ID: 1167268190

View in Genome Browser
Species Human (GRCh38)
Location 19:48493642-48493664
Sequence GGTCGCGGCCTGGAGGGAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 392
Summary {0: 1, 1: 0, 2: 2, 3: 36, 4: 353}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167268190_1167268206 26 Left 1167268190 19:48493642-48493664 CCTGCTCCCTCCAGGCCGCGACC 0: 1
1: 0
2: 2
3: 36
4: 353
Right 1167268206 19:48493691-48493713 CACCTGGTCGAAGAGGTAGACGG 0: 1
1: 1
2: 0
3: 13
4: 139
1167268190_1167268204 19 Left 1167268190 19:48493642-48493664 CCTGCTCCCTCCAGGCCGCGACC 0: 1
1: 0
2: 2
3: 36
4: 353
Right 1167268204 19:48493684-48493706 GGTTCCGCACCTGGTCGAAGAGG 0: 1
1: 0
2: 0
3: 3
4: 79
1167268190_1167268197 -2 Left 1167268190 19:48493642-48493664 CCTGCTCCCTCCAGGCCGCGACC 0: 1
1: 0
2: 2
3: 36
4: 353
Right 1167268197 19:48493663-48493685 CCCCGAAACCGCGCCCTCTCGGG 0: 1
1: 0
2: 1
3: 7
4: 94
1167268190_1167268201 10 Left 1167268190 19:48493642-48493664 CCTGCTCCCTCCAGGCCGCGACC 0: 1
1: 0
2: 2
3: 36
4: 353
Right 1167268201 19:48493675-48493697 GCCCTCTCGGGTTCCGCACCTGG 0: 1
1: 0
2: 0
3: 10
4: 51
1167268190_1167268195 -3 Left 1167268190 19:48493642-48493664 CCTGCTCCCTCCAGGCCGCGACC 0: 1
1: 0
2: 2
3: 36
4: 353
Right 1167268195 19:48493662-48493684 ACCCCGAAACCGCGCCCTCTCGG 0: 1
1: 0
2: 1
3: 2
4: 40

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167268190 Original CRISPR GGTCGCGGCCTGGAGGGAGC AGG (reversed) Intronic
900130648 1:1085752-1085774 GGCAGAGGCCGGGAGGGAGCAGG - Intronic
900235988 1:1590912-1590934 GGAGTCGGGCTGGAGGGAGCAGG + Intergenic
900416127 1:2535559-2535581 GGTGGAGGGCTGCAGGGAGCGGG - Intergenic
901054053 1:6440491-6440513 GGGCGGGGAGTGGAGGGAGCGGG + Intronic
901696537 1:11012281-11012303 GGGCGGGGCCTGGAGGGGGCGGG - Intergenic
901883422 1:12207090-12207112 GGTGGGGGCCTGGAAGGACCAGG - Exonic
902480240 1:16707819-16707841 GGGCGGGGAGTGGAGGGAGCGGG - Intergenic
902691773 1:18114292-18114314 GGTCCCTGCCTGGGTGGAGCAGG - Intronic
903016776 1:20366649-20366671 GGTCGGGGCGCGGAGGGTGCTGG - Intergenic
903132771 1:21290334-21290356 GGGCGCGGCCTGGAGGGCGGGGG - Intronic
903273935 1:22209000-22209022 GGTCGGGGCCATGAGGGAGGGGG - Intergenic
903366325 1:22807538-22807560 GGTAGAGGCTGGGAGGGAGCTGG - Intronic
903699000 1:25232373-25232395 GGGAGCGGCCTGGAGAGAGGTGG - Intronic
903931300 1:26863982-26864004 GGTGGGGGACTGGAGGGGGCAGG - Exonic
904012916 1:27399868-27399890 GGTCTCAGCATGGAAGGAGCTGG - Intergenic
904038388 1:27570859-27570881 GGCAGGGGCCTGGAGGGGGCTGG - Intronic
905205286 1:36339909-36339931 GGCAGCAGCCTGGAGGGACCCGG + Exonic
905677475 1:39837817-39837839 GGTCCAGGCCTTGAGGCAGCGGG + Intergenic
905819622 1:40979627-40979649 GGGCGGGGCCTGGAGTGCGCAGG - Exonic
905819633 1:40979653-40979675 GGGCCGGGCCTGGAGGGCGCGGG - Exonic
906177260 1:43785383-43785405 GGTAGAGGCCTGGATGGTGCTGG + Intronic
907314311 1:53558794-53558816 TGTCGGGGCCTGAATGGAGCAGG - Intronic
910736616 1:90465349-90465371 GTTCAGGGCTTGGAGGGAGCTGG - Intergenic
912496682 1:110096291-110096313 GGTCTCGGCCAGGAGGGACTGGG + Intergenic
913671117 1:121097876-121097898 GGCGGCGGCAGGGAGGGAGCGGG + Intergenic
914022884 1:143885297-143885319 GGCGGCGGCAGGGAGGGAGCGGG + Intergenic
914661371 1:149793241-149793263 GGCGGCGGCAGGGAGGGAGCGGG + Intronic
915128575 1:153681839-153681861 GGTCAGGGCCTGGAGGTGGCTGG + Exonic
915327201 1:155086575-155086597 GGGCGGGGCTTGGAAGGAGCAGG + Exonic
915835324 1:159171613-159171635 GGTGGGGACCGGGAGGGAGCCGG - Exonic
920554898 1:206897566-206897588 GCTGGCTGCCTGGAGGCAGCTGG - Exonic
