ID: 1167271349

View in Genome Browser
Species Human (GRCh38)
Location 19:48508309-48508331
Sequence GAACACACCCTTTCCAAAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 209
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 188}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167271345_1167271349 9 Left 1167271345 19:48508277-48508299 CCTTTACAACTGTTCTGATAAGG 0: 1
1: 0
2: 2
3: 5
4: 122
Right 1167271349 19:48508309-48508331 GAACACACCCTTTCCAAAACAGG 0: 1
1: 0
2: 2
3: 18
4: 188
1167271343_1167271349 13 Left 1167271343 19:48508273-48508295 CCCACCTTTACAACTGTTCTGAT 0: 1
1: 0
2: 0
3: 7
4: 137
Right 1167271349 19:48508309-48508331 GAACACACCCTTTCCAAAACAGG 0: 1
1: 0
2: 2
3: 18
4: 188
1167271344_1167271349 12 Left 1167271344 19:48508274-48508296 CCACCTTTACAACTGTTCTGATA No data
Right 1167271349 19:48508309-48508331 GAACACACCCTTTCCAAAACAGG 0: 1
1: 0
2: 2
3: 18
4: 188

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167271349 Original CRISPR GAACACACCCTTTCCAAAAC AGG Intronic
907158783 1:52356699-52356721 GAAGGCAGCCTTTCCAGAACAGG + Intronic
907794076 1:57696714-57696736 GATCTTACCCTTTCTAAAACAGG + Intronic
908000916 1:59678019-59678041 GAAAACACCCTTTCTAAAGAGGG - Intronic
909557918 1:76975386-76975408 GAACACCACCTTTCCATATCTGG + Intronic
910799067 1:91127824-91127846 ACACACACACCTTCCAAAACAGG - Intergenic
915241443 1:154525142-154525164 GAACTCACCATTTCCAGCACAGG - Intronic
920415054 1:205793550-205793572 GAACACAACCTTTCTAAAGCTGG + Intronic
922151886 1:223013440-223013462 GCCCACATCCTTTCCAACACTGG - Intergenic
1063550576 10:7029064-7029086 GAACAGAGACTTTCCACAACTGG - Intergenic
1063778323 10:9290723-9290745 CAACACTCTCTTTCCAAAACCGG + Intergenic
1066388150 10:34957936-34957958 CAACACCCCATTTCCAAAAGAGG + Intergenic
1068235884 10:54231848-54231870 GAATACACCCATTCCAAAAAAGG - Intronic
1070325627 10:75387066-75387088 GAACACTCACTTTCCATAGCTGG + Intergenic
1071384150 10:85102745-85102767 GAAAACACCCTATCCAGGACTGG + Intergenic
1071469410 10:85971541-85971563 GAACAAGCCTTTTACAAAACAGG + Intronic
1072532629 10:96333624-96333646 TGACACAGCCTTTCGAAAACAGG + Intronic
1074459187 10:113621482-113621504 CAACCCACCCATTCCAAAAATGG + Intronic
1075033124 10:119040475-119040497 TAACACAGCCTATCCAAAACTGG - Intronic
1076177294 10:128377819-128377841 GGACACATCCTTTCCATGACAGG + Intergenic
1077523528 11:3050366-3050388 GCACACTCCCTAGCCAAAACTGG + Intronic
1083015814 11:59452917-59452939 GAACAGACACTTTTCAAAAGAGG - Intergenic
1084307865 11:68298555-68298577 GAACAGACCCTCGCCAAAGCTGG - Intergenic
1084443872 11:69192182-69192204 GCACAAATCCTTTGCAAAACAGG + Intergenic
1085066356 11:73498987-73499009 GAACACACCCTCTCCACCAAGGG + Intronic
1085715426 11:78868726-78868748 GCACACTTCCCTTCCAAAACTGG + Intronic
1086932428 11:92707128-92707150 AAACACAACCTTTCACAAACAGG - Intronic
1088609287 11:111561846-111561868 CAAAACACACTTCCCAAAACAGG - Intergenic
1089805963 11:121089829-121089851 GAACATACCTTTTCTAAAATAGG + Exonic
1092586559 12:9906776-9906798 GAAGACACACCTTTCAAAACTGG - Intronic
