ID: 1167258412

View in Genome Browser
Species Human (GRCh38)
Location 19:48444053-48444075
Sequence GCAGGACGCTGCTCCAGGCG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 194
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 178}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167258412_1167258424 8 Left 1167258412 19:48444053-48444075 CCCCGCCTGGAGCAGCGTCCTGC 0: 1
1: 0
2: 1
3: 14
4: 178
Right 1167258424 19:48444084-48444106 GTTCTGGAGGAACCGCAAGCCGG 0: 1
1: 0
2: 1
3: 11
4: 102
1167258412_1167258426 19 Left 1167258412 19:48444053-48444075 CCCCGCCTGGAGCAGCGTCCTGC 0: 1
1: 0
2: 1
3: 14
4: 178
Right 1167258426 19:48444095-48444117 ACCGCAAGCCGGAGAGGATTTGG 0: 1
1: 0
2: 0
3: 1
4: 48
1167258412_1167258419 -5 Left 1167258412 19:48444053-48444075 CCCCGCCTGGAGCAGCGTCCTGC 0: 1
1: 0
2: 1
3: 14
4: 178
Right 1167258419 19:48444071-48444093 CCTGCGCCCCCTGGTTCTGGAGG 0: 1
1: 0
2: 0
3: 18
4: 228
1167258412_1167258417 -8 Left 1167258412 19:48444053-48444075 CCCCGCCTGGAGCAGCGTCCTGC 0: 1
1: 0
2: 1
3: 14
4: 178
Right 1167258417 19:48444068-48444090 CGTCCTGCGCCCCCTGGTTCTGG 0: 1
1: 0
2: 0
3: 6
4: 94
1167258412_1167258425 13 Left 1167258412 19:48444053-48444075 CCCCGCCTGGAGCAGCGTCCTGC 0: 1
1: 0
2: 1
3: 14
4: 178
Right 1167258425 19:48444089-48444111 GGAGGAACCGCAAGCCGGAGAGG 0: 1
1: 0
2: 0
3: 6
4: 106

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167258412 Original CRISPR GCAGGACGCTGCTCCAGGCG GGG (reversed) Exonic