ID: 1167262643

View in Genome Browser
Species Human (GRCh38)
Location 19:48467677-48467699
Sequence CTGGGGAAGGGGAAGGGGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 5499
Summary {0: 1, 1: 6, 2: 308, 3: 1048, 4: 4136}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167262627_1167262643 16 Left 1167262627 19:48467638-48467660 CCTTGACCACATTCCGTTACAAA 0: 1
1: 0
2: 0
3: 4
4: 92
Right 1167262643 19:48467677-48467699 CTGGGGAAGGGGAAGGGGAAGGG 0: 1
1: 6
2: 308
3: 1048
4: 4136
1167262624_1167262643 26 Left 1167262624 19:48467628-48467650 CCAGCCAGTCCCTTGACCACATT 0: 1
1: 0
2: 0
3: 16
4: 146
Right 1167262643 19:48467677-48467699 CTGGGGAAGGGGAAGGGGAAGGG 0: 1
1: 6
2: 308
3: 1048
4: 4136
1167262628_1167262643 10 Left 1167262628 19:48467644-48467666 CCACATTCCGTTACAAATAATGG 0: 1
1: 0
2: 0
3: 3
4: 91
Right 1167262643 19:48467677-48467699 CTGGGGAAGGGGAAGGGGAAGGG 0: 1
1: 6
2: 308
3: 1048
4: 4136
1167262631_1167262643 3 Left 1167262631 19:48467651-48467673 CCGTTACAAATAATGGGACATAG 0: 1
1: 0
2: 2
3: 12
4: 215
Right 1167262643 19:48467677-48467699 CTGGGGAAGGGGAAGGGGAAGGG 0: 1
1: 6
2: 308
3: 1048
4: 4136
1167262626_1167262643 17 Left 1167262626 19:48467637-48467659 CCCTTGACCACATTCCGTTACAA 0: 1
1: 0
2: 0
3: 5
4: 80
Right 1167262643 19:48467677-48467699 CTGGGGAAGGGGAAGGGGAAGGG 0: 1
1: 6
2: 308
3: 1048
4: 4136
1167262625_1167262643 22 Left 1167262625 19:48467632-48467654 CCAGTCCCTTGACCACATTCCGT 0: 1
1: 0
2: 0
3: 5
4: 87
Right 1167262643 19:48467677-48467699 CTGGGGAAGGGGAAGGGGAAGGG 0: 1
1: 6
2: 308
3: 1048
4: 4136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167262643 Original CRISPR CTGGGGAAGGGGAAGGGGAA GGG Intronic
Too many off-targets to display for this crispr