATTTCCCATGG + Intergenic
975974253 4:80076849-80076871 GCTTGCCAGGAACTATCCCAGGG - Intronic
976942765 4:90726457-90726479 GCATCCTAGGGACTATCCCAAGG + Intronic
978249635 4:106614949-106614971 GTATCACTTAAAATATCCCAGGG + Intergenic
978256548 4:106699098-106699120 GCATCACTGAAAATATCCTCAGG - Intergenic
980431626 4:132707052-132707074 GAATGGGAGAAAATATCCCAGGG - Intergenic
981911094 4:149982431-149982453 GCTTCCCTGCAAACATCCCAGGG - Intergenic
982122026 4:152151902-152151924 GCTTGCCTGAACATATCCCATGG + Intergenic
983625352 4:169796626-169796648 ACTTCTCTGAAAATATCCCATGG - Intergenic
984679898 4:182595120-182595142 TTATGCAAGAAAATATCCCACGG + Intronic
984872303 4:184336617-184336639 GCATGACAGAAAATTACCCAAGG + Intergenic
985970395 5:3373596-3373618 CCATCCCACAACACATCCCAAGG - Intergenic
987194541 5:15512506-15512528 GGTTCCCAGAAAATATGACACGG - Intronic
988445043 5:31276336-31276358 GCATGCCAAAATATTTCCCAGGG + Intronic
994587532 5:101728976-101728998 ACTTCCCAGAAAACATCCCCAGG + Intergenic
994990152 5:106985812-106985834 GCATCACAGAAGATATTCTAAGG + Intergenic
995948595 5:117681744-117681766 GCCTCCCAGATAGAATCCCAGGG + Intergenic
998521116 5:142801562-142801584 GCAGCCTTGAAAATATGCCAGGG - Intronic
998852240 5:146362354-146362376 TTACCACAGAAAATATCCCATGG + Intergenic
1001193126 5:169648772-169648794 GCATACCAGACACTATTCCAAGG - Intronic
1003412182 6:5875455-5875477 GAATCCCAGAAACTTTCTCAAGG - Intergenic
1004619557 6:17321084-17321106 GCATCACAGAAAACATTTCATGG - Intergenic
1008653206 6:53584750-53584772 GCTTCCTAGAATATATCCCTTGG - Intronic
1009261391 6:61494109-61494131 GCATAAAAGCAAATATCCCATGG - Intergenic
1013570034 6:111413479-111413501 GAATCCCAGAAATTAGCCCAAGG + Intronic
1013794628 6:113873194-113873216 TCATCCCAGCAAACATCCAATGG - Intergenic
1014780470 6:125559347-125559369 ACATCCCAGAAAACCTCTCATGG + Intergenic
1017958538 6:159200996-159201018 ACATATCACAAAATATCCCAAGG - Intronic
1018182213 6:161234100-161234122 GCAGCCCAGAAATTCCCCCAAGG + Intronic
1021803981 7:24336844-24336866 GCACCTCAGAAAATGTCCAAAGG + Intergenic
1022604995 7:31804139-31804161 GCATCCCAGAATAAAGCTCAAGG - Intronic
1023113487 7:36837925-36837947 ACATTCCAGGAAATATGCCATGG - Intergenic
1025321375 7:58097371-58097393 GTTTCCCATAAAATATCACAAGG + Intergenic
1025595661 7:62921796-62921818 GCAACAAAGAAAGTATCCCAGGG + Intergenic
1026393777 7:69929951-69929973 GCATCCCAGAACAAAGCTCAAGG - Intronic
1028486140 7:91359625-91359647 GCATCCCAGAGAATCACCCCAGG + Intergenic
1029874260 7:103732281-103732303 GCTTTCCAGAAACTAGCCCATGG - Intronic
1032317810 7:130856103-130856125 CCATCCCACAACAGATCCCAAGG + Intergenic
1042344916 8:67717643-67717665 GCCTCCCAAAAGATATCCCTGGG + Intronic
1045354483 8:101373393-101373415 GCATCGCAGCAAATCACCCAAGG - Intergenic
1048091255 8:131242804-131242826 CCCTCCCTGAAAATATTCCAGGG - Intergenic
1048829626 8:138463577-138463599 TCACCCCAGAAATTATGCCATGG - Intronic
1049987043 9:961175-961197 GCATTCCAGAAACTGTCCCTGGG - Intronic
1055365111 9:75535553-75535575 GCATCACAGAAATTAACACAGGG + Intergenic
1056140883 9:83678510-83678532 GCAACCTAGAAAGCATCCCAGGG - Exonic
1058357841 9:104105116-104105138 GCAGCCCAGCAGATATCCCTTGG - Intronic
1058812721 9:108656844-108656866 GAATCCCAGAAGAGATTCCAGGG + Intergenic
1058963003 9:110009318-110009340 GCATTCCAGAAAAAATCACTGGG - Intronic
1192242949 X:69349235-69349257 GCTGCCCACAGAATATCCCATGG - Intergenic
1194558936 X:95396703-95396725 ACATCCCATAAAATCTGCCAAGG - Intergenic
1195772617 X:108367834-108367856 GCATTCCAGCTAATATCCGAAGG - Intronic
1199414897 X:147570582-147570604 GCACCCCACAAATTAGCCCATGG + Intergenic