921814098 1:219545896-219545918 GGCCCCGTCCTGGAGGGAGGTGG + Intergenic
924437438 1:244054758-244054780 GGACTCGGTCTTGAGGGAGCTGG + Exonic
924482739 1:244451731-244451753 GGGCGCGGCCCGGAGGAAACCGG - Exonic
1063095685 10:2906695-2906717 GTTCACGGCCTGGAGGGAACTGG - Intergenic
1063504013 10:6580170-6580192 CGCCGCCGCCGGGAGGGAGCGGG - Intronic
1063565709 10:7171115-7171137 GGCCGAGGCCTGGAGAGTGCTGG - Intronic
1065816813 10:29490154-29490176 GGATGTGGGCTGGAGGGAGCAGG - Intronic
1066084048 10:31959770-31959792 GGTAGTAACCTGGAGGGAGCTGG + Intergenic
1067069217 10:43119960-43119982 GGTAGCGGCCTGGTGAGACCTGG - Intronic
1067251543 10:44590768-44590790 GGTAGCGACCTGGAGGCATCAGG - Intergenic
1068544937 10:58334929-58334951 GGGCGCGGCGGGGAGGGCGCAGG + Intergenic
1069557783 10:69408872-69408894 GGGCGGGGCCTGGAGGGGGCGGG - Intronic
1069557792 10:69408888-69408910 GGCGGGGGCCTGGAGGGGGCGGG - Intronic
1069629837 10:69890695-69890717 GGTTGGGGCCCAGAGGGAGCTGG - Intronic
1070828219 10:79403546-79403568 GGCCGCGGCCTGCAGGATGCTGG + Intronic
1071502366 10:86212946-86212968 GCTCGGGCCCTGGAGTGAGCTGG + Intronic
1072695823 10:97602009-97602031 GGGCGCGGCCTGGCGGGGGGTGG + Intronic
1074362998 10:112837907-112837929 GGCCGAGGCCTGGATTGAGCTGG - Intergenic
1075519837 10:123136729-123136751 GGACACGGCCTGGAAGGAGGGGG + Intronic
1076230125 10:128813402-128813424 GACTGTGGCCTGGAGGGAGCAGG + Intergenic
1076662671 10:132065745-132065767 GTTCGCGCCCTGCAGGGAGCTGG + Intergenic
1076689091 10:132211762-132211784 GGTCCCTGCCCTGAGGGAGCTGG - Intronic
1076908197 10:133373560-133373582 CGGCGGGGCCTGGAGGGCGCTGG - Exonic
1076948266 10:133665866-133665888 GGGGGCGGGCGGGAGGGAGCCGG + Intergenic
1076949255 10:133669176-133669198 GGGGGCGGGCGGGAGGGAGCCGG + Intronic
1076950239 10:133672475-133672497 GGGGGCGGGCGGGAGGGAGCCGG + Intergenic
1076951224 10:133675774-133675796 GGGGGCGGGCGGGAGGGAGCCGG + Intergenic
1076952214 10:133679084-133679106 GGGGGCGGGCGGGAGGGAGCCGG + Intergenic
1076953202 10:133682394-133682416 GGGGGCGGGCGGGAGGGAGCCGG + Intergenic
1076955170 10:133742045-133742067 GGGGGCGGGCGGGAGGGAGCCGG + Intergenic
1076956160 10:133745355-133745377 GGGGGCGGGCGGGAGGGAGCCGG + Intergenic
1076957148 10:133748664-133748686 GGGGGCGGGCGGGAGGGAGCCGG + Intergenic
1076958137 10:133751974-133751996 GGGGGCGGGCGGGAGGGAGCCGG + Intergenic
1076959121 10:133755273-133755295 GGGGGCGGGCGGGAGGGAGCCGG + Intergenic
1076960110 10:133758583-133758605 GGGGGCGGGCGGGAGGGAGCCGG + Intergenic
1078256592 11:9664042-9664064 GGGCGGGGCCTGGCGGGGGCGGG + Intergenic
1078579238 11:12525879-12525901 GGATAAGGCCTGGAGGGAGCAGG + Intronic
1079060361 11:17243338-17243360 GGTTGTGGGGTGGAGGGAGCGGG + Intronic
1081613321 11:44576479-44576501 GGTCCTGTTCTGGAGGGAGCCGG + Intronic
1081831961 11:46121655-46121677 GGCCGCGGCGGGGAGGGAGGGGG + Intergenic
1081854596 11:46295621-46295643 GGTGGCGGCGTGGAGGGCACCGG - Intronic
1083487065 11:62989945-62989967 GGTCTCGACCTGGAGGGAGAAGG - Intronic
1083560589 11:63670828-63670850 AATCGGGGCCTGGATGGAGCGGG - Intronic
1083920838 11:65780843-65780865 GGCCGCGGGCGGGAGGGAGGCGG - Intergenic
1084154000 11:67303803-67303825 GGGCTCGGGCTGGAGGGCGCTGG + Intronic
1084675067 11:70629470-70629492 GGTTCCGGCCTGGCGGGAGAGGG + Intronic
1084955506 11:72689245-72689267 GGTCTGGGCTTGGAAGGAGCAGG + Intronic
1085411271 11:76292109-76292131 GCTTGGGGACTGGAGGGAGCAGG - Intergenic
1087192852 11:95273990-95274012 TGTCGTGGGGTGGAGGGAGCAGG + Intergenic
1089253060 11:117179045-117179067 GGGGGCGGCCGGGAGGGGGCGGG - Exonic
1090189579 11:124759488-124759510 GGCCGAGGCCTGGAGGGAGTAGG - Intronic
