ID: 1167258108

View in Genome Browser
Species Human (GRCh38)
Location 19:48443027-48443049
Sequence GACGGCGGTGGCCGCGGCGG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 4330
Summary {0: 1, 1: 0, 2: 84, 3: 1414, 4: 2831}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167258108_1167258119 8 Left 1167258108 19:48443027-48443049 CCGCCGCCGCGGCCACCGCCGTC 0: 1
1: 0
2: 84
3: 1414
4: 2831
Right 1167258119 19:48443058-48443080 ACTCTGCCGCTTGGCCTTCGAGG 0: 1
1: 0
2: 0
3: 2
4: 93
1167258108_1167258116 -1 Left 1167258108 19:48443027-48443049 CCGCCGCCGCGGCCACCGCCGTC 0: 1
1: 0
2: 84
3: 1414
4: 2831
Right 1167258116 19:48443049-48443071 CGGGCCGCCACTCTGCCGCTTGG 0: 1
1: 0
2: 0
3: 4
4: 86
1167258108_1167258122 23 Left 1167258108 19:48443027-48443049 CCGCCGCCGCGGCCACCGCCGTC 0: 1
1: 0
2: 84
3: 1414
4: 2831
Right 1167258122 19:48443073-48443095 CTTCGAGGACGAGAGCCCGCCGG 0: 1
1: 0
2: 0
3: 2
4: 29

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167258108 Original CRISPR GACGGCGGTGGCCGCGGCGG CGG (reversed) Exonic
Too many off-targets to display for this crispr