ID: 1167262567

View in Genome Browser
Species Human (GRCh38)
Location 19:48467403-48467425
Sequence AGCCCAGCCTGGGTTTCCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 256
Summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 227}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167262567 Original CRISPR AGCCCAGCCTGGGTTTCCAC TGG Intronic
900622279 1:3592957-3592979 AGCCCAGCCCGGGCTGCCCCGGG + Intronic
901669390 1:10846665-10846687 AGCTAAGCATGGGTTTGCACTGG + Intergenic
903011983 1:20337796-20337818 AGACCAGCCTGGATGTCCAGCGG + Exonic
903316577 1:22512678-22512700 AGCCCAGCATTACTTTCCACCGG + Intronic
905240314 1:36576830-36576852 GGCCCTGCCTGGGATTCCACAGG - Intergenic
906528466 1:46510007-46510029 AGCCCAGCCTGGCTTCTCATGGG + Intronic
906716205 1:47971378-47971400 ACCCAAGGCTGGCTTTCCACGGG - Intronic
909740128 1:79018671-79018693 TGCCCAGCCTGACTTTCCATGGG + Intergenic
917511053 1:175669646-175669668 AGCCGAGCCAGGGTTTCCAGAGG + Intronic
917512996 1:175683592-175683614 AGCCCAGGCTGGACATCCACAGG + Intronic
920399753 1:205669523-205669545 CCCCCAGCCTGGGCTTCCACGGG - Intronic
920708099 1:208269571-208269593 AACCCAGCCTGGTTCTCCTCTGG - Intergenic
922767708 1:228164548-228164570 AGCCCAGCCTGTCCTCCCACAGG - Intergenic
923337781 1:232985200-232985222 GGCCCAGCCTTGGCTTCCCCTGG + Intronic
923354168 1:233137339-233137361 TGTCCAGCATGGGTTCCCACTGG + Intronic
924254202 1:242166107-242166129 ATCCCAGGCTGGGTTTTCCCTGG + Intronic
924888632 1:248248584-248248606 GTCCCTGCCTGGGTTTCCTCGGG - Intergenic
1064096424 10:12427570-12427592 GCCCCAGCCTGGCCTTCCACTGG + Intronic
1064267215 10:13834736-13834758 AGACCAGCCTGTGTTGCCATGGG + Intronic
1065879658 10:30027778-30027800 AGCCCTGCGTGGATGTCCACGGG - Exonic
1067069402 10:43120848-43120870 TGCCCTGCCTGGGCTGCCACTGG - Intronic
1067107727 10:43376912-43376934 ACCCCTGCCTGGGGTGCCACAGG - Intergenic
1067452659 10:46391886-46391908 AGCCCATCCAGTGTTCCCACTGG - Intergenic
1067452670 10:46391935-46391957 AGCCCATCCAGTGTTCCCACTGG - Intergenic
1067584562 10:47467820-47467842 AGCCCATCCAGTGTTCCCACTGG + Intronic
1067584573 10:47467869-47467891 AGCCCATCCAGTGTTCCCACTGG + Intronic
1067683914 10:48456246-48456268 AGCCTAGCCTGGGATTCATCCGG - Intronic
1073299007 10:102459367-102459389 AGCCCTCCCTGGGTATCCAGTGG - Intergenic
1074894569 10:117763827-117763849 AGCAGAGACTGGGTCTCCACTGG - Intergenic
1075373388 10:121956805-121956827 AGTCCAGCCTGGCTTGCCAGAGG + Intergenic
1075949977 10:126468701-126468723 TGCCCTGCATGGGTTTCCACAGG - Intronic
1076221085 10:128733726-128733748 TGCCCAGGCTGGGAGTCCACTGG + Intergenic