1093488073 12:19674352-19674374 GAACAGACACTTTGCAAAAGAGG - Intronic
1094218890 12:27972784-27972806 GAAAATATCCTTTCCAAAACAGG - Intergenic
1095320335 12:40819204-40819226 AAACACACCCTTTCCACCAAGGG - Intronic
1098152507 12:67561548-67561570 GAAGACAGCCTTTTGAAAACCGG - Intergenic
1100887355 12:99086119-99086141 GAACAGTCCCTTTCCATCACGGG - Intronic
1105818751 13:24061068-24061090 GAACAGACACTTTTCAAAAGAGG + Intronic
1106153576 13:27130389-27130411 GAATACAGACTTTGCAAAACTGG + Intronic
1109764099 13:66870583-66870605 GAACAGACACTTTTCAAAAGAGG + Intronic
1111056606 13:82958494-82958516 GAACAGACACTTTTCAAAAAAGG + Intergenic
1111752976 13:92358127-92358149 AAATACTCCCTTTCCAAAAGGGG + Intronic
1114263409 14:21055994-21056016 GAACTCACCTTTTCCACAGCAGG - Intronic
1114749408 14:25186114-25186136 CACCACACCTATTCCAAAACTGG + Intergenic
1118847251 14:69556899-69556921 GGACACAACCTTTCCCAAAGTGG - Intergenic
1119370774 14:74140351-74140373 AAACAGACTCTTTCCAAGACAGG - Intronic
1120277000 14:82388679-82388701 CAAACCACCGTTTCCAAAACTGG - Intergenic
1123852175 15:24370185-24370207 GAACAGAACATTTTCAAAACAGG - Intergenic
1123862271 15:24480755-24480777 GAACAGACAATTTTCAAAACAGG - Intergenic
1125746529 15:42000958-42000980 GAACACGCCCTTTACAGAGCAGG + Intronic
1131925013 15:97373282-97373304 GAACAGACACTTCCCAAAAGAGG - Intergenic
1131926924 15:97395003-97395025 GAACAGACACTTCCCAAAAGAGG - Intergenic
1132795624 16:1720431-1720453 GAACACACACCTGCCAAAAATGG + Intronic
1132823365 16:1889072-1889094 TAACACAGACTTTACAAAACAGG - Intergenic
1133657643 16:7881548-7881570 GACCTCACCTTCTCCAAAACTGG + Intergenic
1136094200 16:27942827-27942849 GTACACACACTTTGCAAAATGGG + Intronic
1149038476 17:52159356-52159378 GAACACCGCCTTTCCAAGTCCGG + Intronic
1149959316 17:61090165-61090187 GAACACACCCCTTCCACAAAAGG - Intronic
1150488013 17:65557440-65557462 GAAGTGACCCCTTCCAAAACCGG + Intronic
1151171539 17:72250483-72250505 GAACACTTCCTTTCCAAGAGGGG - Intergenic
1153360195 18:4186077-4186099 GAACAGACACTTTTCAAAAGAGG - Intronic
1153694790 18:7629385-7629407 GAACACATCCTTTCAACAAGTGG - Intronic
1154633814 18:16826451-16826473 GAACATTCCCTTTCCAGAGCAGG + Intergenic
1154718757 18:17990271-17990293 GAACATTCCCTTTCCAGAGCAGG + Intergenic
1154784255 18:18888734-18888756 GAACATTCCCTTTCCAGAGCAGG + Intergenic
1154804351 18:19164981-19165003 GAACATTCCCTTTCCAGAGCAGG + Intergenic
1154807655 18:19210221-19210243 GAACATTCCCTTTCCAGAGCAGG + Intergenic
1154841377 18:19675324-19675346 GAACATTCCCTTTCCAGAGCAGG + Intergenic
1154856063 18:19877970-19877992 GAACATTCCCTTTCCAGAGCAGG + Intergenic
1156381346 18:36564195-36564217 GCACACAGCCTCTCCAAAACAGG - Intronic
1157311840 18:46558956-46558978 GAAGACACACTGTCCTAAACTGG + Intronic
1157717891 18:49901687-49901709 GCAAACACTCTTTCCAAAAGAGG + Intronic
1158313899 18:56189457-56189479 GAACACACCCGTTCAAAACATGG + Intergenic
1163103774 19:15111778-15111800 CAACTCACCCTTTCCACATCTGG - Exonic
1167271349 19:48508309-48508331 GAACACACCCTTTCCAAAACAGG + Intronic
1167389638 19:49186071-49186093 GAATACAGACTTTCCAAAAAAGG - Intronic
