ID: 1167265371

View in Genome Browser
Species Human (GRCh38)
Location 19:48480463-48480485
Sequence CGGCCTGAAGGCCCCCGCGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 93
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 82}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167265366_1167265371 -9 Left 1167265366 19:48480449-48480471 CCACAGGCACCTGCCGGCCTGAA 0: 1
1: 0
2: 1
3: 19
4: 185
Right 1167265371 19:48480463-48480485 CGGCCTGAAGGCCCCCGCGGTGG 0: 1
1: 0
2: 0
3: 10
4: 82
1167265364_1167265371 -3 Left 1167265364 19:48480443-48480465 CCTTGGCCACAGGCACCTGCCGG 0: 1
1: 0
2: 3
3: 28
4: 324
Right 1167265371 19:48480463-48480485 CGGCCTGAAGGCCCCCGCGGTGG 0: 1
1: 0
2: 0
3: 10
4: 82
1167265363_1167265371 -2 Left 1167265363 19:48480442-48480464 CCCTTGGCCACAGGCACCTGCCG 0: 1
1: 0
2: 1
3: 13
4: 215
Right 1167265371 19:48480463-48480485 CGGCCTGAAGGCCCCCGCGGTGG 0: 1
1: 0
2: 0
3: 10
4: 82
1167265359_1167265371 7 Left 1167265359 19:48480433-48480455 CCTGTCCCGCCCTTGGCCACAGG 0: 1
1: 0
2: 0
3: 17
4: 212
Right 1167265371 19:48480463-48480485 CGGCCTGAAGGCCCCCGCGGTGG 0: 1
1: 0
2: 0
3: 10
4: 82
1167265358_1167265371 8 Left 1167265358 19:48480432-48480454 CCCTGTCCCGCCCTTGGCCACAG 0: 1
1: 0
2: 3
3: 26
4: 240
Right 1167265371 19:48480463-48480485 CGGCCTGAAGGCCCCCGCGGTGG 0: 1
1: 0
2: 0
3: 10
4: 82
1167265362_1167265371 1 Left 1167265362 19:48480439-48480461 CCGCCCTTGGCCACAGGCACCTG 0: 1
1: 0
2: 2
3: 43
4: 386
Right 1167265371 19:48480463-48480485 CGGCCTGAAGGCCCCCGCGGTGG 0: 1
1: 0
2: 0
3: 10
4: 82
1167265361_1167265371 2 Left 1167265361 19:48480438-48480460 CCCGCCCTTGGCCACAGGCACCT 0: 1
1: 0
2: 3
3: 39
4: 385
Right 1167265371 19:48480463-48480485 CGGCCTGAAGGCCCCCGCGGTGG 0: 1
1: 0
2: 0
3: 10
4: 82

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167265371 Original CRISPR CGGCCTGAAGGCCCCCGCGG TGG Intronic