ID: 1167271049

View in Genome Browser
Species Human (GRCh38)
Location 19:48506505-48506527
Sequence GCCTCCCGCCAGGCCCCAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 306
Summary {0: 1, 1: 0, 2: 0, 3: 35, 4: 270}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167271049_1167271052 -1 Left 1167271049 19:48506505-48506527 CCTACTGGGGCCTGGCGGGAGGC 0: 1
1: 0
2: 0
3: 35
4: 270
Right 1167271052 19:48506527-48506549 CAGAGCCACTTGTGTGCTGTGGG 0: 1
1: 0
2: 2
3: 14
4: 169
1167271049_1167271053 0 Left 1167271049 19:48506505-48506527 CCTACTGGGGCCTGGCGGGAGGC 0: 1
1: 0
2: 0
3: 35
4: 270
Right 1167271053 19:48506528-48506550 AGAGCCACTTGTGTGCTGTGGGG 0: 1
1: 0
2: 2
3: 15
4: 202
1167271049_1167271051 -2 Left 1167271049 19:48506505-48506527 CCTACTGGGGCCTGGCGGGAGGC 0: 1
1: 0
2: 0
3: 35
4: 270
Right 1167271051 19:48506526-48506548 GCAGAGCCACTTGTGTGCTGTGG 0: 1
1: 0
2: 2
3: 19
4: 183

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167271049 Original CRISPR GCCTCCCGCCAGGCCCCAGT AGG (reversed) Intronic
900229705 1:1550548-1550570 GCCTCTCGCCAGACCCCACGGGG + Intronic
901002175 1:6154352-6154374 CCCTCCCTCCAGGCCCACGTCGG + Intronic
903548626 1:24142571-24142593 GCCTCCCTCCATGCCCCTGCAGG - Intronic
904222459 1:28983727-28983749 GCATCCCTCCAAGCCCCAGAGGG + Intronic
905405883 1:37732124-37732146 GACTCCCCCAAGGCCCCAGCTGG + Intronic
905414132 1:37793523-37793545 TCCGCCCGCCAGGCCCCGGACGG + Intergenic
905990647 1:42334870-42334892 GGCGTCCGCCAGGCCCCAGCCGG + Intronic
906294117 1:44638578-44638600 GCTTCCCACCAGGCCCCTGGAGG + Intronic
907283148 1:53363634-53363656 GCTTCCTGCCAGGGCCCTGTGGG + Intergenic
907326103 1:53639432-53639454 GCCTCCTGCCAGCCCCGAGAGGG - Intronic
908453838 1:64282448-64282470 GCCTCCCGCCTGGCTTGAGTAGG + Intergenic
909305480 1:74070468-74070490 GCCTCCCTCCACTCTCCAGTAGG - Intronic
910935936 1:92484709-92484731 GCCTGCCGCTAGGCTCCAGCCGG + Intronic
912787455 1:112618872-112618894 GCCCCCCGCCCTGCCCCAGGAGG + Intronic
914677007 1:149913425-149913447 GCCTCCCCCCGGCCCCCAGGGGG + Exonic
920032372 1:203045198-203045220 GCCTCCCTCTGGGCCCCAGGAGG - Intronic
920101972 1:203522396-203522418 GCCTCCTGCCGGGCTCCAGGAGG - Intergenic
920857512 1:209675250-209675272 ACCTCCTGCCAGGTCCCAGCCGG + Intergenic
924917650 1:248590263-248590285 GCCTCCGCCCAGGCCCCGGAAGG + Intergenic
1062914513 10:1236428-1236450 GCCTCCAGCCATGACCCAGGTGG + Intronic
1063419513 10:5900434-5900456 CCCTCCCGCCAGGCCCTCGCCGG + Intronic
1064033556 10:11898517-11898539 AACTCCAGCCAGGTCCCAGTGGG - Intergenic
1065661229 10:28005870-28005892 ACCTGCTACCAGGCCCCAGTTGG - Intergenic
1070528668 10:77317133-77317155 GCCAACTGCCAGGCCCCAGCAGG + Intronic
1070645711 10:78200839-78200861 GCCACCTGCCTGGCCCCAGCAGG + Intergenic
1070828728 10:79405900-79405922 GCCTCTTGCCAGGCAGCAGTGGG - Intronic