1168569637 19:57455439-57455461 GAAAACACTCTTTCCTAATCTGG - Exonic
927241452 2:20923096-20923118 GAAGACAACCTTTCCTAACCTGG + Intergenic
929370960 2:41223245-41223267 AAACACACCCTTTCCACCAAGGG + Intergenic
930242675 2:48952755-48952777 TCACACATTCTTTCCAAAACAGG + Intergenic
930965493 2:57318955-57318977 GAACAGACACTTTTCAAAAATGG + Intergenic
931596041 2:63944756-63944778 GAACAGACACTTTTCAAAAAAGG + Intronic
931873451 2:66485894-66485916 GAACAGACACTTTTCAAAAGAGG - Intronic
933687307 2:85152970-85152992 GAGCATGCCCTTTCAAAAACAGG - Intronic
939374709 2:141349420-141349442 AAACAATCTCTTTCCAAAACTGG - Intronic
940831628 2:158473003-158473025 GAACAGACACTTTTCAAAAAAGG + Intronic
941270270 2:163417744-163417766 CAACAGACACTTTCCAAAACAGG + Intergenic
943262425 2:185683169-185683191 GAACAGACACTTTTCAAAAGAGG - Intergenic
943480714 2:188413483-188413505 GAACAGACACTTTTCAAAAAAGG - Intronic
944166573 2:196728255-196728277 AATCACAGCCTTTCTAAAACTGG - Intronic
944277924 2:197860672-197860694 GAACAGACACTTTTCAAAAGAGG - Intronic
947922680 2:233891934-233891956 GAACACACCCTTCTCAACAGCGG + Intergenic
948532931 2:238624344-238624366 GAACACACACTTCTCAAAAGAGG + Intergenic
1169452120 20:5720968-5720990 GAACATATCCTTTCCAAGAAGGG + Intergenic
1176241083 20:64076292-64076314 GGACACACCCTTGGCAAGACAGG + Intronic
1177688833 21:24476843-24476865 GAACAGACCCTTTTCAAAAGAGG + Intergenic
1178095142 21:29206781-29206803 CTACACATCCTTTCCCAAACTGG - Intronic
1182729526 22:32475448-32475470 GAACGCACAATTTCCACAACTGG + Intronic
951586639 3:24221580-24221602 GAAGGCACCCTTTACAAAGCTGG - Intronic
952977852 3:38710992-38711014 GCACAAGCCCTTTCCAACACAGG - Intronic
954527676 3:51287155-51287177 GAACAGACACTTTTCAAAAGAGG + Intronic
955640884 3:61082818-61082840 GAACAAGCCCTTTACAAAAGAGG - Intronic
956652221 3:71514633-71514655 GAACATACCCTTCCCAACAGGGG - Intronic
957291398 3:78281903-78281925 AAACACACCCTCTCCAACAAGGG + Intergenic
958198938 3:90281733-90281755 CAGCACACCTTTTCCAAAATTGG + Intergenic
958989844 3:100830058-100830080 GAACACACCCTTACCCCAAATGG + Intronic
959936871 3:112038438-112038460 GGATACACCATTTCCAAAACTGG + Intronic
960147746 3:114221148-114221170 GACCACACCCTTTACACAAAGGG - Intergenic
962466760 3:135667773-135667795 GAAGACTGCCTTTACAAAACTGG - Intergenic
963542396 3:146609301-146609323 CCACATACCCTTTCCAATACTGG + Intergenic
964863515 3:161228753-161228775 GAATACACGCTTTCTAAGACAGG - Intronic
965685351 3:171296372-171296394 CAACACACCCTTTTTAAAAATGG + Intronic
966901153 3:184486912-184486934 GAACAGACCCTTCTCAAAAGAGG - Intronic
967836978 3:193973029-193973051 GAAAACACTCTTTCTAACACAGG + Intergenic
969158729 4:5236424-5236446 GAACACACTCATGCCCAAACGGG + Intronic
969243817 4:5919432-5919454 GGGCACACCCTTTCCTAAAGGGG + Intronic
971790149 4:31159751-31159773 GAATAAATCCTTTCTAAAACAGG - Intergenic
971811644 4:31435676-31435698 GAACACACACTTTACAACAGAGG - Intergenic
973047051 4:45547611-45547633 GAACACACACTTCTCAAAAGAGG + Intergenic
973873450 4:55189860-55189882 GAACAAACACTTTTCAAAAGAGG + Intergenic