1090399914 11:126442650-126442672 GGGCATGGGCTGGAGGGAGCTGG - Intronic
1090768266 11:129895629-129895651 GGGCGGGGCCTGGAGGGTGCCGG + Intergenic
1092980182 12:13786851-13786873 GGTGGGGGCTGGGAGGGAGCAGG + Intronic
1093894697 12:24562777-24562799 GGGGGCGACCTGGAGGGAGCGGG - Intergenic
1094199229 12:27780135-27780157 GGCCGCCGCCTCGCGGGAGCGGG + Exonic
1096491598 12:52015676-52015698 GGTCGAGGCCAGGAGGGAGGAGG - Exonic
1096496709 12:52043052-52043074 GGTCCCAGCCTGGAGGGAAGGGG + Intronic
1097053653 12:56237937-56237959 AGTAGGGGCCTGGAGGGTGCAGG + Exonic
1097401968 12:59139020-59139042 TGTCGGGGGCTGGAGGGGGCTGG - Intergenic
1098255512 12:68611359-68611381 GGACGCGGGCTGAAGAGAGCGGG - Intronic
1100466383 12:94849390-94849412 GGTTGCAGTCTGGTGGGAGCTGG - Intergenic
1102619985 12:114186666-114186688 AGTCGAGGACAGGAGGGAGCGGG + Intergenic
1103789295 12:123458223-123458245 GGAAGCGGCTTGGAAGGAGCGGG + Intronic
1104970503 12:132528596-132528618 GGTGTCTGCCTGGGGGGAGCGGG + Intronic
1107307616 13:39038789-39038811 GGTCGTGGCATGGAGGTGGCAGG + Intronic
1107898648 13:44990199-44990221 GGTCGGGGGCTGGAGAGAACAGG - Intronic
1108934467 13:55868043-55868065 GGTGCAGGACTGGAGGGAGCTGG + Intergenic
1112771874 13:102800748-102800770 GGAAGGGGCCTGGAGGGCGCGGG + Intronic
1113417122 13:110137045-110137067 GGGTGCAGCCTGGAGAGAGCTGG + Intergenic
1113766090 13:112881941-112881963 ACTCGCGGCCTGGAAGGAGAAGG + Exonic
1114269315 14:21091496-21091518 GGACCCGGCCTGAAGGGGGCCGG - Exonic
1114635586 14:24185034-24185056 GGTTTCCGCCTGGAGGGAGGTGG - Intronic
1118493128 14:66281180-66281202 GTTCGCGGCCTAGAGGGAGCTGG - Intergenic
1119202919 14:72771673-72771695 GCTCCCAGCCTGGAGGGAGGAGG - Intronic
1119348465 14:73944934-73944956 GGAGGAGGTCTGGAGGGAGCAGG - Intronic
1121427555 14:93863373-93863395 GGTGGAGGCCAGGAGAGAGCAGG + Intergenic
1122117603 14:99535589-99535611 GGTCGGGCCCAGGAGGGAGGAGG + Intronic
1122429062 14:101628604-101628626 GCTCGCGGCCGGCAGGGGGCAGG - Intergenic
1122445064 14:101761935-101761957 GGCCGCGGGACGGAGGGAGCAGG + Intronic
1122631951 14:103111348-103111370 GGAGGGGGCCTGGAGGGAGTGGG - Intergenic
1122795892 14:104206050-104206072 AGTCGGGGCCTGGAGGCACCAGG - Intergenic
1122811524 14:104291736-104291758 GAGCGAGGCCTGGAGGGTGCTGG - Intergenic
1122825951 14:104370545-104370567 AGCTGGGGCCTGGAGGGAGCAGG - Intergenic
1122904131 14:104794253-104794275 GGGCGTGGCCTGGAGGCAGAGGG + Intronic
1122975366 14:105168667-105168689 CGTCGCCGCCGGGTGGGAGCCGG - Exonic
1123019792 14:105392296-105392318 AGGCGCAGCCTGGAAGGAGCCGG - Intronic
1124365253 15:29066536-29066558 GGTCAGGGGCTGGAGAGAGCAGG + Intronic
1125651553 15:41321279-41321301 CGTCCCGTCCTGGAGGGAGGTGG + Intronic
1125698516 15:41660034-41660056 GGGCGCGGCCGGGGCGGAGCCGG + Intronic
1125725660 15:41866962-41866984 GGTTGCGGCCTGGGTGAAGCTGG + Exonic
1129273040 15:74429367-74429389 GGTGGCGCCCTGGGGGAAGCAGG - Intronic
1129336117 15:74853216-74853238 GGTGGTGGGCTGTAGGGAGCTGG - Intronic
1129424691 15:75454918-75454940 GGTCGCGGCCTGACGGGTTCCGG + Intronic
1129451616 15:75654419-75654441 GGTTGGGGGCAGGAGGGAGCAGG - Intronic
1129743331 15:78000882-78000904 GGTGGTGGCCTGGAGGTAGGTGG - Intronic
1130353195 15:83108659-83108681 GGTTGCTGTCTGGAGGGAGGAGG + Intronic
1131270999 15:90947643-90947665 GGTGGTGGTCTGGAGGGAGAGGG + Intronic
1132808727 16:1787699-1787721 CGACGTGGCCTGGGGGGAGCTGG + Exonic
1132847993 16:2009487-2009509 GGGCGCGGCCCGGGGGCAGCGGG - Intronic
1133053684 16:3134278-3134300 GGTCGAGGCGTGGAGAGAGTGGG + Intronic
1133170019 16:3977015-3977037 GGTCACAGCCTGGAAGGAGGAGG - Intronic