1076365492 10:129919012-129919034 TGCCCAGGCTGGGCTTCCATGGG - Intronic
1076554547 10:131312619-131312641 AGCCGAGCCTGGGTCCGCACTGG + Intergenic
1076794894 10:132793662-132793684 AGCCCGGCCTCTGTGTCCACAGG - Intergenic
1078760658 11:14248737-14248759 AGGTCACCCTGGCTTTCCACTGG - Intronic
1080715461 11:34796018-34796040 AGCCAAGCCTTGTTTCCCACTGG + Intergenic
1081594335 11:44448814-44448836 AGCTCAGGCTGGGCTTCCACAGG + Intergenic
1083724637 11:64621829-64621851 AGCCCAGCCTGGGCTGCCTCAGG + Intronic
1084068415 11:66718696-66718718 ACTCCAGCCTGAGGTTCCACTGG - Intronic
1084909121 11:72373340-72373362 CGCCCAGCCGGGGTTGCCGCTGG - Intronic
1085411315 11:76292316-76292338 GGCCCAGCCTGGGTAAACACGGG - Intergenic
1090840982 11:130487284-130487306 AGCCCAGCCTGGGTTGGCTCAGG - Intergenic
1091309247 11:134561058-134561080 AGCCCTCCCTGGGAGTCCACTGG - Intergenic
1091855109 12:3733078-3733100 AGCCCAGCCAGAGCCTCCACTGG - Exonic
1096602991 12:52743399-52743421 TGCCCAGCCTGGGTCTCTTCAGG - Intergenic
1102015989 12:109648385-109648407 AGCCCAGCATGGCTGTCCACAGG - Intergenic
1103213114 12:119180797-119180819 TGCCCAGCCTGTGTTTGCAATGG - Intronic
1103222243 12:119255489-119255511 ACCCCAGCCTGCATCTCCACTGG + Intergenic
1103251895 12:119507095-119507117 AGCCCAGCCTCGGCTGCCACAGG - Intronic
1103507582 12:121452451-121452473 AGCCGAGCCTGCTTTTCCACGGG + Intronic
1105016399 12:132788534-132788556 AGCCCAGGCTCAGCTTCCACAGG + Intronic
1106763218 13:32888047-32888069 AGCCCAGCCTTTATTTGCACAGG - Intergenic
1111220058 13:85193492-85193514 AGGCCAGCCTTGGCTTCCCCAGG - Intergenic
1113887328 13:113667798-113667820 AGCCCGTCCTGGATCTCCACAGG - Exonic
1113916990 13:113880170-113880192 ATCCAAGCCTGGGTTGCCATTGG - Intergenic
1114416699 14:22549693-22549715 GGTCTAGCCTGGGTTTGCACAGG + Intergenic
1116803051 14:49463631-49463653 AGCCCAACCTAGATTTCAACGGG - Intergenic
1117372173 14:55088650-55088672 AGCCCTACCTGAGTTTCCAGAGG - Intergenic
1118554197 14:66996162-66996184 AGCCGAGCCTGGTTTTGCAGTGG - Intronic
1122267923 14:100555262-100555284 CACCCAGCCCGGGTTTCCACAGG - Intronic
1122442134 14:101739335-101739357 AGCCCTTCCTGTATTTCCACAGG - Intergenic
1122793226 14:104193176-104193198 ACCCCAGCCTTGATTTCCCCAGG - Intergenic
1124198755 15:27658022-27658044 AGGGCAGCCTGGGTCTCCTCCGG - Intergenic
1127263522 15:57343540-57343562 AGCCCAGCTTTGGTTAGCACGGG - Intergenic
1127619684 15:60721411-60721433 AGCCCAGCCTTGGTCTCCTCAGG - Intronic
1127790858 15:62397629-62397651 AGCACAGCCCTGGTTTCCAGTGG - Intronic
1128075626 15:64823791-64823813 GCCCCAGCCTGGGGCTCCACAGG + Exonic
1128959465 15:71986334-71986356 AGCCATCCCTGGGTATCCACAGG - Intronic
