ID: 1167267062

View in Genome Browser
Species Human (GRCh38)
Location 19:48488498-48488520
Sequence ACTTTGTCCTGGGGGTGCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 249
Summary {0: 1, 1: 1, 2: 4, 3: 26, 4: 217}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167267062 Original CRISPR ACTTTGTCCTGGGGGTGCCA GGG (reversed) Intronic
900371335 1:2333484-2333506 ACTTTGTTCTGCAGGAGCCATGG - Intronic
900715330 1:4140380-4140402 GCTTTGTTCTTGGTGTGCCATGG - Intergenic
901930525 1:12594070-12594092 ACCTTGGGGTGGGGGTGCCAAGG + Intronic
902691689 1:18113749-18113771 ACGGTTTCCTGGGGGTCCCAGGG - Intronic
903209935 1:21812241-21812263 ACTGTGTCCAGGGGTTGCCATGG - Intergenic
903282709 1:22259112-22259134 ACGGTGTCCTGGGGTGGCCATGG - Intergenic
903475735 1:23618086-23618108 ACTTTATCCTGAGGTTGACAGGG - Intronic
903496495 1:23771311-23771333 ACTTAAGCCTGGGGGTGTCAAGG + Intergenic
904453665 1:30633327-30633349 GCTTTGACCTGGGGGAACCAGGG + Intergenic
904715635 1:32465449-32465471 ACTTTGTCCGCGGGAGGCCATGG + Intronic
904717594 1:32480691-32480713 ACTTTATCCTGGGGCTGACTGGG + Intronic
904747396 1:32719668-32719690 TCTGTGTCCTGGAGATGCCAGGG + Intergenic
905405278 1:37728309-37728331 ACTTTCTCCTGTGGGTGACAGGG + Intronic
906291635 1:44623243-44623265 ACTTTGTCCTGAGGGGAACAAGG + Intronic
907427370 1:54388914-54388936 ACTTTGTCCTGGCATGGCCAGGG - Intronic
908509878 1:64843091-64843113 ACATTTTACTGGGGGTGGCATGG - Intronic
909201150 1:72691867-72691889 ATTTTGTCCTGGGGGTTCTTTGG + Intergenic
911854799 1:102862973-102862995 ACTTTGTCCTTGATATGCCATGG - Intergenic
913548888 1:119897043-119897065 TGTTTGTCTTTGGGGTGCCAGGG + Intergenic
915039655 1:152958038-152958060 ACTTTGCTCTCAGGGTGCCAAGG - Intergenic
915349787 1:155217119-155217141 GTTTTGTCCTGGGGGTGGGAGGG - Intergenic
915353044 1:155238396-155238418 GTTTTGTCCTGGGGGTGGGAGGG - Intronic
915593720 1:156884659-156884681 TCTTTGGCCTGGGGATGCAAGGG - Intergenic
916462989 1:165046017-165046039 GCTCTGTCTTTGGGGTGCCATGG - Intergenic
916678108 1:167081332-167081354 ACTTGGTCCTGGGGCTGGCTGGG - Intronic
917499701 1:175575123-175575145 GCTTTGTCCTGGAAGTGACATGG - Intronic
918111402 1:181458158-181458180 AGTTTGTCCTGTTGTTGCCATGG + Intronic
918811444 1:189126143-189126165 TCTTTGTTCTGTGGGTCCCAGGG - Intergenic
921887568 1:220321904-220321926 ACTCTGTCCTGGTGCTGTCATGG + Intergenic
924260749 1:242228381-242228403 TCTGTGTCCTGCGGGTGCCTCGG - Intronic
1064316923 10:14266148-14266170 TCTTTGTCCTGGGGGTGGGAGGG + Intronic
1068275853 10:54795314-54795336 ATTTTGTCCTGGTGGTGACTTGG - Intronic