1133269066 16:4601855-4601877 GGGAGCTGCCAGGAGGGAGCTGG + Intergenic
1133730729 16:8576464-8576486 GGTCTCTGGCTGGAGGGAACTGG + Intronic
1134232313 16:12438429-12438451 GGTCCTGGGCTGGAGTGAGCGGG - Intronic
1135976149 16:27109951-27109973 GGGCGCGGCGGGGCGGGAGCGGG - Intergenic
1136546663 16:30958401-30958423 GGGCGGGGCCTGCAGGGGGCGGG + Intronic
1137237970 16:46631195-46631217 GTTCGTGGCTTGGAGGGAGAGGG - Intergenic
1137426567 16:48385367-48385389 GGCGGCGGCCAGGGGGGAGCCGG - Intronic
1137707789 16:50547809-50547831 TGTCGCTGCCTGGAGAGGGCTGG + Intergenic
1139478639 16:67216015-67216037 GGGCCCTGCCTGGAGGCAGCTGG - Intronic
1141619457 16:85229108-85229130 GGTGGCGGCATCGTGGGAGCAGG + Intergenic
1141646598 16:85371067-85371089 GGCCTGGGCCTGGAGGGAGCCGG + Intergenic
1141699535 16:85636114-85636136 GGTTGCAGCTGGGAGGGAGCAGG - Intronic
1141749106 16:85946468-85946490 GGTGGTGGCCCAGAGGGAGCAGG - Intergenic
1142558725 17:797190-797212 AGCCGCAGCCTGGAGGAAGCAGG + Intergenic
1142627776 17:1203372-1203394 GGGCGGGGCCTTGAGGGGGCGGG + Intronic
1142750378 17:1983924-1983946 TGTCCCAGCCGGGAGGGAGCAGG - Intronic
1142982424 17:3679868-3679890 GGTGGCGGCCTGCAGGGCGAGGG - Intronic
1143118341 17:4592973-4592995 GGACGAGGCCTGGGGGGATCTGG - Exonic
1143470828 17:7174137-7174159 GGTCACGTCCTGGGAGGAGCAGG - Exonic
1143597297 17:7923001-7923023 GGCCGCTGCGTGGAGGGATCCGG + Exonic
1143747232 17:9003461-9003483 GGTCGCGGCCCGGAGCAGGCTGG - Intergenic
1144185207 17:12790011-12790033 GAGCGGCGCCTGGAGGGAGCTGG - Intronic
1144724281 17:17493920-17493942 GGTGGCACCCTGGAGTGAGCGGG + Intergenic
1144816511 17:18039247-18039269 AGGCGCGGCGTGGAGGGGGCGGG - Intergenic
1146057813 17:29589743-29589765 GGGCGCGGGCAGGAGGGGGCGGG + Intronic
1146894943 17:36534494-36534516 GGGGGCGGCCTGGGGGGAGAGGG - Intronic
1147164626 17:38586676-38586698 GATGGAGCCCTGGAGGGAGCTGG + Intronic
1147225796 17:38975967-38975989 TGCCTCGGCCTGGAGGGAGAGGG + Intergenic
1147558910 17:41497086-41497108 GGTCGGGTTCTGGAGGGAGGAGG - Intergenic
1147726094 17:42567026-42567048 GGTCGCGGATTGGCGGGCGCGGG + Intergenic
1148122564 17:45221712-45221734 GGGGGCGGGCTGGAGGGAGGGGG - Intronic
1148643815 17:49207490-49207512 AGTCGAGGTGTGGAGGGAGCTGG - Intronic
1150176704 17:63065052-63065074 GTTAGGGGCTTGGAGGGAGCAGG - Intronic
1152068135 17:78122550-78122572 GGGCCAGGCCTGCAGGGAGCTGG + Intronic
1155054012 18:22169766-22169788 GACCGCGGCCTGGAGAGGGCCGG - Intronic
1155933620 18:31731757-31731779 TGTTGCTGCCTGGAGGGAGCAGG + Intergenic
1156270189 18:35523575-35523597 GGTAGCTGCCTGGGGGGAGCAGG - Intergenic
1157359505 18:46964539-46964561 AGTCACAGCCTGGAGCGAGCTGG + Intronic
1157361099 18:47024058-47024080 AGTCACAGCCTGGAGCGAGCTGG + Intronic
1157362089 18:47029973-47029995 AGTCACAGCCTGGAGCGAGCTGG + Exonic
1157362965 18:47035391-47035413 AGTCACAGCCTGGAGCGAGCTGG + Exonic
1160591244 18:79945746-79945768 GGCTGAGGCCTGGAGGGGGCCGG - Intronic
1160745414 19:709044-709066 GGACGCGGCCTGGCGGGGGCCGG - Intergenic
1160768711 19:821173-821195 GCTGGGGGCCTGGAGGGGGCGGG - Intronic
1160980000 19:1812358-1812380 GGGCGGGGCCTGGAGGGGGTGGG + Intergenic
1161025481 19:2034877-2034899 GGTTTGGGCCTGGAGGGGGCTGG - Intronic
1161169969 19:2807755-2807777 GGACGCGGCCTCGGGGGAGGTGG + Exonic
1161614559 19:5262804-5262826 GGTCGCGGGGAGGAGGGAGAGGG + Intronic
1161739393 19:6011334-6011356 GGTGGGGGCAGGGAGGGAGCCGG + Intronic
1162043565 19:7984708-7984730 GGTAGGTGCCTGGAGGCAGCAGG + Intronic
1162718339 19:12647632-12647654 GGGCGGGGCCTGGATGGAGAAGG + Intronic
1162972211 19:14187573-14187595 GGTTGGGGGCTGGAGGTAGCTGG - Intronic