1128986069 15:72222500-72222522 AGCCCAGCCTTGGTTTCTCAGGG + Intronic
1129158855 15:73735750-73735772 AGCCCATCCTGTGTTTCCTTAGG + Exonic
1129956354 15:79640321-79640343 AACCCAGCCTAAGATTCCACAGG + Intergenic
1130014050 15:80173860-80173882 AGCTCAGCCTGGATCCCCACAGG - Intronic
1132664462 16:1075276-1075298 AGCCCAGCGAGGGGCTCCACAGG - Intergenic
1132827816 16:1913780-1913802 GGCCCAGCCTGCGTTTCCCTGGG - Intronic
1134190246 16:12115357-12115379 ATCCCTGCCTGGGGTTTCACTGG - Intronic
1135939462 16:26808984-26809006 AACCCAGCCTGGGTTATCAGGGG - Intergenic
1139470141 16:67174057-67174079 ACCCCAGCCTGGGTGTTCACTGG + Intronic
1139896124 16:70289291-70289313 AGCCCAGACTGGGCTTCTCCAGG + Intronic
1139910546 16:70394952-70394974 AGCCCACCCTTGGGCTCCACAGG + Intronic
1140223553 16:73061147-73061169 AGTCCAGCCTGGCTTGCTACAGG + Intergenic
1140803020 16:78506221-78506243 AACACAGCCTGTGTGTCCACAGG - Intronic
1141745006 16:85919764-85919786 AGCCCTCCCTGGGTGTCCTCAGG + Intronic
1142164119 16:88576500-88576522 AGCCCTGCCTGCGTGTTCACTGG - Intronic
1142178636 16:88656605-88656627 AGCCCAGCTTGGGTGTCCTCGGG - Intronic
1142184982 16:88690576-88690598 TGCCCAGGCTGGGTTTTCTCGGG - Intergenic
1143136582 17:4715871-4715893 AGCCCAGCCTGGAGATCCCCGGG + Intronic
1143165866 17:4897038-4897060 ATCCCAGCCTGCCTTTCCTCCGG + Intronic
1143441457 17:6977727-6977749 AGACCAGCCTGGGTAACCATAGG + Intronic
1143464885 17:7129989-7130011 GGCCCTGCCTGGCTTCCCACAGG - Intergenic
1143764550 17:9128976-9128998 GGCCCAGCCTTGGGTTACACAGG - Intronic
1144716642 17:17440722-17440744 TGCCCAGCCTGGCATTTCACAGG - Intergenic
1147554478 17:41467656-41467678 AACCCAGCCTGTGCCTCCACTGG + Intergenic
1147899209 17:43773011-43773033 CGCCCAGCCTATGTTTACACAGG + Intronic
1147927324 17:43953806-43953828 AAAACAGCCTGGGTTTCCCCAGG + Intronic
1149231907 17:54544590-54544612 AGCCCAGGATGGGTAACCACGGG + Intergenic
1152061370 17:78078223-78078245 AGCCCAGCTAGGGTGTGCACTGG + Intronic
1152499586 17:80698873-80698895 AGGCTCGCCTGGGTTTCCCCAGG - Intronic
1152656878 17:81523954-81523976 AGCCCAGCCTGGGCTCCTGCTGG - Intergenic
1154342391 18:13514774-13514796 ACACCAGCCTGGGTTTCACCAGG - Intronic
1156046610 18:32884755-32884777 ACCACAGCCTGTGTTCCCACAGG + Intergenic
1156462562 18:37329561-37329583 CGGCCAGCCTGGGCTACCACAGG + Intronic
1157717241 18:49896427-49896449 ACTCCAGTCTGGGTCTCCACTGG + Intronic
1159017859 18:63116416-63116438 GACCCAGGCTGGGTTCCCACAGG - Intergenic
1159804301 18:72937655-72937677 AACACAGCCTGGGTTTCCATAGG - Intergenic
1160417021 18:78718740-78718762 GGCCCAGCCTTGATCTCCACGGG - Intergenic