1069861185 10:71472677-71472699 CCCTTGTGCTGGGGTTGCCAAGG + Intronic
1070437573 10:76408537-76408559 ACTTGGTCCTTCAGGTGCCAGGG + Intronic
1070820436 10:79350988-79351010 ACTCTGTCCTGGGTCTGCAAGGG + Intronic
1070954652 10:80455709-80455731 GCTTCATTCTGGGGGTGCCAGGG - Intronic
1072729056 10:97832541-97832563 ACTTGATCCTGGGAGTTCCAGGG + Intergenic
1074440207 10:113471350-113471372 CCTTTGTCCTTGGGGTTCAATGG - Intergenic
1074761045 10:116667788-116667810 CCTTTGTCCTGGGACTGCCTGGG - Intronic
1074764721 10:116692153-116692175 GCTTCCTCCTGGGGGAGCCATGG - Intronic
1075374319 10:121965763-121965785 ACTTTGATCTGGGGAGGCCAAGG + Intronic
1075577475 10:123588530-123588552 ACTTTGCCCAGGGGGTGCAGTGG + Intergenic
1075610652 10:123852160-123852182 ACTTTGTCATGGCAGTCCCAGGG + Intronic
1076143179 10:128095886-128095908 ACTGTGTCCTGGAGATGCCTTGG + Intergenic
1076579513 10:131497256-131497278 ACTTTGACCTGGGTGAGGCATGG + Intergenic
1076783989 10:132739981-132740003 GCTTCGTCCTGGGGAGGCCACGG - Intronic
1076785930 10:132749945-132749967 ACTGAGTCCTGGAGGTGGCAGGG - Intronic
1076844158 10:133060844-133060866 GCTTTGTGCTGGGAGTCCCAGGG - Intergenic
1077181342 11:1218605-1218627 ACTGGGTCCTGGTGCTGCCATGG - Intergenic
1077985285 11:7345284-7345306 ACTTTCTCCAGGTGGTGACATGG + Intronic
1078900174 11:15634705-15634727 AGTTTGTCCTGCGGCAGCCAGGG - Intergenic
1081509795 11:43758591-43758613 ACTTTTTACTGGGGCTACCACGG + Intronic
1081642095 11:44763108-44763130 ACTTTCTCCTGGGGTTGTAAGGG + Intronic
1081705491 11:45180444-45180466 ACTCGGCCCGGGGGGTGCCAGGG - Intronic
1081957489 11:47106249-47106271 ACTTTGTCTTAGGGGTGGGAAGG + Intronic
1083990297 11:66242513-66242535 ACGCTGTCCTGGGGATGCCGGGG - Intronic
1084359539 11:68660611-68660633 CCTTTGGCCTGGAGGTCCCAGGG - Intergenic
1085454012 11:76655736-76655758 ACTGTGACCTGGGAGTGGCAGGG + Intergenic
1088716546 11:112554470-112554492 ACTTTGTCCTGGGGCAGTCAGGG + Intergenic
1088945196 11:114504525-114504547 CCACTGTGCTGGGGGTGCCAGGG - Intergenic
1089504822 11:118956251-118956273 ATTTTGTCCTGGGGGTGGGAGGG - Intronic
1089683091 11:120130361-120130383 ACCTTGTCCTCGGGGTGGTAAGG - Intronic
1091587320 12:1823571-1823593 GCTCTGTTCTGGGGGAGCCAAGG - Intronic
1095455011 12:42374069-42374091 ACATTGTCCTGGGGGTGGGTGGG + Intronic
1097125082 12:56768073-56768095 ACTTTATCCTGTGGGTGACAGGG + Intronic
1099048584 12:77755381-77755403 ACTGTGTGCTGGGGATACCAGGG + Intergenic
1102006477 12:109592300-109592322 ACTGTGTCCAGGGGGAGCCTGGG - Intronic