1070915802 10:80153876-80153898 GGCTCCTGCCAGGACCCAGCAGG + Exonic
1071527784 10:86367804-86367826 GACTCCCGCCACGCACCAGGGGG + Intergenic
1072890116 10:99316220-99316242 GGCTCCCGCCAGGCCTCGGGTGG + Intergenic
1074904342 10:117847910-117847932 GCCCCCCGACAGGCCCTGGTGGG - Intergenic
1076001784 10:126918351-126918373 GGCTACCGCCACGCACCAGTAGG - Intronic
1076294522 10:129374276-129374298 CGCTCCTGCCAGGCCCCCGTCGG + Intergenic
1076550466 10:131274697-131274719 GCTTCCTCCCAGGCCCCAGGAGG + Intronic
1076916121 10:133423828-133423850 GCGCCCCCCCAGGCCTCAGTGGG - Intronic
1076936225 10:133568614-133568636 GCGCCCCCCCAGGCCTCAGTGGG - Intronic
1077146573 11:1049191-1049213 GCCTCCCGCAGGCCTCCAGTTGG + Intergenic
1077328751 11:1974805-1974827 GCCTCCCCACAGGCCCCCGCTGG - Intronic
1077623023 11:3744508-3744530 GGAGCCCCCCAGGCCCCAGTAGG - Exonic
1081993009 11:47347665-47347687 ACCTCCAGCCAGGCTCCTGTGGG + Exonic
1084146196 11:67266569-67266591 GCCTCCCGCCTGGCCCTGCTCGG - Exonic
1084413935 11:69019625-69019647 GCTTCCCGCCAGGCCCCTGAGGG - Intergenic
1084704020 11:70805342-70805364 GCCACCCCCTAGGCCCAAGTGGG - Intronic
1086741888 11:90379384-90379406 GTATCCCTTCAGGCCCCAGTTGG + Intergenic
1089363516 11:117907004-117907026 GTCTCCCTCCAGGCTCCAATAGG - Intronic
1089768357 11:120784896-120784918 ACCTCACGCCAGGCACCAGTGGG - Intronic
1202811730 11_KI270721v1_random:29984-30006 GCCTCCCCACAGGCCCCCGCTGG - Intergenic
1092314431 12:7395427-7395449 ACCAACCGACAGGCCCCAGTGGG - Intronic
1094814109 12:34166851-34166873 GCCACCCGGCAGGCCCGAGCTGG + Intergenic
1095102788 12:38201648-38201670 GCCACCCGGCAGGCCCGAGCTGG - Intergenic
1096011907 12:48224905-48224927 CCCTCCCCCCAGTCCCCAATGGG - Intergenic
1096469184 12:51865534-51865556 GCCTCCCCCCATGCCCCACAGGG - Intergenic
1096691812 12:53325937-53325959 GACTCCTGCGCGGCCCCAGTCGG - Intergenic
1098282060 12:68871714-68871736 GGCTCCCGACAGGCACCTGTTGG - Intronic
1098667605 12:73183288-73183310 CCCTCACAACAGGCCCCAGTGGG + Intergenic
1101526736 12:105538079-105538101 GCCTCCCACCAGTCCCAAGAGGG + Intergenic
1101878843 12:108613009-108613031 GCCTCCCACCAGGCAGCAGAAGG - Intergenic
1102454845 12:113065076-113065098 CCAGCCTGCCAGGCCCCAGTGGG - Intronic
1103952306 12:124557897-124557919 GACTCCTGCCAGGCTCCAGAGGG + Intronic
1105443794 13:20435849-20435871 GCCTCCCGCGAGGGCGCTGTCGG - Intronic
1105485512 13:20827104-20827126 GTCTCCCGCCAGGACTCTGTTGG + Exonic
1105847728 13:24307984-24308006 TCCTCCCGCCAGGACCCTGCCGG - Intronic
1106134120 13:26961582-26961604 GCCTCTCTGCAGGCCCCAGTGGG - Intergenic
1106347951 13:28897883-28897905 ACCTCACAACAGGCCCCAGTGGG - Intronic
1106474691 13:30088670-30088692 ACCTCCCACCAGGCCCCACTGGG + Intergenic
1108020995 13:46127566-46127588 GCCTCCCACCCAGCCCCATTGGG + Exonic