1160417038 18:78718803-78718825 GGCCCAGCCTTGATCTCCACGGG - Intergenic
1160417053 18:78718866-78718888 GGCCCAGCCTTGATCTCCACGGG - Intergenic
1160417096 18:78719034-78719056 GGCCCAGCCTTGATCTCCACGGG - Intergenic
1160715545 19:574906-574928 AGGCCTGGCTGGGTTTCCACAGG - Intronic
1163163628 19:15480434-15480456 AGCCAGGCCTGGGATTCCCCTGG + Intronic
1163769084 19:19179886-19179908 AGGCCAGCCCGGGTTTCTCCTGG - Intronic
1164159587 19:22617789-22617811 AGCCCAGCCCGGGGGTCCACAGG - Intergenic
1165091099 19:33388812-33388834 AGGCCAGGCTGGGTGTGCACTGG - Intronic
1165487356 19:36103762-36103784 ACGCCAGGCTGGGTATCCACGGG - Exonic
1165568430 19:36753558-36753580 ACTCCAGCCTGGGTGACCACGGG + Intronic
1165746998 19:38235489-38235511 AGCCCAGCCTGGGCTTCTGAAGG + Intergenic
1165777739 19:38414808-38414830 CGCCCAGGCTGGGCTTCCAAGGG - Intronic
1165829272 19:38722495-38722517 TGCCCAGCATGGGGCTCCACTGG - Intronic
1165939427 19:39407803-39407825 AGCCCAGGCTGGGGCTCCTCGGG + Exonic
1166272013 19:41720313-41720335 TGGCCAGCCTGGGTGTCCAGGGG - Intronic
1167262567 19:48467403-48467425 AGCCCAGCCTGGGTTTCCACTGG + Intronic
1167352815 19:48986202-48986224 AGACCAGCCTGGGCTGCCTCAGG - Intronic
1167468232 19:49661479-49661501 AGACCATCCTTGGATTCCACGGG + Intronic
925159737 2:1675730-1675752 AGCCCAGCCCGGTTTGCCTCTGG + Intronic
928176294 2:29036493-29036515 TGCCCAGCCTGGGTTCCCATGGG + Intronic
931158074 2:59657893-59657915 AGTGCAACCTAGGTTTCCACTGG - Intergenic
931431932 2:62215371-62215393 GGCCTGGCCTGGGTTTTCACCGG - Intronic
931573847 2:63698949-63698971 AGCCCAGTCTGGATTTCCTGAGG + Intronic
933723235 2:85411312-85411334 AGCCCATCCTGGGTTGACCCAGG + Intronic
934847481 2:97671516-97671538 AATCCAGCCTGAGGTTCCACAGG - Intergenic
934942713 2:98514039-98514061 AGACCAGCCTCCGTTTCCATGGG - Intronic
935649715 2:105371880-105371902 AGGTCAGCCTGGCTTTCTACGGG + Intronic
937069962 2:119055713-119055735 AGCTCAGCCTGGGCTGTCACAGG + Intergenic
937516395 2:122660811-122660833 ACCGCAGCCTGGGTTTCCCTTGG - Intergenic
940854276 2:158717575-158717597 AGCACAGCATGGGTTTGAACTGG - Intergenic
946219816 2:218217031-218217053 AGCGCAGCCTCCGTTTCCTCCGG + Intergenic
949009965 2:241672780-241672802 TGCCCAGCCTGGCTTACCAAGGG + Exonic
1171487991 20:25497723-25497745 AGCCCAGCCTGGGAGCCCCCTGG + Intronic
1175152633 20:56947040-56947062 AGCCCTTGGTGGGTTTCCACAGG + Intergenic
1175700137 20:61130929-61130951 CTCCCACTCTGGGTTTCCACAGG - Intergenic
1175744405 20:61445266-61445288 GGCCCTGCCTGGCTCTCCACAGG - Intronic
1175752452 20:61508721-61508743 GGCTCAGCCTGGGTGGCCACCGG + Intronic