977557947 4:98503700-98503722 GCACACACCCTTCCTACAACTGG + Intronic
978344952 4:107757002-107757024 AAATACACCCATTCCAAAAAGGG - Intergenic
983013882 4:162584580-162584602 GAACAGACATTTTTCAAAACAGG + Intergenic
983287455 4:165757689-165757711 GAAATCACCCTTTCCAAAACAGG - Intergenic
987994128 5:25252771-25252793 GAACAGGCCCTTTTCAAAAGAGG + Intergenic
988979409 5:36551380-36551402 GAACAGATACTTTGCAAAACTGG + Intergenic
990889201 5:60630849-60630871 GTTCACACCCTTTCAATAACAGG - Intronic
991659774 5:68938656-68938678 GAACAGATGCTTTGCAAAACAGG - Intergenic
992781400 5:80131489-80131511 GCACACACTCTTTCCCATACTGG - Intronic
993997997 5:94745226-94745248 GAACAAACCTTTTCCCAAAATGG + Intronic
994949276 5:106436621-106436643 GAACACGCTCTTTACAAAAGAGG + Intergenic
999052601 5:148539566-148539588 GAACAGACACTTTTCAAAAGAGG + Intronic
1001454304 5:171848845-171848867 GAACACACCCCACCCAAAGCAGG + Intergenic
1003802335 6:9684347-9684369 CAACACACCTATTCCAAAATTGG + Intronic
1004019005 6:11759565-11759587 TAAGACAGCCTTTTCAAAACTGG + Intronic
1004325756 6:14672736-14672758 GAAGACACCCTCTCCAAACCAGG + Intergenic
1004349913 6:14882094-14882116 GAACAGACCCTTTCCAAGGATGG + Intergenic
1005340339 6:24837973-24837995 GAAAACACACTTTCCCAAAATGG - Intronic
1005460902 6:26069360-26069382 CAACACATCCTTCCCAAACCTGG - Intergenic
1006575394 6:35041594-35041616 GAACACAGCCTTTTCAAAACAGG - Intronic
1006875604 6:37292986-37293008 GAACACACGCTTTTGAAAAATGG - Intronic
1007345372 6:41224870-41224892 GTCAACACCCTTTCCAAATCAGG + Intergenic
1007848313 6:44779548-44779570 TAAAACACACTTTCCAAAAAGGG + Intergenic
1008457253 6:51725396-51725418 AAACACATCTCTTCCAAAACAGG - Intronic
1010330183 6:74614619-74614641 GAACAGACACTTTTCAAAAGAGG - Intergenic
1010677470 6:78760830-78760852 CACCACACCTATTCCAAAACTGG + Intergenic
1011571304 6:88738862-88738884 ACACACACCCCTTCCAAAACAGG + Intronic
1011828117 6:91334736-91334758 GAACAGACACTTGCCAAAAGAGG - Intergenic
1011977641 6:93325003-93325025 GAACCTACCTTTTCTAAAACTGG + Intronic
1013191756 6:107809704-107809726 GAACTCAACGTTTCCAAAACTGG - Intronic
1014567165 6:122963698-122963720 GAACAGACACTTTTCAAAAAAGG + Intergenic
1017605866 6:156132379-156132401 GAACAGACACTTTTCAAAAGAGG + Intergenic
1017644615 6:156527473-156527495 CACCACACCCCTTCCAATACTGG - Intergenic
1023196317 7:37643125-37643147 TAACACACTGTTGCCAAAACTGG - Intergenic
1023390664 7:39708583-39708605 GAGCACAACCTTTCAAAATCTGG + Intergenic
1023747711 7:43337327-43337349 GAACAGACATTTTGCAAAACAGG - Intronic
1025698216 7:63790939-63790961 AAACACACGCTTTGCTAAACTGG + Intergenic
1025829937 7:65039409-65039431 AAACACACCCTTTGCTAAACTGG + Intergenic
1026379261 7:69782830-69782852 CAACAAAGCCTTTCCAAAAAGGG - Intronic
1029888164 7:103896035-103896057 GAACAGACCCTTGACAAAAGTGG + Intronic
1030538488 7:110799296-110799318 GGAGTCACCCTTTCAAAAACTGG - Intronic
1033524598 7:142197714-142197736 GAACTCACAGTTTCCAACACAGG - Intronic
1033971059 7:147040147-147040169 GAACAGACACTTTTCAAAAGTGG + Intronic
1035814914 8:2528477-2528499 GAACACACACCTTTCAAATCAGG + Intergenic