1103624665 12:122208638-122208660 ACGTTGGCCTGGGGGTGCTGTGG + Intronic
1105443266 13:20432584-20432606 ACTCTGTCCTGGGGAGGCCAGGG - Intronic
1106481436 13:30140163-30140185 GCTGGGTCCTGGGGGTGTCAAGG - Intergenic
1107478789 13:40767626-40767648 ACTTGGTCCTTGGGGTGGCCAGG + Intronic
1107776708 13:43851745-43851767 CCACTGTGCTGGGGGTGCCAAGG - Intronic
1108439990 13:50441592-50441614 ACTTGAGCCTGGGGGTGACAGGG + Intronic
1108493557 13:51003779-51003801 ACTTTGTCCTGAGGGTCGTAGGG - Intergenic
1108750626 13:53444767-53444789 ACTTCATCCTAGGGCTGCCATGG - Intergenic
1109326487 13:60873422-60873444 ACTTTGTCTTGAGGGTGCTGGGG + Intergenic
1109587217 13:64422102-64422124 ACTCTGACCTGGAAGTGCCAGGG - Intergenic
1122286937 14:100657927-100657949 ACTTTGTCCTGGGTGTGAAAGGG + Intergenic
1122355531 14:101120940-101120962 ACTGTGTCCCGTGGGGGCCAGGG + Intergenic
1123493552 15:20800653-20800675 ACTTAGTCCAGGGCGTACCAGGG - Intergenic
1123550060 15:21369755-21369777 ACTTAGTCCAGGGCGTACCAGGG - Intergenic
1123921128 15:25070598-25070620 ACTTTGGCCTGTGGATGCCCTGG - Intergenic
1127397519 15:58554497-58554519 TCATTGTGCTGGGGGTGGCAGGG + Intronic
1128536105 15:68491833-68491855 CCTGTGTCCTGTGGGGGCCAGGG + Intergenic
1129641383 15:77382213-77382235 ACTTTGCCCTGATGGTGGCAGGG - Intronic
1202958390 15_KI270727v1_random:96973-96995 ACTTAGTCCAGGGCGTACCAGGG - Intergenic
1137508711 16:49079493-49079515 TCTTAGTCCTGGCTGTGCCATGG - Intergenic
1137806978 16:51316276-51316298 ACTTTGTCTTAGGGGTTCCTTGG + Intergenic
1138200102 16:55082032-55082054 ACTTTGTCCTGCCTGGGCCAGGG - Intergenic
1139254976 16:65532147-65532169 TCTTTGTCCAGGAGGGGCCACGG - Intergenic
1139613044 16:68072625-68072647 ACTTTGTCCTGAGCGTGCCGTGG + Intronic
1139699764 16:68700903-68700925 GCTTTGTCCTGAGGGTGCCATGG - Intronic
1141216838 16:82033094-82033116 ACTCTGTCCTGGGGCTCCCAAGG - Intergenic
1141542727 16:84738566-84738588 TCTTTGCCTTGCGGGTGCCAAGG + Intronic
1142069575 16:88083778-88083800 ACTGGGACCTGGGGCTGCCAAGG + Intronic
1142194482 16:88733141-88733163 ACTCTCCCCTGGGGGCGCCAAGG - Intronic
1143965974 17:10756723-10756745 TCTTTGTCCTGGGGGTGGAGTGG + Intergenic
1145729089 17:27158926-27158948 ACTTTGTCCTGGGCCTTGCAGGG + Intergenic
1146027231 17:29332094-29332116 CATTTGTTCTGGGGGTGGCAGGG - Intergenic
1146032214 17:29376080-29376102 ACTTTGTCTTTTGGGTGCCATGG - Intergenic
1146393144 17:32441502-32441524 CCTTTGCCCTGGAGATGCCATGG + Intergenic
1146677695 17:34784896-34784918 ACTTTTTTCTGGGAGAGCCAAGG + Intergenic
1146889418 17:36496437-36496459 ACTAGTTCCTGGGAGTGCCAGGG + Intronic