1175891881 20:62319324-62319346 AGCCCAGCCTGGGGGTCGGCAGG - Intronic
1176024549 20:62978965-62978987 AGCCCACACTGAGTGTCCACAGG - Intergenic
1178473051 21:32911822-32911844 AACCCTGCCTGAGTTTCCAGTGG - Intergenic
1178706857 21:34882864-34882886 AGAGAAGCCTGGGTTACCACAGG - Intronic
1179167495 21:38946066-38946088 AGCGCAGCCAGCGTTTCCGCAGG - Intergenic
1180734506 22:18005858-18005880 AGCCCAGCCTGTATTTGCAGGGG - Intronic
1181403611 22:22666803-22666825 AGGCCAGCCTGGCGTTCAACAGG + Intergenic
1181408620 22:22702788-22702810 AGGCCAGCCTGGGGTTCAACAGG + Intergenic
1181412491 22:22734160-22734182 TGCCCAGCAGAGGTTTCCACGGG + Intergenic
1181413889 22:22745918-22745940 AGGCCAGCCTGGGGTTCAACAGG + Intronic
1181749282 22:24977571-24977593 AGCCCACCCTGGGGCTCCAAAGG + Intronic
1183334254 22:37237576-37237598 AATCCAGCCTGGGATTCCAGTGG - Intronic
1184643290 22:45883341-45883363 TGCCCGGCCTGGCTCTCCACTGG - Intergenic
1184781610 22:46652412-46652434 AGTCCAGCCTGGGTCTCCCTGGG - Intronic
1185067718 22:48640406-48640428 AGCCCAGGCTGTGTCTGCACTGG - Intronic
950357757 3:12425920-12425942 AGCCCATGCTCAGTTTCCACTGG + Intronic
953854661 3:46491973-46491995 ATCCCAGTCTGGGGTTCCAGGGG - Intergenic
954419651 3:50411984-50412006 AGCCCAGCGTGGCTTGCCATGGG - Intronic
954662416 3:52233146-52233168 ACACCAGCCTGGGTATACACAGG + Intronic
955125003 3:56102284-56102306 AGCACTGCCTGGGCTTCCTCTGG - Intronic
955764177 3:62323349-62323371 AGCCTAGCCTGTGTTTCAATAGG + Intronic
956281189 3:67558800-67558822 AAACCAGCCTGAGTTTCCAGGGG - Intronic
958994019 3:100880486-100880508 AGCCCAACCTGGGTTTGTAATGG - Intronic
960054425 3:113266984-113267006 AGCCCTCTCTGGGTCTCCACTGG + Intronic
961404029 3:126666396-126666418 TGCCCAGCCTGGGTATCTAGGGG + Intergenic
962349060 3:134643616-134643638 AGCACAGGCTGGGTTTCTTCTGG + Intronic
962552120 3:136504761-136504783 AGCCGTGCCTCAGTTTCCACTGG - Intronic
962939532 3:140113266-140113288 AGCACAGCCTGGGTTGCTGCTGG - Intronic
965760263 3:172068172-172068194 AGCCCAGAATGGGAGTCCACTGG - Intronic
967930026 3:194684433-194684455 ACCCAACTCTGGGTTTCCACTGG - Intergenic
967956502 3:194881403-194881425 TCCCCAGCCTGGCTTTCCAATGG + Intergenic
968703303 4:2066780-2066802 GGCCCGGCCTGGCTTTCCCCGGG - Exonic
969254026 4:5990507-5990529 ATCCCAGCCTGGGTGTCCTGTGG + Intergenic
970171862 4:13298645-13298667 CGCCCAGCCTGGGATTCTTCCGG - Intergenic
973982263 4:56316295-56316317 GGCCCACCCTGGGCCTCCACCGG + Exonic
975371393 4:73592576-73592598 AGCCCAACCTGGATATCCAAGGG + Intronic
975491622 4:74995543-74995565 AGCCCAGTCAGGGTTTGAACGGG + Intronic
975683491 4:76897910-76897932 CGCCCGGCCAGGGTTTCCTCTGG - Exonic