1108508860 13:51136761-51136783 GCCTCGCGCCAGGCTCCTGGGGG - Intergenic
1108559457 13:51628199-51628221 GCCGCCCCTCAGGCCCCACTGGG + Intronic
1108882413 13:55136958-55136980 TCCTCCCACCAGGCCCCAGGGGG - Intergenic
1111404869 13:87790738-87790760 ACCACCTGACAGGCCCCAGTGGG + Intergenic
1113325072 13:109273119-109273141 GCCTCCCTCCAGCACCAAGTAGG + Intergenic
1113437980 13:110307679-110307701 GCCTCCCGTTAGGCCCCTGTGGG - Intronic
1113608389 13:111626437-111626459 CCCTCCTGCCAGGGCCCAGGTGG - Intronic
1113693445 13:112328091-112328113 GCCTGCCGGGAGGCCCCAGAAGG + Intergenic
1114483186 14:23047894-23047916 GCCGCCCGCCTGGACCCCGTGGG + Exonic
1114625204 14:24124386-24124408 CCCTGACGCCAGGCCCCAGTGGG + Exonic
1117376584 14:55123369-55123391 GCCTCCAGTGAGGCCCCATTTGG + Intergenic
1118638686 14:67772103-67772125 ACCCCCTGCCAGGCACCAGTGGG - Exonic
1122536300 14:102465958-102465980 GACTCCTGCCAGCCCCCATTTGG + Intronic
1122655723 14:103258284-103258306 GACTCCCTCCAGGACCCAGATGG + Intergenic
1122825952 14:104370547-104370569 TGCTCCCTCCAGGCCCCAGCTGG + Intergenic
1123035664 14:105470919-105470941 GCACCGCGCCAGGCCCCAGCAGG - Intergenic
1126695014 15:51318462-51318484 ACCTCCTGTCAGGCTCCAGTTGG + Intronic
1127297996 15:57626948-57626970 GCCTCAGGCCAAGCCCCACTGGG + Intronic
1127670135 15:61187296-61187318 GCGGCCCGCCAGGCCCAAGTGGG + Intronic
1128340632 15:66820493-66820515 GGCTCCACCCAGGGCCCAGTGGG - Intergenic
1129322727 15:74783617-74783639 GCCCCCAGCCCGGCCCCAGAGGG + Intronic
1130295739 15:82646483-82646505 GCCTCCCGCCAGGCCCGCCTGGG - Intronic
1132513431 16:354818-354840 GCCTGCGGCCAGGACCCAGCGGG - Intergenic
1132574247 16:657323-657345 GCCCCCCCACAGGACCCAGTCGG - Intronic
1132603563 16:784410-784432 GCCTCCAGTCGGGCCCCGGTGGG + Intergenic
1132785863 16:1656722-1656744 GCCTGCCGCCAGGCCCCCGAAGG + Exonic
1132789577 16:1678226-1678248 GCCGCCCGCCAGCGCCCATTGGG - Intronic
1132861362 16:2073349-2073371 GCCTCCCTCCACGCCCCATCAGG + Intronic
1133021814 16:2970148-2970170 CCCTCCCGCCAGCACCCAGCCGG + Intronic
1133209948 16:4258010-4258032 GGCTCCCTCCAGCCCCCAGAAGG + Exonic
1133976355 16:10602094-10602116 GTCCCCCGCCAGCCCCCAGAAGG - Intergenic
1134187910 16:12098917-12098939 GCCTCCTGTCTGGCCCAAGTGGG + Intronic
1134710276 16:16324129-16324151 GCCTCCTGCCAGGGTCCAGCTGG + Intergenic
1134718448 16:16368417-16368439 GCCTCCTGCCAGGGTCCAGCTGG + Intergenic
1134949327 16:18344516-18344538 GCCTCCTGCCAGGGTCCAGCTGG - Intergenic
1134956306 16:18383742-18383764 GCCTCCTGCCAGGGTCCAGCTGG - Intergenic
1136702684 16:32157992-32158014 GGCTCCCACCAGACCTCAGTTGG + Intergenic
1138483464 16:57319420-57319442 ACCCCCTGACAGGCCCCAGTGGG - Intergenic
1139515197 16:67448741-67448763 GCCTCTCCCCAAGGCCCAGTTGG + Intronic
1139965503 16:70742780-70742802 GCCTCCCGCCACAGCCCAGCCGG - Intronic