1163082568 19:14954359-14954381 GGGCGTGGCCTGGTGGGGGCGGG + Intronic
1163116575 19:15192290-15192312 AGTCAGGGCCTGGAGGGACCAGG + Exonic
1163369978 19:16896490-16896512 GGGCGCGGCCTGGCGGCAGGCGG + Exonic
1163493033 19:17628032-17628054 GGTCTGGGTCTGGAGGAAGCTGG + Intronic
1163573596 19:18097879-18097901 GGACGCGGCCTGAAAGGTGCCGG + Intronic
1163664479 19:18596842-18596864 GGGCGGGGCCTGGAAGGAACAGG + Intronic
1163835972 19:19574391-19574413 GGCCACGGGCTGCAGGGAGCTGG - Intronic
1164579094 19:29423279-29423301 GGTCTGGGCCTGGAGTGAGGAGG - Intergenic
1164602036 19:29568647-29568669 GGCCGCTGCCTGGAGGGCGCAGG - Intergenic
1165446720 19:35860729-35860751 GGTCGGGGCCTGGAGGGGCGGGG + Intronic
1165742107 19:38210726-38210748 GGGCGCAGCCGGGAGGGAGGCGG - Intergenic
1166043732 19:40217763-40217785 GGTCTGTGGCTGGAGGGAGCTGG - Intronic
1166069077 19:40377173-40377195 GGTCGGGGCCAGGATGGAGGAGG + Intronic
1166306842 19:41940223-41940245 GGGCGAGGCCTGGCGGGCGCGGG + Intergenic
1167058888 19:47131087-47131109 GTTTGCGGCCCGGAAGGAGCGGG + Intronic
1167080754 19:47274856-47274878 GGGCGGGGCCTGGTGGGGGCGGG + Exonic
1167251142 19:48398937-48398959 GGGCGGGGCCTAGAGGGGGCGGG + Intronic
1167268167 19:48493574-48493596 GGGCGGGGCCTGGAGGGAGGCGG - Intronic
1167268190 19:48493642-48493664 GGTCGCGGCCTGGAGGGAGCAGG - Intronic
1167578342 19:50328367-50328389 GGCGGCGGCCTGGACGGAGCGGG - Exonic
1167636315 19:50658144-50658166 GGGCGGGGCCTGGAGCGAGCGGG + Intronic
1167638523 19:50668227-50668249 GGGGGCGGCCCGGAGGGAGGGGG - Exonic
1167941094 19:52946487-52946509 GGGCCAGGCCTGGAGGGGGCGGG - Intronic
1168002940 19:53463532-53463554 GGGCGGGGCCTGGAGGGGGCGGG + Intergenic
1168564789 19:57413974-57413996 GGTCGGGGCATGCAGGGATCAGG + Intronic
1168717556 19:58538393-58538415 GGTGGTGGGCTGGAGGGGGCGGG + Intronic
1202714279 1_KI270714v1_random:33729-33751 GGGCGGGGAGTGGAGGGAGCGGG - Intergenic
925705942 2:6684807-6684829 GGAGCAGGCCTGGAGGGAGCTGG + Intergenic
926083938 2:10009646-10009668 GGCCGCAGCCTGGAGGGGACAGG + Intergenic
926130916 2:10302771-10302793 GGGCGGGGCCCGGAGGGGGCGGG + Intergenic
927294967 2:21443599-21443621 GGTCACAGCCAGGAGGCAGCTGG + Intergenic
927667391 2:25042141-25042163 GGCCGCGGGCAGGACGGAGCCGG - Exonic
928092875 2:28386769-28386791 GGTCTGGGCCTGGAGCAAGCGGG + Intergenic
928278311 2:29921642-29921664 GGGCGGGGCCCGGAGGGGGCGGG + Intergenic
932322977 2:70835419-70835441 GGTCTCGATCTGAAGGGAGCCGG + Intronic
932503976 2:72211008-72211030 TGTGGCTGCCTGGAGGGAACCGG - Intronic
934921299 2:98347081-98347103 GTCAGTGGCCTGGAGGGAGCAGG + Intronic
935658369 2:105443996-105444018 GGCCCCTGGCTGGAGGGAGCTGG + Intergenic
935673690 2:105576302-105576324 GGAGGAGGGCTGGAGGGAGCGGG + Intergenic
936671447 2:114662024-114662046 GGGCGCGGCCTGGAGAGCCCGGG - Intronic
937363369 2:121244215-121244237 TGATGAGGCCTGGAGGGAGCTGG + Intronic
937919956 2:127121996-127122018 TTTGGCAGCCTGGAGGGAGCTGG + Intergenic
938992779 2:136646462-136646484 GGTGGTGGCCTGCAGGGAGTGGG - Intergenic
942278731 2:174340962-174340984 GGTAGCGGCCTGGAGGTCGGTGG + Intergenic
944806916 2:203291824-203291846 TGTTGTGGCGTGGAGGGAGCGGG - Intronic
946295621 2:218781784-218781806 CCTCGCGTCCTGGAGGGAACGGG - Exonic
946432717 2:219634076-219634098 GGTGGGAGCCTGGAGGGAGATGG - Intronic
948809169 2:240466208-240466230 GGTCGGGGGCTGGGGGCAGCTGG - Exonic
948880149 2:240852511-240852533 GGCCGCGGCAGGGAGTGAGCAGG - Intergenic
1169557606 20:6767620-6767642 GGCCGCGGCCGGGAGGGAGCCGG + Intergenic
1171234276 20:23511532-23511554 GGTCTTGGGCTGGAGAGAGCAGG - Intergenic
1171459405 20:25290467-25290489 GGGCGCTGCCTGGAAGGAGAGGG - Exonic