1147141525 17:38463238-38463260 CCTTTGCCCTGGGGATGCCCTGG + Intronic
1148779208 17:50112201-50112223 CCTCTGTCCTGTGGGTCCCAGGG - Intronic
1149057890 17:52387488-52387510 ACAGTGTCCTGAGGGTGCCCAGG - Intergenic
1151260563 17:72912723-72912745 ACTTGGTCCTGCCTGTGCCAAGG + Intronic
1152471255 17:80491133-80491155 ACTTTGTCCTGGGCAGGCTATGG + Intergenic
1154147212 18:11876112-11876134 ACTTTTCTCTGGGGGTGCTATGG - Intronic
1154451085 18:14475116-14475138 ACTTAGTCCAGGGCGTACCAGGG - Intergenic
1156502546 18:37568615-37568637 ACTTGGACCTAGGGGTGCCTTGG - Intergenic
1161121746 19:2530847-2530869 ACTTTTTCCTGGGGTTGGGAGGG + Intronic
1161308233 19:3578805-3578827 CCTGTGTCCTGGGGGTGGCCCGG - Exonic
1161642767 19:5434787-5434809 ACTTTGTCCTGAGGGCGATAGGG + Intergenic
1161802227 19:6422711-6422733 ACTTCGTTCTAGGGGTGACAAGG + Intronic
1163133891 19:15295157-15295179 ACTGCAGCCTGGGGGTGCCACGG + Intronic
1163171546 19:15534987-15535009 ACTTTATCCTGGGAGTGATAGGG + Intronic
1163889200 19:19995954-19995976 TCATTGTCATGGGGTTGCCATGG + Intergenic
1166212551 19:41316437-41316459 ACTTTGTCCTGGGGTTTAGATGG - Exonic
1166388922 19:42397980-42398002 ACTTTGTCCTGAGGGTGAGGGGG + Intergenic
1166558228 19:43715814-43715836 ACTTTGTCCTTGGGGGGTGATGG + Intergenic
1166861047 19:45811392-45811414 AATGGGGCCTGGGGGTGCCAGGG + Intronic
1167254342 19:48418416-48418438 ACTTTGTCCTGGGGGTGCTAGGG + Intronic
1167267062 19:48488498-48488520 ACTTTGTCCTGGGGGTGCCAGGG - Intronic
1167476201 19:49702719-49702741 ACTCTTTCCTGGGGGTACTAGGG + Intronic
1167667700 19:50832264-50832286 ACTTTATCCTGGTGGTGCCAAGG - Intronic
1167747979 19:51364011-51364033 ACTCTGTCCTGAGGGTGCTGGGG + Intronic
925019121 2:554616-554638 ACCGTGTCCTGGGGGTGACATGG + Intergenic
925581746 2:5417915-5417937 ACTCTATCCTGGGAGAGCCATGG - Intergenic
925751726 2:7095516-7095538 AGGCTGTCCTGGGGGTGGCAGGG + Intergenic
929556495 2:42928810-42928832 GCTTTCTCCTGGGGGAGCCAAGG - Intergenic
932948885 2:76269963-76269985 GCTTTGTCCTGGGTGTTCCAGGG + Intergenic
935229523 2:101083742-101083764 ACCTTGTCCTGGGGCTGCCCAGG + Intronic
936087686 2:109480477-109480499 TGTTAGTCCTGAGGGTGCCAAGG + Intronic
936385428 2:112024478-112024500 TCTGTGCCCTGGGTGTGCCAAGG + Intronic
939193931 2:138949099-138949121 CCTATGTCCTGGGGCTGTCATGG + Intergenic
941883661 2:170506516-170506538 ACTTTATGCTGGGGCTCCCACGG + Intronic
1170011453 20:11728293-11728315 ATTTTCTCCTGCCGGTGCCAGGG + Intergenic
1170335509 20:15266685-15266707 ACTTTGTCCTGGGAGTGATGGGG - Intronic
1171349459 20:24491557-24491579 ACCTTGTCCTGGGTCTGCTATGG - Intronic