1140478791 16:75251636-75251658 GCCTGCCGCCACGGCCCAGCCGG + Intronic
1141064124 16:80900329-80900351 GCCTCCCGCCCGCCTGCAGTGGG - Intergenic
1141550505 16:84803686-84803708 ACCCTCCGACAGGCCCCAGTGGG - Intergenic
1141875443 16:86820888-86820910 GCCTCATTCCAGGCCACAGTAGG + Intergenic
1142129282 16:88425390-88425412 CCCTGCAGCCTGGCCCCAGTGGG + Intergenic
1142393332 16:89816566-89816588 GCCTCGGGCCAGGACCCAGGGGG - Exonic
1203067372 16_KI270728v1_random:1031729-1031751 GGCTCCCACCAGACCTCAGTTGG - Intergenic
1142595066 17:1025908-1025930 TCCTTCCCCCATGCCCCAGTTGG - Intronic
1142595384 17:1027256-1027278 GCCTCCCTGCAGGCCACAGACGG - Intronic
1142668282 17:1474893-1474915 GCCTCCCCGCAGGCCCCTGTGGG + Intronic
1142679784 17:1539990-1540012 GCCTCCCGCCCAGCCCCCGCTGG + Intronic
1143078869 17:4366717-4366739 GCCTCCCGCCCCGCCCCCGGCGG + Intergenic
1143125637 17:4639657-4639679 CCCTCCCGCCAGGCCCCACCGGG - Intronic
1143402840 17:6657166-6657188 CCCTCCCGCCAGGCCCCACCGGG + Intergenic
1144829875 17:18125282-18125304 GCGTCCCACCCGGCCCCAGGAGG - Intronic
1144847027 17:18225473-18225495 GCCGCCCGCCCCGCCCCTGTTGG - Intergenic
1145007177 17:19344458-19344480 GCCTCCCGCCTGGCCCAACTGGG - Intronic
1145193259 17:20866542-20866564 TCCTACCTCCAGGCCCCCGTGGG + Exonic
1145252512 17:21304297-21304319 GCCCCCTCCCATGCCCCAGTGGG - Intronic
1145298756 17:21614542-21614564 TCCTACCACCAGGCCCCCGTGGG - Intergenic
1145351524 17:22088748-22088770 TCCTACCACCAGGCCCCCGTGGG + Intergenic
1146571167 17:33954446-33954468 GCCTCCCGGGATGCCCCAGGTGG - Intronic
1148157570 17:45432507-45432529 GCTTCCCTCCAGCCCCCAGATGG + Intronic
1148206614 17:45783926-45783948 GCCTCCCGCCCGGCCGAGGTCGG - Intergenic
1148779670 17:50114233-50114255 GCCTCCTGCCAGGGCCCACTGGG + Exonic
1151030330 17:70730504-70730526 ACCCCCCGACAAGCCCCAGTAGG + Intergenic
1151314347 17:73312307-73312329 GCCTCGCGCCAGGCCCCCGGAGG - Intergenic
1151595833 17:75077598-75077620 GCCACCCGCCAGGCCGTAGAAGG - Intergenic
1151671452 17:75573702-75573724 GCCTCCAGCCAGGCAGCAGTGGG - Intronic
1152507745 17:80762359-80762381 CCCTCACCCCAGCCCCCAGTGGG - Intronic
1152855403 17:82662688-82662710 GAATCCCCCCAGGCCCCAGCAGG - Intronic
1154218399 18:12432109-12432131 GCCTCCCGCAAGCTGCCAGTCGG + Exonic
1154324463 18:13380017-13380039 CCCTCACGCCAGGCCACAGTGGG + Intronic
1157614425 18:48978272-48978294 TCCTCACGCCAGGCCCGAGGTGG - Intergenic
1157840179 18:50950292-50950314 TCCTCCCTCCAGGCCCCCGGGGG + Exonic
1160680090 19:408476-408498 GCCTCCCGGCAGGGCCCTGCCGG + Intronic
1162386348 19:10362446-10362468 ACCTCCTGCCAGGCACCAGACGG - Exonic
1162797809 19:13095625-13095647 CCCTCCGGCCCGGCCCCAGCAGG - Exonic
1162938877 19:13996277-13996299 GGCTCCTGCCTGGCCCCAGAAGG + Intronic
1163233485 19:16018658-16018680 TCCTCCCACCAGGGCACAGTGGG - Intergenic