1172772974 20:37392338-37392360 AGTTGAGGCCAGGAGGGAGCAGG - Intronic
1173733375 20:45343470-45343492 GTTTGCAGCCTGGAGGGAGAGGG - Intronic
1174280586 20:49435987-49436009 GGTCCTGGCCTGGAGGGCGGTGG + Intronic
1175837279 20:62004161-62004183 GGTCAGGGCCTGGAGGGGGCGGG + Intronic
1175888796 20:62306984-62307006 GCTGGAGGACTGGAGGGAGCTGG + Intronic
1176145575 20:63563910-63563932 GGTCGCGGCCTGCAGGAGCCAGG + Exonic
1176582002 21:8539404-8539426 GGTCAGGGCCTGGAGGAAACAGG + Intergenic
1178992690 21:37367854-37367876 GGCCGCGGCCTCCCGGGAGCCGG + Intronic
1179045871 21:37844615-37844637 GGTCACGGATTGCAGGGAGCTGG - Intronic
1179710519 21:43210587-43210609 GGTCAGGGCATGGAGAGAGCTGG + Intergenic
1179794875 21:43776752-43776774 GGTCCCGGCCCCGCGGGAGCAGG + Intergenic
1179795176 21:43778298-43778320 GGTTGAAGCCTGGGGGGAGCGGG + Intergenic
1179911969 21:44455461-44455483 GGGCGGGGCCTGGAGGGGGCGGG - Intergenic
1180051203 21:45331771-45331793 GGTCGTGTCCTGGAAGGAGGAGG + Intergenic
1180089384 21:45526031-45526053 GGTCATGGGCTGGTGGGAGCCGG - Intronic
1180190870 21:46161877-46161899 GGGCGCGGCCAGGAGGGTGCGGG - Intronic
1180201870 21:46229138-46229160 GGGCGGGGCCTGGTGGGTGCGGG + Intergenic
1180264839 22:10516452-10516474 GGTCAGGGCCTGGAGGAAACAGG + Intergenic
1182149443 22:28017967-28017989 CTTGGCGGCCTGGAGAGAGCAGG - Intronic
1183281612 22:36935506-36935528 GAGCAGGGCCTGGAGGGAGCTGG - Intronic
1183408129 22:37640278-37640300 GGTCCTGGCCTGGTGGGAGGAGG + Intronic
1184352978 22:43956988-43957010 TGTGGCGGCCTGCCGGGAGCAGG + Intronic
1184871418 22:47241176-47241198 TGTCGCGGGGTGGAGGGAGCGGG - Intergenic
1184920625 22:47603284-47603306 GGTGGGGGCCTGGTGGGAGGTGG + Intergenic
1184920647 22:47603362-47603384 GGTGGGGGCCTGGTGGGAGGTGG + Intergenic
1184920669 22:47603440-47603462 GGTGGGGGCCTGGTGGGAGGTGG + Intergenic
1185038414 22:48491153-48491175 GCTGGCCGCCTGCAGGGAGCAGG + Intronic
1185205113 22:49533382-49533404 GGAAGCATCCTGGAGGGAGCAGG + Intronic
949346497 3:3081816-3081838 GGTCACTGCCGGGAGGGAGGTGG + Intronic
949891206 3:8734665-8734687 GGTGTGGGCCTGGAGGCAGCAGG - Intronic
950239108 3:11351997-11352019 TGTCGTGGCGTGGAGGGAGGGGG - Intronic
950455145 3:13088440-13088462 GGTGGGGGCCTGGAGAGAGCAGG - Intergenic
950584092 3:13880444-13880466 TGTTCCGGGCTGGAGGGAGCAGG - Intergenic
954360939 3:50122543-50122565 GGTCCAGCCCTGGAGTGAGCTGG + Intergenic
954648024 3:52143339-52143361 GCTGGGGACCTGGAGGGAGCAGG - Intronic
954672437 3:52298216-52298238 GGATGCTGTCTGGAGGGAGCTGG + Intergenic
954795854 3:53161129-53161151 GGGCGAGGCCTGGCGGGGGCGGG + Exonic
954795863 3:53161145-53161167 GGGCGGGGCCTGGCGGGGGCGGG + Exonic
955182278 3:56683265-56683287 CGTCGGGGCCGGGAGGGGGCGGG + Intergenic
956798760 3:72738675-72738697 GGTCGCGGTCTGGAAGCTGCTGG - Intergenic
961326924 3:126114530-126114552 GGGCCGGGCCTGGAGGGGGCAGG - Intronic
961827610 3:129606945-129606967 GGGCGGGTCCTGGAGGGCGCGGG - Intergenic
962255211 3:133865749-133865771 GGTCACTCCCTGGAGGGAGCAGG + Intronic
962318812 3:134374693-134374715 CACCGCGGCCTGGAGGGCGCTGG - Intronic
964878807 3:161400670-161400692 GGTCGGGGGCTGGAGGGGGTTGG - Intergenic
966049897 3:175603476-175603498 TGTCAGGGCCTGGAGGGAGAAGG - Intronic
967390094 3:188947116-188947138 GGGTGGGGACTGGAGGGAGCAGG + Intergenic
968084541 3:195868444-195868466 GGTCTCGTCCAGCAGGGAGCAGG + Exonic
968702111 4:2062132-2062154 GGCCACGGCCCAGAGGGAGCAGG - Intronic
968908557 4:3465394-3465416 GGGCCCGGCGTGGAGGGAGCAGG + Intronic
969643644 4:8413486-8413508 GGTTGCGGGGTGGAGGGAGATGG - Intronic
969746963 4:9080149-9080171 GCTCTGGGGCTGGAGGGAGCAGG - Intergenic