979638937 4:122989566-122989588 AGACCAGCCTGGGTCTACAGTGG + Intronic
979687310 4:123524975-123524997 CGCCCAGCCTGGAATTCAACTGG + Intergenic
982728154 4:158927711-158927733 TGCGCAGCCCGGGTTCCCACTGG - Intronic
984655924 4:182318638-182318660 AGCCCAGCTGTGGTTTCCAGAGG + Intronic
984763101 4:183379020-183379042 GGCTCAGCCTGGGTTTCTGCTGG - Intergenic
985497724 5:218807-218829 AGCCCAGCCAGGGCGGCCACCGG - Intronic
986129315 5:4912374-4912396 AGCCCACCCTGGGTTGCCACAGG + Intergenic
987115247 5:14721370-14721392 AGCCCAGACTGGGTCTTCGCGGG + Intronic
988980072 5:36559266-36559288 AGTCCAGCTTGGGTTTCAATAGG + Intergenic
989200637 5:38759250-38759272 GGCCAAGCCTGGGATCCCACAGG + Intergenic
989581346 5:43036172-43036194 ACTCCAGCCTGGGTTTCAATGGG + Intergenic
994945906 5:106391344-106391366 AGCCAAGCATGGTTTTCCTCTGG + Intergenic
996329485 5:122312544-122312566 ACCCCCGCCTCGGTTTCCAAAGG + Intronic
999534657 5:152503552-152503574 AGCCCGGCCTGGGTGTGCCCTGG - Intergenic
1000890422 5:166795400-166795422 AGACCAGCCTGGCTTCTCACAGG - Intergenic
1001666377 5:173436726-173436748 TGCCCAGCCCTGGGTTCCACAGG - Intergenic
1001694945 5:173663135-173663157 AGCCCTGGCTTGGTTTCCACTGG - Intergenic
1001832492 5:174801127-174801149 AGCCAAGCCTGGGCTGTCACTGG - Intergenic
1002319447 5:178366241-178366263 AGCCCAGCTTGGCTGTCCAGTGG + Intronic
1003506373 6:6743573-6743595 TTCCCAGCCTGGGTCTCGACAGG - Intergenic
1006339311 6:33437950-33437972 CGCCCAGCCAGGGTGGCCACTGG - Exonic
1007767977 6:44172282-44172304 AGCCCTGCCTGTCTTTCCAGGGG + Exonic
1009742025 6:67758492-67758514 AGGCCAGCCTTGGTTTCCCCAGG + Intergenic
1011736170 6:90313022-90313044 CGCCCACCCTGGGTTCCCAGTGG - Intergenic
1013773327 6:113651236-113651258 AGCCCAGGCTGGCCTGCCACTGG + Intergenic
1014141740 6:117951727-117951749 ACACTAGCCTGGGTTTGCACAGG - Intronic
1017778121 6:157695416-157695438 AGTCCACCCTGACTTTCCACTGG - Intergenic
1019157988 6:170051768-170051790 AGCCCTGCCTGGGTCCCCACTGG + Intergenic
1019490855 7:1312488-1312510 AGCCGGGCTTGGGCTTCCACTGG + Intergenic
1019547849 7:1587051-1587073 AGCCCAGCCTGGGAGGCCGCAGG - Intergenic
1019600367 7:1880268-1880290 TGCCCAGCCTGGGTCACCACAGG - Intronic
1020227297 7:6290372-6290394 TGCCCAGCAAGGGTTACCACGGG - Intergenic
1021106734 7:16646348-16646370 CGCCCCGCCGGGGTTTCCATCGG + Intronic
1022100972 7:27169036-27169058 AGTCCAGCCTGAGTCTCCACTGG + Intronic
1022420305 7:30214771-30214793 ATCTCAGCATTGGTTTCCACGGG - Intergenic
1022575122 7:31489978-31490000 TGCCCAGCCTGGGTTCCCCAGGG - Intergenic
1023280997 7:38569689-38569711 ATCCCAGCCAGGGTTTTGACAGG + Intronic
1026576885 7:71579340-71579362 AGCCCAGCAGGCATTTCCACTGG + Intronic