1163481064 19:17556376-17556398 GCCTCTGGCAACGCCCCAGTGGG - Intronic
1163831827 19:19550671-19550693 GCCTCCCTCCTTGCCCCAGATGG + Intergenic
1164118073 19:22241140-22241162 GCCTCGGTCCAGCCCCCAGTAGG - Intergenic
1164201104 19:23019322-23019344 GCCTCGGTCCAGCCCCCAGTAGG - Intergenic
1164447114 19:28327361-28327383 GCCTCCCGCCCAGGCACAGTGGG - Intergenic
1164581173 19:29436134-29436156 GCACCCTGGCAGGCCCCAGTAGG + Intergenic
1165315631 19:35053784-35053806 GCCCCCCTCCCCGCCCCAGTTGG + Intronic
1165828693 19:38719913-38719935 GTCTCCGGCCAGGGCCCAGCTGG + Intronic
1166075187 19:40410163-40410185 GCCACCCGCCAGGCCCATCTGGG + Intronic
1166185590 19:41136880-41136902 GCCGCGCGCCAGGCACCTGTTGG - Intergenic
1167119557 19:47508366-47508388 GCCTCCCGCCACTCTGCAGTGGG + Intronic
1167248381 19:48387871-48387893 GATTCCTGCCAGGCCCCAGGAGG + Intronic
1167268179 19:48493610-48493632 GCCTCCCGCCAGGCCCTTCCCGG + Intronic
1167271049 19:48506505-48506527 GCCTCCCGCCAGGCCCCAGTAGG - Intronic
1167638024 19:50666638-50666660 GCCTGCGGCCTGGCCCCAGCGGG - Exonic
1168464214 19:56589175-56589197 GCCTCCCTCCTTGCCCCTGTGGG - Intergenic
925284068 2:2704609-2704631 CCCTCCCTCCAGGCCTCAGTGGG - Intergenic
926251214 2:11156471-11156493 GCCCCCCGCCATCACCCAGTGGG + Intronic
927940665 2:27101154-27101176 GCCCCCTGCCTGGTCCCAGTAGG - Exonic
927944027 2:27123900-27123922 GGCTCCTGGCTGGCCCCAGTTGG - Exonic
927997036 2:27494051-27494073 GTCTTCAGCCAGGCCCCAGAGGG + Exonic
928204073 2:29271693-29271715 GCAACCAGCCAGGGCCCAGTGGG + Intronic
934925679 2:98380389-98380411 GCTTCCTGCCTGGCCCCAGCAGG - Intronic
936079412 2:109422251-109422273 GACTCCAGCCAGGGCCCAGATGG + Intronic
936559311 2:113523037-113523059 GCCTGCCGCCACGCCCCAGCGGG + Intergenic
937238991 2:120448075-120448097 GCCTCCCCCCGGCCCCCACTTGG - Intergenic
937909555 2:127068820-127068842 TCCTCCTGCCTGGCCCCAGGTGG - Intronic
938075185 2:128328460-128328482 TCCTCCCCCCAGCCCCCATTTGG - Intergenic
941974360 2:171386832-171386854 CCCTCCCCCCAGACCCCAGCAGG + Intronic
948055779 2:235008351-235008373 GCCTCCCTGCAGGGCCCAGGAGG + Intronic
948206398 2:236164703-236164725 GCTTCCCGGCAGCCCTCAGTCGG - Intergenic
948944988 2:241214971-241214993 GCCTCCAGCCCGGCCCTAGCTGG + Intronic
949026310 2:241767994-241768016 GCCACCCGCCGACCCCCAGTGGG - Exonic
1171414389 20:24967801-24967823 GCCTCCCCCTAGGTCCCAGCAGG + Intronic
1172645463 20:36466411-36466433 GCCTGCTGCCAGGACCAAGTAGG - Intronic
1172751128 20:37252038-37252060 GGCTCTCATCAGGCCCCAGTAGG - Intronic
1172799783 20:37567750-37567772 GTCTCCCGCCAGCCGCCAGTGGG - Intergenic
1173579542 20:44137401-44137423 GCCTCCCGCCCCTCCCCAGGTGG + Intronic
1174500518 20:50980931-50980953 GCCTCCACCCAGACCCCAGAGGG - Intergenic
1175168835 20:57065609-57065631 GGCTCCCACCATGCCCCAGATGG + Intergenic