971510140 4:27414593-27414615 TGTCGTGGGGTGGAGGGAGCGGG - Intergenic
972437044 4:39044762-39044784 GGGCGGGGCCTGGCGGGAGGGGG + Intergenic
975909044 4:79246984-79247006 GGTCAAGGGCTGGAGGAAGCTGG + Intronic
978600136 4:110418909-110418931 GGGCAGGGCCTGGAGGGGGCGGG + Intronic
979349261 4:119627285-119627307 GGCCGGGGCCGTGAGGGAGCTGG - Intronic
981033971 4:140152085-140152107 GGGAGCGGCCTGGAGGGGGCGGG - Intronic
985451718 4:190066666-190066688 GGGGGCGGGCGGGAGGGAGCCGG + Intergenic
985452706 4:190069958-190069980 GGGGGCGGGCGGGAGGGAGCCGG + Intergenic
985453693 4:190073255-190073277 GGGGGCGGGCGGGAGGGAGCCGG + Intergenic
985454682 4:190076548-190076570 GGGGGCGGGCGGGAGGGAGCCGG + Intergenic
985455671 4:190079841-190079863 GGGGGCGGGCGGGAGGGAGCCGG + Intergenic
985456654 4:190083135-190083157 GGGGGCGGGCGGGAGGGAGCCGG + Intergenic
985457642 4:190086435-190086457 GGGGGCGGGCGGGAGGGAGCCGG + Intergenic
985458629 4:190089728-190089750 GGGGGCGGGCGGGAGGGAGCCGG + Intergenic
985459618 4:190093028-190093050 GGGGGCGGGCGGGAGGGAGCCGG + Intergenic
985611943 5:894083-894105 GGTCGCTGCTTGTAGGGTGCTGG + Intronic
985744043 5:1636612-1636634 GGGGGCTTCCTGGAGGGAGCCGG - Intergenic
987086464 5:14474202-14474224 TGTAGCCTCCTGGAGGGAGCTGG + Intronic
989353090 5:40510100-40510122 TGTCGTGGGGTGGAGGGAGCGGG + Intergenic
993385035 5:87252533-87252555 GGTAGCGGGCTGCAGGGAGCGGG + Intergenic
995529726 5:113080648-113080670 TGTCGTGGGGTGGAGGGAGCGGG + Intronic
995787111 5:115841922-115841944 GGTCGCGTGCGGGAGGGGGCGGG + Exonic
996065148 5:119071366-119071388 GGGCGAGGCCCGGAGGGGGCGGG - Intronic
997399808 5:133593510-133593532 GGTTGGGGGCTGGAGGAAGCCGG - Intronic
997516166 5:134491401-134491423 GGTGGCGCCCTGATGGGAGCTGG - Intergenic
999318604 5:150599976-150599998 GGACCCTGCCTGGAGGGAGCTGG + Intergenic
999374986 5:151080787-151080809 GGTGGCGGCGGGGAGCGAGCTGG - Intronic
1000425544 5:161086625-161086647 TGTCGTGGCCAGGATGGAGCAGG - Intergenic
1002060388 5:176622127-176622149 TGACGCTGCCTGGATGGAGCTGG - Intronic
1002098698 5:176846807-176846829 CGCCGAGGCCCGGAGGGAGCTGG + Intronic
1002133602 5:177095594-177095616 GGTCGGGGCCTGGGGGGCGCCGG - Exonic
1002566878 5:180117106-180117128 GGTGGCGGCCTGCCAGGAGCCGG - Intronic
1002643493 5:180641517-180641539 GGCTGCAGACTGGAGGGAGCTGG + Intronic
1002770501 6:286787-286809 GGTAGGGGGCTGCAGGGAGCAGG - Intergenic
1003313077 6:4986238-4986260 TGTGGGGTCCTGGAGGGAGCTGG + Intergenic
1004044598 6:12012149-12012171 GATCGCGGCCGCCAGGGAGCCGG - Intronic
1004458852 6:15817045-15817067 GTTTGAGGCCAGGAGGGAGCTGG + Intergenic
1006092005 6:31633694-31633716 GGTCAAGTGCTGGAGGGAGCGGG + Intronic
1006882785 6:37354305-37354327 GGGCAGGGGCTGGAGGGAGCGGG + Intronic
1007406066 6:41637144-41637166 GGTTGCGGCCCGGAGGAAGGTGG - Intronic
1011131135 6:84052721-84052743 GGTGGCTGCCTGGGGAGAGCTGG + Intronic
1012410260 6:98948045-98948067 GGGCGGGGCCTGGAGGGAGGCGG + Intergenic
1012965157 6:105666202-105666224 GGTCGGGGCCTGCAGTGCGCAGG + Intergenic
1013600645 6:111701343-111701365 GGGGGCTGCCAGGAGGGAGCGGG - Intronic
1013793619 6:113860201-113860223 GGGCGCGGCCTCCGGGGAGCAGG + Exonic
1014130813 6:117829960-117829982 GGTCGCGGCCAGGGGGGCGGTGG + Intergenic
1015402103 6:132798577-132798599 GATCGCTGCCTGCAGGGAGTCGG - Intergenic
1018040372 6:159916326-159916348 GGCCGGGGGCTGGAGGGAGGAGG + Exonic
1018811868 6:167304238-167304260 GGGCTGGGGCTGGAGGGAGCGGG + Intronic
1019114858 6:169751779-169751801 GGTCCCGCGCTGGAGGGCGCTGG + Intronic
1019575998 7:1737939-1737961 AGGCAGGGCCTGGAGGGAGCTGG - Intronic
1020035003 7:4959285-4959307 GGTCGCGGGAGGGAGGGGGCCGG - Intergenic