1028049824 7:86170257-86170279 AGCCCAGCCTGGGTTTGAGAAGG + Intergenic
1028778288 7:94705505-94705527 CGCGCAGCCCGGGTTCCCACTGG - Intergenic
1029614525 7:101647960-101647982 CACACAGCCTGGGGTTCCACTGG - Intergenic
1034881620 7:154767180-154767202 AGCCCTGCAGTGGTTTCCACGGG - Intronic
1035246682 7:157566850-157566872 ACCCCAGCGTGCGTCTCCACAGG - Intronic
1036218006 8:6896869-6896891 CACCCAGCCTGGCCTTCCACGGG - Intergenic
1038014905 8:23506333-23506355 AGCCCAGCCTGGGCTACCGAGGG - Intergenic
1038176490 8:25185297-25185319 CGCCCAGCGTGGGTTTCACCTGG + Intronic
1039646160 8:39285290-39285312 ACCCCAGCCTGGGTTTCTGAGGG + Intergenic
1039915633 8:41858479-41858501 ACCCCAAGCTGGGTGTCCACTGG + Intronic
1040276977 8:46018818-46018840 AGACCACCCTGGATTTACACAGG + Intergenic
1040531613 8:48270871-48270893 TGCCCAGCCTGGGCCTCCACTGG - Intergenic
1042638597 8:70906505-70906527 AGCCCAGCCTCGGCAACCACAGG - Intergenic
1043460048 8:80450457-80450479 AGACCAGCCTGGGAAACCACAGG + Intergenic
1046851575 8:118980238-118980260 AGCCCAGGCTGGTTTGCAACGGG + Intergenic
1047411446 8:124627749-124627771 AGGTCAGCCTGAGCTTCCACAGG + Intronic
1048377362 8:133834252-133834274 TGCCCAGCCTGTGGTTCCCCTGG + Intergenic
1055613962 9:78052351-78052373 AGCCTTGCCTGGTTCTCCACAGG + Intergenic
1056559074 9:87714169-87714191 AGCCCAGCTTTGTTTTCAACAGG - Intergenic
1056676792 9:88682817-88682839 AGGCAAGCCAGGGTGTCCACAGG + Intergenic
1057036420 9:91814877-91814899 AGCCGGGCCTGGGTTTCAGCTGG - Intronic
1057245671 9:93452122-93452144 AGCCAAGCATGTGGTTCCACTGG - Exonic
1059921652 9:119167215-119167237 AGTCCAGCTGGGGTTTCCCCGGG + Exonic
1060869436 9:127028098-127028120 AGCCCTGCCTGTGTTGCCAGAGG + Intronic
1060985076 9:127815166-127815188 AGCCCAGCCTGGGAGCCCAGAGG - Exonic
1061009457 9:127946449-127946471 AGGCCAGCCTGGGGTGTCACAGG - Intronic
1062071936 9:134560424-134560446 ACCCAAGCTTGGGCTTCCACAGG - Intergenic
1185504711 X:623896-623918 AGCCCCGCCTGCGTCTCCAGGGG + Intergenic
1187060015 X:15776913-15776935 AGCCCAGCCTTGTTTTACATGGG - Intronic
1187249360 X:17582955-17582977 AGCCCTGCCTTGGCTCCCACTGG + Intronic
1189476862 X:41362822-41362844 AGGACAGCCTGTGCTTCCACTGG + Intronic
1190106830 X:47567033-47567055 AGCCCAGCCAGCGTGTCCTCGGG + Exonic
1190141909 X:47854470-47854492 AGCCTAGCTTGGCTTTCAACAGG + Intronic
1190737085 X:53262705-53262727 AGCCCAGCCTGGCTTGGCACAGG + Intronic
1190844888 X:54182754-54182776 AGCCCAGCATGGCGTTCCATTGG + Exonic
1190873523 X:54444356-54444378 AGCAGAGCCTGGGTCTCCAGTGG + Intronic
1197117453 X:122850389-122850411 ACCCCAGGCTGGGTTTTCTCTGG - Intergenic