1172335370 20:34111707-34111729 ACTGGGTGCCGGGGGTGCCAGGG - Intronic
1172971906 20:38879858-38879880 ATCTTGTCCTGGTGGTGCTAAGG + Intronic
1176013616 20:62915129-62915151 CCTTTGTTCTGAGGTTGCCAGGG - Intronic
1176141306 20:63546290-63546312 ACATCGTCCTGGGGGTTGCATGG - Intronic
1176246429 20:64099427-64099449 ACTTTCTCCTGGGGTGGCCCCGG - Exonic
1176380222 21:6108911-6108933 ACTTAGTTATGAGGGTGCCAGGG + Intergenic
1176445150 21:6815457-6815479 ACTTAGTCCAGGGCGTACCAGGG + Intergenic
1176823317 21:13680490-13680512 ACTTAGTCCAGGGCGTACCAGGG + Intergenic
1179743252 21:43429327-43429349 ACTTAGTTATGAGGGTGCCAGGG - Intergenic
1180986951 22:19910555-19910577 ACTCTGTCCTGTGGCTGCCTTGG - Intronic
1182086402 22:27564060-27564082 ACTCTGGCCAGGGGGTGGCAGGG - Intergenic
1182756952 22:32688019-32688041 TCTTTGTCCTGGAGGTCCCCTGG - Intronic
1183192590 22:36331314-36331336 ACTTTCTCGTGGCGGTGCCAGGG - Intronic
1183616292 22:38947768-38947790 CATTGGTCCTGGGGCTGCCAGGG + Intergenic
1185133750 22:49056703-49056725 ACTTTTTCCTGGGGAACCCAAGG + Intergenic
1185338866 22:50282874-50282896 ACTTCGTCCTGGGGGAGGGAGGG + Exonic
949409784 3:3751098-3751120 ACTATGGCCTGTGGGTGCTAAGG - Intronic
952946345 3:38479983-38480005 ACTGTGTCCTGGGGATGGCATGG + Intronic
953584423 3:44186864-44186886 CCTTTTTCTTGGGGGAGCCAAGG - Intergenic
953932539 3:47012874-47012896 ACTTTCTCCTGGTGCTGCCGAGG - Intergenic
954379600 3:50212633-50212655 ACTCTGGCCTGGGGCTGCCTGGG + Intronic
956724861 3:72148619-72148641 ATTTTTTCATGGGGGTGCCTAGG - Intergenic
960996781 3:123345457-123345479 CCTTTGTCCATGCGGTGCCAGGG + Intronic
961192547 3:124974209-124974231 ACTGTGTCTTGGGGGTGGCCAGG + Intronic
961929125 3:130515184-130515206 TATTTGTCCTGGCGGGGCCATGG + Intergenic
962117074 3:132521856-132521878 AATTTCTCCTGGGGTTCCCATGG - Intronic
968436120 4:590426-590448 ATTTTGGCCTGGAGGTGCAAGGG - Intergenic
975849162 4:78553727-78553749 ACTTTTCTCTGGGGGTGTCAGGG + Intronic
976717435 4:88137627-88137649 ACATTGTCCAGGAGGAGCCAAGG - Intronic
977787463 4:101054430-101054452 CCTTTATGCTTGGGGTGCCAAGG + Intronic
978591551 4:110329730-110329752 ACTATGTCCTGGGGCTGCATAGG - Intergenic
979192692 4:117882263-117882285 ACTTTGTCCTGGGAGGCCCATGG + Intergenic
983312395 4:166081276-166081298 CCTTTGTCGTAGGGGTGGCAGGG + Intronic
985540428 5:484964-484986 ACATGGTCCTGGGGGTTCCTGGG - Intronic
985930400 5:3052447-3052469 ACTCTGTCCTTGTGCTGCCATGG + Intergenic
985997376 5:3604495-3604517 CCTTTGGGCTGGGGCTGCCAGGG - Intergenic
987059924 5:14232902-14232924 ACTTGGAGCTGGGGGTGCCAGGG + Intronic