1175294314 20:57897830-57897852 GCCTCCCCACTGGCCCCAGGAGG + Intergenic
1177172352 21:17668394-17668416 GCCACGCGCCCGGCCCCACTTGG + Intergenic
1179902889 21:44402967-44402989 GCCTCCCCCAGGGCCCCAGTAGG - Intronic
1179908297 21:44435342-44435364 GCCTCCCGCATCCCCCCAGTAGG - Intronic
1179958491 21:44754552-44754574 GCCTCATGCCAGGACCCAGAAGG + Intergenic
1180879910 22:19196291-19196313 CCCTCCTTCCAGGCCTCAGTGGG + Exonic
1181035872 22:20169510-20169532 GCCCCCAGCCTGGCCCCTGTAGG - Intergenic
1181309002 22:21933628-21933650 GCCTGGCGCCACGCCCCACTGGG - Intronic
1181771858 22:25131456-25131478 GCCACCTGCCAGGCCCCAGAGGG - Intronic
1183445254 22:37849349-37849371 GTTTCCCGGCAGGCCCGAGTGGG + Exonic
1183508682 22:38222851-38222873 CCCCCCTGCCAGGCCCCAGGAGG - Intronic
1184151785 22:42643730-42643752 GCCTCCTTTAAGGCCCCAGTTGG + Intronic
1185117204 22:48944673-48944695 CCCTCCAGCCAGGGCCCAGCTGG - Intergenic
1185153403 22:49179347-49179369 TCCTCCCGCCAGGCCCTCGGCGG + Intergenic
950377407 3:12582987-12583009 GCCTCCAGCCAGGGCCCTCTAGG + Exonic
951709567 3:25574614-25574636 ACCTCCCGCCAGGCCCCACCTGG - Intronic
953795706 3:45984412-45984434 TCCGCCAGCCAGGACCCAGTTGG + Intronic
954628531 3:52035924-52035946 GACTCCAGCCAGTGCCCAGTGGG - Intergenic
954708262 3:52492520-52492542 GCCTGCTGCCCTGCCCCAGTAGG - Exonic
956255804 3:67282235-67282257 ACCCCACGACAGGCCCCAGTGGG - Intergenic
956488996 3:69751825-69751847 ACCTCCCACCAGGCCCCACCTGG - Intronic
961005954 3:123405523-123405545 GCCTCCTGCCAGGCCTGAGCAGG + Intronic
961006594 3:123409828-123409850 CCCACCCTCCAAGCCCCAGTTGG + Intronic
961471884 3:127120276-127120298 GCCTCCCACCAGGGCACACTGGG - Intergenic
961629968 3:128289404-128289426 GCCTCCTGCCAGGCCCTAAAAGG - Intronic
962351494 3:134659795-134659817 TCCTCCCGCCAGGCCCCTGGGGG - Intronic
962862550 3:139418454-139418476 GAATCCCCCCAGGCCCCAGATGG + Intergenic
962904407 3:139789030-139789052 GCCACCAGCCTGGCCCCAGGGGG + Intergenic
963316270 3:143762174-143762196 ACCCCACGACAGGCCCCAGTGGG - Intronic
964074412 3:152675922-152675944 GCTTCCAGCCAGCCCCCAGGTGG - Intergenic
965858553 3:173119138-173119160 CCCCCTCGACAGGCCCCAGTAGG - Intronic
968232179 3:197010664-197010686 GCCTGCCGCCTGGCCTCAGCCGG - Intronic
968509756 4:990385-990407 GGCTCCCGCCAGGCGCCTGCTGG - Intronic
969113883 4:4859750-4859772 GCCTCCCGCCCCTCCCCAGCAGG - Exonic
971078033 4:23173017-23173039 ACTTCCCACCAGGCCCCTGTGGG + Intergenic
981658717 4:147141505-147141527 ACCCCCCGACAGGCCCCCGTGGG - Intergenic
982911386 4:161147392-161147414 ACCTCCCACCAGGCCCCACTGGG - Intergenic
984544066 4:181077904-181077926 GGCTCACTCCAGGCCCCAGATGG - Intergenic
1202757123 4_GL000008v2_random:74819-74841 ACCCCCCAACAGGCCCCAGTGGG - Intergenic
985528678 5:421174-421196 GCCTCCTGCCCGGCACCAGCCGG - Intronic
985577009 5:678188-678210 GCCTCACGCCCAGCCCCAGGAGG - Intronic