1022655880 7:32319082-32319104 GGTGACGGCGTGGAGGGCGCGGG - Intergenic
1023635734 7:42208241-42208263 GGTCTCAGGCTGGAGTGAGCAGG + Intronic
1029421612 7:100474741-100474763 GGTCCCGGCCCAGTGGGAGCTGG - Intronic
1033268902 7:139913111-139913133 GGATGTGGCCTGGAGGGAGGCGG + Intronic
1033421719 7:141209917-141209939 GGCTGGGGCCTGAAGGGAGCTGG + Intronic
1034590457 7:152133899-152133921 GGTCGTGACATGGAGGGAGCTGG - Intergenic
1035020407 7:155797241-155797263 GGTCGGGGGCTGGGGGGAGCCGG - Intergenic
1035020446 7:155797318-155797340 GGCCCGGGGCTGGAGGGAGCTGG - Intergenic
1036707320 8:11055422-11055444 GGTCGGGGCCTTGAGGGCTCAGG + Intronic
1039785636 8:40832142-40832164 GGTCGCGAGCTGGAGGTGGCAGG - Intronic
1040741722 8:50583918-50583940 TGTCGTGGGGTGGAGGGAGCGGG - Intronic
1041689889 8:60678665-60678687 CGGCGCGGCCCGGAGGGAGCTGG + Intergenic
1042903048 8:73747034-73747056 GGTCGCGGGCCGGCGGGAGGCGG - Intronic
1047251232 8:123183146-123183168 GGTGCCGGACTGTAGGGAGCTGG - Exonic
1048931256 8:139317082-139317104 GGTGGCAACCAGGAGGGAGCGGG - Intergenic
1049204956 8:141359350-141359372 GGCCGCCGACTGGAGGGACCTGG - Intronic
1049708144 8:144052122-144052144 GGGCACGGCCGGGTGGGAGCCGG - Intronic
1049789258 8:144465562-144465584 GGTCGAGACCTGGGGGGGGCCGG + Intronic
1053142607 9:35690742-35690764 GGACGCGTCCGGGTGGGAGCGGG - Exonic
1055069214 9:72149394-72149416 GGGCGCGGCCTGCAGGGTACCGG + Exonic
1057214797 9:93221825-93221847 GGTTGCGTCCTGGTTGGAGCTGG + Intronic
1057594987 9:96408057-96408079 TGTCGCGGGGTGGCGGGAGCGGG + Intronic
1057804168 9:98208861-98208883 GGTAGCAGCCTGGAGTGTGCAGG + Exonic
1060822893 9:126671781-126671803 TGCCCTGGCCTGGAGGGAGCTGG - Intronic
1061365845 9:130172238-130172260 GGCCGCGGCCAGGCGGGTGCGGG + Intergenic
1061536641 9:131254414-131254436 CGTCTGGGCCTGAAGGGAGCTGG + Intergenic
1061569831 9:131470369-131470391 TGAAGAGGCCTGGAGGGAGCAGG + Intronic
1062031124 9:134362474-134362496 GCTCACGGTCTGGCGGGAGCTGG - Intronic
1062052780 9:134456148-134456170 GACCGCGGCCGGGAAGGAGCAGG - Intergenic
1062144187 9:134979727-134979749 GATCGGGGCCTGGAGGAGGCCGG - Intergenic
1062161879 9:135085105-135085127 GGTCAAGGCCTGTAGGGGGCTGG + Intronic
1062315118 9:135963292-135963314 GGAGGTGGCCTGGAGGCAGCTGG + Intergenic
1062439805 9:136564600-136564622 GGTCCCGGCCTGCAGGCAGCTGG - Intergenic
1062497598 9:136838993-136839015 GGACGGGGCCTGCAGGCAGCGGG - Exonic
1062499808 9:136847519-136847541 GGTGGGGGCCTGGGCGGAGCTGG - Exonic
1185791624 X:2931809-2931831 GGCCGAGGCCTGGAAGGAGGGGG + Intergenic
1186529611 X:10282105-10282127 TGGGGCAGCCTGGAGGGAGCTGG - Intergenic
1186669855 X:11757919-11757941 GGGCGCAGCCTGGAGGCCGCGGG + Intergenic
1187450062 X:19388082-19388104 GGTCGCTGCCTGCAGGGAGACGG + Intronic
1187506973 X:19886706-19886728 GGTCGGGGCCGGGAGGAAGGGGG + Intronic
1188418958 X:29972977-29972999 AGTAGCCTCCTGGAGGGAGCAGG - Intergenic
1189357892 X:40325330-40325352 GGCCGTGGCCTGGAGTGAGGTGG - Intergenic
1190945479 X:55089232-55089254 CGTCGCGACCTGGGAGGAGCTGG - Intronic
1190962307 X:55264654-55264676 CGTCGCGACCTGGGAGGAGCCGG + Exonic
1192422441 X:71045663-71045685 GGTGGGGGCCTGGCGGAAGCAGG - Intergenic
1195146744 X:102026212-102026234 GGTTGTGTCCTGGTGGGAGCTGG - Intergenic
1195269412 X:103215394-103215416 GTGCCCGGCCCGGAGGGAGCCGG + Intronic
1195763571 X:108273080-108273102 TGTCGTGGGGTGGAGGGAGCGGG - Intronic
1198744154 X:139872508-139872530 TGTCGTGGGGTGGAGGGAGCGGG - Intronic
1200001912 X:153066525-153066547 GGCCGCGGCCGGTGGGGAGCTGG + Intergenic
1200005820 X:153083500-153083522 GGCCGCGGCCGGTGGGGAGCTGG - Intergenic