993010551 5:82477618-82477640 TCTTGGTCTTGGGGATGCCAAGG + Intergenic
993490733 5:88544404-88544426 TATTTGTTCTGGGAGTGCCACGG - Intergenic
993954605 5:94216547-94216569 ACCTAGTCCTGGGGGACCCAGGG + Intronic
994097858 5:95863291-95863313 AGTTTGTCCTGGAGGTCCTAAGG + Intergenic
995735400 5:115295704-115295726 ACATTCTCATGGGGGTGCGAGGG + Intronic
998478720 5:142443537-142443559 ACTCTCCTCTGGGGGTGCCAAGG + Intergenic
999195645 5:149779814-149779836 ACTGTGTGCTGGGGTTGCCCAGG + Intronic
1000656958 5:163890852-163890874 CCTTTGTCCTGGGGAAACCATGG - Intergenic
1003246562 6:4386902-4386924 GCTTTGTCCTGGGTGGGACATGG + Intergenic
1003980997 6:11389630-11389652 ACTCTGTCCAGGGGATACCAAGG - Intergenic
1004403835 6:15313210-15313232 CCTGTTTCCTTGGGGTGCCATGG - Intronic
1006169974 6:32087093-32087115 GCTTTGTCCTGGGGGCCCCCTGG + Intronic
1006262590 6:32887625-32887647 ACTTTGTTTTGGAGGTTCCAAGG - Intergenic
1007745339 6:44039939-44039961 ACACTGTCCTGGGGGTTCCTGGG + Intergenic
1012034221 6:94111107-94111129 ACTTTGCCCTGGGGGTCCCATGG - Intergenic
1012131568 6:95499992-95500014 CCTGTGTCCTGGGGGTGACAGGG - Intergenic
1012554415 6:100494297-100494319 ACTTTGTCATGGGGCAGCCCTGG - Intergenic
1013886998 6:114980001-114980023 ACTTTGTCTTGGAGGTGTCAGGG - Intergenic
1014817040 6:125947472-125947494 ACTTTGCCTTGGGGGTGGCAAGG - Intergenic
1015630645 6:135228844-135228866 ACTTGGTCCTGGGTGTGACCTGG - Intergenic
1015945522 6:138496299-138496321 ACATTCTCCTGCTGGTGCCACGG + Exonic
1017216875 6:151918376-151918398 GATTTCTCCTGGGGGTGCAAAGG - Intronic
1017220230 6:151957808-151957830 ACTTTGTCTTGGTTATGCCAAGG - Intronic
1019365492 7:630487-630509 CCATTGCCCTGGGGGTCCCACGG + Intronic
1019602291 7:1890776-1890798 ACTTTGTCCTTGGGGAGCTGAGG + Intronic
1019745849 7:2700082-2700104 GCTGTGTCCTGGAGGGGCCAGGG + Intronic
1022959559 7:35413536-35413558 ACTTTCTCTTGGGGGTGCCTTGG + Intergenic
1023848116 7:44134687-44134709 ACTTGTTCCTGGGGGCCCCAAGG - Intergenic
1025254461 7:57374132-57374154 ACTTTGTCCTGTGGGTAAAAGGG + Intergenic
1025937781 7:66050974-66050996 ACTGTGTCCTGGAGGCTCCATGG + Intergenic
1026071292 7:67122828-67122850 ACTTTGTCCTCAGTGTGCTAAGG - Intronic
1026705600 7:72689460-72689482 ACTTTGTCCTCAGTGTGCTAAGG + Intronic
1029176723 7:98669924-98669946 ACTTAGTCCTGGGGAGGCAAAGG - Intergenic
1029743361 7:102503508-102503530 ACCTTGCTCTGGGGGTGGCAGGG + Intronic
1029761350 7:102602669-102602691 ACCTTGCTCTGGGGGTGGCAGGG + Intronic
1031009727 7:116513382-116513404 ACTTTGTCTTGGAGATCCCAGGG + Intergenic