985591929 5:770241-770263 GCCTCACGCCCAGCCCCAGGAGG - Intergenic
991330204 5:65485560-65485582 GCCTCCCCCCCGGCCTCCGTGGG - Intergenic
991595828 5:68304306-68304328 GCCTCCCACCATGCCCCAGAGGG - Intergenic
992572301 5:78071391-78071413 GCCCCCTGACAGGCCCCAGTGGG - Intronic
993351282 5:86853322-86853344 GCCTCCAGCCACGCCCCACCAGG - Intergenic
994073718 5:95628743-95628765 GCCTCCACGCAGTCCCCAGTGGG - Intergenic
994415494 5:99464676-99464698 GCCCCCAGAAAGGCCCCAGTGGG - Intergenic
995460293 5:112396082-112396104 ACCCCACGACAGGCCCCAGTGGG - Intronic
997424219 5:133792227-133792249 GCCCCACCCCAGGCCCCATTAGG + Intergenic
998004462 5:138647959-138647981 GACTCCCTGCAGGCCCCAGAGGG + Intronic
999228893 5:150049804-150049826 GCTCCCCACCAGACCCCAGTGGG - Intronic
999357756 5:150953215-150953237 GCCTCCAGCCAGGCACCATGGGG - Intergenic
1002316854 5:178349320-178349342 GCCTCCTGCCAGTCCTCAGTGGG - Intronic
1002427499 5:179184936-179184958 ACGTCCTTCCAGGCCCCAGTGGG - Intronic
1004866435 6:19857460-19857482 GCCTCCTTCCAGGCCCCTGTGGG - Intergenic
1006078312 6:31548418-31548440 GCTGCCCGCCAGGGCCCAGATGG + Exonic
1006434093 6:34017262-34017284 GCCGCCCCCCACGCCCCAGGTGG - Intergenic
1007368571 6:41411700-41411722 GCCGCCTGCCAGCCCCCAGCAGG - Intergenic
1007596391 6:43053631-43053653 GCCTCGCGCCAGGACCCCGGTGG - Intronic
1007741412 6:44012074-44012096 GCCTCCCCACTGGGCCCAGTTGG + Intergenic
1007787739 6:44290871-44290893 GCATCCCACCTGGCCCCAGGTGG - Intronic
1010057587 6:71584761-71584783 GCCACCACCCAGGCCCCAGAAGG - Intergenic
1010343292 6:74781989-74782011 GAGTCCCCCCAGGCCCCAGATGG - Intergenic
1013023996 6:106251257-106251279 TCTTCCCGCCAGGCCAGAGTTGG - Intronic
1015440422 6:133241224-133241246 GCCTCCCCCGAGGCCCCCGGCGG + Intronic
1017401566 6:154070213-154070235 GCCTCCCACCAGGCTCGTGTGGG + Intronic
1019564093 7:1671020-1671042 GCCTCCTCCCAGCCCCCAGAGGG - Intergenic
1020142431 7:5619926-5619948 TGCTCCTGCCAGGACCCAGTCGG + Intergenic
1020267970 7:6574002-6574024 GTCTCCCTCCAGGCCCAAGTAGG - Intergenic
1022484198 7:30765482-30765504 GGCCCCAGCCAGGCTCCAGTAGG - Intronic
1022559884 7:31336773-31336795 GCCGCCCGCCAGGCCCCGTCGGG + Intergenic
1022644821 7:32220283-32220305 TCCTCATGCCAGGCACCAGTAGG + Intronic
1024639083 7:51315940-51315962 GCCTCAGGCCTGGCCCCACTAGG + Intronic
1026106908 7:67428657-67428679 AACCCCCGACAGGCCCCAGTGGG - Intergenic
1027029045 7:74875022-74875044 GGCTCCCGGCAGGCCCGGGTGGG - Intergenic
1027194145 7:76017596-76017618 CCATCGCGCCTGGCCCCAGTAGG - Intronic
1031510199 7:122639656-122639678 CCCTCTAGCCAGTCCCCAGTTGG + Intronic
1031717102 7:125123111-125123133 AACCCCCGACAGGCCCCAGTGGG + Intergenic
1031717505 7:125126514-125126536 GCCTCCCACCAGGCCCCACAGGG + Intergenic
1032237840 7:130140566-130140588 GCCTGCCGCCGGGTCCCAGGAGG - Intergenic