1033733941 7:144204082-144204104 ACTTTATGCTAGAGGTGCCATGG + Intergenic
1033749110 7:144346891-144346913 ACTTTATGCTAGAGGTGCCATGG - Intergenic
1034950197 7:155291627-155291649 GTTTTTTCCTGGTGGTGCCAAGG - Intergenic
1036648146 8:10625005-10625027 ACTTTGTCCAGTGGATGACAGGG + Intronic
1036671561 8:10791914-10791936 ATGTTGTCCTGGGGGTCTCAGGG - Intronic
1040574503 8:48639579-48639601 GCTGTGACCTGGGGGTGCCTGGG + Intergenic
1041206126 8:55499418-55499440 ACTCTGTCCTTGGGGTCCCAAGG - Intronic
1041708592 8:60872684-60872706 ACTTTGTCGTTGAGTTGCCACGG - Intergenic
1047377433 8:124315114-124315136 ACTCTGTACTGGGTGTACCATGG + Intronic
1048572519 8:135667508-135667530 ACTGTGTCCTTGGGGTGTCCCGG - Intergenic
1048825044 8:138416140-138416162 ATTTTGTCCTGGGGGATCAAGGG - Intronic
1049347539 8:142146752-142146774 ACCTTGGCCTGGGGCCGCCAGGG + Intergenic
1049393399 8:142383410-142383432 ACTCTGTCCTGGGTGTGCTTGGG - Intronic
1049671835 8:143873455-143873477 ACTCTGCCGCGGGGGTGCCAAGG + Intronic
1052681189 9:31695105-31695127 ACCTTGTCCTGGGGTGACCAGGG + Intergenic
1053020650 9:34691687-34691709 TGGTTGTCCTGAGGGTGCCAGGG - Intergenic
1056919114 9:90770595-90770617 AGTTGTTCCTGTGGGTGCCAAGG + Intergenic
1056955140 9:91075384-91075406 ACTGTGTCCTGGGCCTGCCCTGG + Intergenic
1057303599 9:93900121-93900143 ACTTTGTCCTGGGGGTACTAGGG - Intergenic
1058239625 9:102540710-102540732 TTTGTGTCCTGGGGGTGGCAGGG + Intergenic
1058542058 9:106021743-106021765 ACTTTGTCCTGGTGCTGCCTGGG + Intergenic
1060633775 9:125183918-125183940 ACTGTTCCCTGTGGGTGCCAGGG - Intronic
1060820760 9:126660342-126660364 AGTTTGTCCTGGTGTGGCCAAGG + Intronic
1060852014 9:126886097-126886119 GATTTGTTCTGGGGGTGCCTGGG - Intergenic
1060944225 9:127560462-127560484 CCTTTGTCCTTAGGGTCCCAGGG - Intronic
1061513231 9:131073355-131073377 CCCTTCTCCTGGGGGTTCCAGGG + Intronic
1061573847 9:131494170-131494192 GCTCTGTCCTGGAGGTGCCAGGG + Intronic
1061957208 9:133969931-133969953 GCTTCATCCTGGGTGTGCCAGGG - Intronic
1062113697 9:134796481-134796503 ACTTTGTCCTGGGGTGGGCTGGG + Intronic
1062600644 9:137317342-137317364 AGGCTGTCCTCGGGGTGCCAGGG - Intronic
1187971415 X:24662706-24662728 ACTTTGTACTGGGAGGGGCAGGG - Intronic
1189579822 X:42394302-42394324 TCTCTGTCCTGGGCCTGCCAGGG - Intergenic
1191034368 X:56008739-56008761 ATTTTTTCCTGCTGGTGCCAGGG + Intergenic
1192238235 X:69309773-69309795 ACTTGGTCCTAGGGGGGCCCTGG - Intergenic
1198936219 X:141904324-141904346 GCCTTGTTCTGGGGGTCCCATGG + Intronic
1201152666 Y:11102447-11102469 ACTTTGTCCGTGGGGCGCCCAGG + Intergenic