1032502286 7:132409235-132409257 GCCTCCATCCAGGCCCTAGCTGG + Intronic
1035476856 7:159149875-159149897 TCCTCCCACCAGGCCCCACCCGG - Intergenic
1035976688 8:4320516-4320538 ACCCCCCAACAGGCCCCAGTGGG + Intronic
1036562145 8:9906575-9906597 TCCTCCCGCCAGGGCCGAGGAGG - Intergenic
1036695191 8:10969730-10969752 GCCTCCAGCTCAGCCCCAGTGGG - Intronic
1037374320 8:18211588-18211610 ACCACCTGCCTGGCCCCAGTCGG + Intronic
1037813094 8:22098166-22098188 TGCTCCTGCCAGGCCCCAGCTGG + Exonic
1037823443 8:22147001-22147023 CCCTCCCACCAGGCCCCACCCGG + Exonic
1039885103 8:41650058-41650080 GGCACCCGCCAGGCCCCGGGGGG - Intronic
1040042886 8:42934551-42934573 CCCCCGCACCAGGCCCCAGTGGG + Intronic
1041303988 8:56441214-56441236 GCCTCCCTCCATCCTCCAGTGGG - Exonic
1041739094 8:61139618-61139640 GCCTTCCACCTGGCCCCAGCAGG - Intronic
1043527420 8:81111965-81111987 GCCGCCAGCCCGCCCCCAGTCGG + Exonic
1044115379 8:88328107-88328129 GCCGCTCCCCAGGCCCCACTAGG - Intergenic
1044734827 8:95268800-95268822 GCCCCCCGGCATGCCCCAGAGGG - Intronic
1048533753 8:135273804-135273826 GTCTCCCGCCAGACCACACTGGG - Intergenic
1049268980 8:141684162-141684184 GCCTCCTGCCAGGCTGCAGAGGG - Intergenic
1049291734 8:141806916-141806938 GGCTCCTCCCAGGCCCCAGCTGG - Intergenic
1049583990 8:143424605-143424627 GAGTCCCGCCTGGCCACAGTGGG - Intronic
1049766014 8:144355576-144355598 GACTTCCTCCAGGCCCCGGTAGG + Exonic
1049795556 8:144495880-144495902 GCCTCAAGCCAGGCACCAGGTGG + Intronic
1049797451 8:144503203-144503225 GCAACCAGCCAGGCCCAAGTCGG - Intronic
1049893544 9:93160-93182 GCCTGCCGCCACGCCCCAGCGGG - Intergenic
1053168468 9:35861322-35861344 TCCTCCCGCCCATCCCCAGTGGG + Intergenic
1053785559 9:41650298-41650320 GCCTCCTTCCAGGCGCCACTCGG - Intergenic
1054174278 9:61864264-61864286 GCCTCCTTCCAGGCGCCACTCGG - Intergenic
1054449136 9:65393309-65393331 GCCTCCTTCCAGGCGCCACTCGG - Intergenic
1054663260 9:67716527-67716549 GCCTCCTTCCAGGCGCCACTCGG + Intergenic
1054693619 9:68338169-68338191 GCCTGCCGCCAAACCCCAGCGGG + Intronic
1056303143 9:85262466-85262488 GCTTCCTGCCAAGCCCCAGAAGG + Intergenic
1057187121 9:93063140-93063162 TCAACCCTCCAGGCCCCAGTGGG - Intronic
1057196733 9:93119739-93119761 GCATCCTTCCAGGCCCCCGTCGG - Intergenic
1057267746 9:93630306-93630328 GCCTCTCGCTAGGCCTCAGAAGG - Intronic
1057615428 9:96585368-96585390 ACCCCCAGACAGGCCCCAGTGGG + Intronic
1059805054 9:117789888-117789910 ACCTCCCACCAGGCCCCATTTGG + Intergenic
1061806875 9:133141700-133141722 TCCTGCCCCAAGGCCCCAGTAGG + Intronic
1062517158 9:136942496-136942518 GCCGGGCGCCAGGCCCCAGGAGG + Intronic
1062623185 9:137431674-137431696 GCCTCCCGCCTGTCCCCAGCTGG - Intronic
1193096547 X:77555688-77555710 ACCCCCTGACAGGCCCCAGTGGG - Intronic
1193589253 X:83367166-83367188 ACCTCCTGACAGGTCCCAGTGGG - Intergenic