1038504153 8:28070117-28070139 GAGCCCTCTCTTTCCAAAACAGG + Intronic
1038545180 8:28420610-28420632 GAACTCTCCCTTTCCTAAATTGG + Intronic
1039184777 8:34904999-34905021 GAACAGACCCTTTCCCAAGGTGG + Intergenic
1039634879 8:39153573-39153595 AAACTCACCCTTTCCCACACTGG - Intronic
1040720206 8:50311312-50311334 GAACATAACCTTTCCTAAAGTGG - Intronic
1041816129 8:61973678-61973700 GAACAAACCCTTTACCAGACAGG + Intergenic
1042167471 8:65959562-65959584 AAACACGCCCTTTCAAAAAGGGG - Intergenic
1042499754 8:69495743-69495765 AAACAAACCCTTTCCTTAACAGG + Exonic
1043952210 8:86321877-86321899 GACCACACCCTTGACATAACAGG - Intergenic
1046334963 8:112773133-112773155 CAACCCACCCGTTCAAAAACAGG + Intronic
1047360469 8:124164372-124164394 GAAAACACCTTTTCCAAAGCTGG + Intergenic
1048583905 8:135755302-135755324 GAAGACAATTTTTCCAAAACAGG - Intergenic
1049114251 8:140672361-140672383 GGACACACCCTTCCCAATATTGG - Intronic
1049570426 8:143367817-143367839 GAACACACCCTTTGAAGAGCAGG - Intergenic
1050178637 9:2896429-2896451 CACCACACCTATTCCAAAACTGG - Intergenic
1050417156 9:5429798-5429820 TAACACACCCCTTTCAAAAAGGG + Intronic
1050884960 9:10752491-10752513 GAACACACTCTTTTAAAAAATGG - Intergenic
1055136346 9:72833529-72833551 GAAAACACAGTATCCAAAACAGG - Intronic
1055465411 9:76560728-76560750 GAACACTCCCTTTGCAGAAATGG - Intergenic
1056486061 9:87059128-87059150 GATCACCCCCTTTCCAAGGCTGG - Intergenic
1057626606 9:96683488-96683510 TGACACACCCAGTCCAAAACTGG - Intergenic
1058970517 9:110078221-110078243 GAATACACCCTGTCTAAATCAGG - Intronic
1059824020 9:118006964-118006986 GAAAACACAATTTCCAAAGCTGG + Intergenic
1061332208 9:129902146-129902168 ACACACACCCTTTCCATAATGGG + Intronic
1061689086 9:132310113-132310135 GAACAGGCACTTTCCAAAAGAGG + Intronic
1186102770 X:6174113-6174135 GAACACACACTTCTCAAAAGAGG + Intronic
1186395785 X:9207475-9207497 GAACAGAGCCCTTCCAAAAATGG + Intergenic
1187106572 X:16249352-16249374 CAACACAGCCTTGCCAAAAGAGG + Intergenic
1188874378 X:35412155-35412177 GAACACACACTTCCCAAAAGAGG + Intergenic
1189727460 X:43982593-43982615 GAACAGACACTTTTCAAAAGAGG + Intergenic
1189899191 X:45688292-45688314 GAACAGACACTTTTCAAAAGAGG - Intergenic
1189899572 X:45692161-45692183 GAACAGACACTTTTCAAAAGAGG + Intergenic
1190961627 X:55255468-55255490 GAACATAACATTTCCAATACTGG - Intronic
1191273724 X:58513162-58513184 CAACACACCTGTTCCAAAATTGG - Intergenic
1193215538 X:78859368-78859390 GAAGTCACCATTTCCAAAACAGG - Intergenic
1193410531 X:81157511-81157533 TAGCACATCTTTTCCAAAACTGG + Intronic
1193511979 X:82413510-82413532 GAACACAGCATGTCCAAAAATGG - Intergenic
1194593507 X:95830636-95830658 GAACAGACACTTTGCAAAAGAGG - Intergenic
1194631434 X:96290357-96290379 GAACACACAATATCCAACACTGG + Intergenic
1196857626 X:119999171-119999193 CAACAAAACATTTCCAAAACAGG + Intergenic
1198052837 X:132965047-132965069 GAACACACCCATTGCATGACTGG + Intergenic
1198138509 X:133779383-133779405 GAACACAACCTTTCCAATCCTGG + Intronic
1198187027 X:134263522-134263544 GACCCCTCCCTCTCCAAAACTGG + Intergenic
1198399546 X:136255757-136255779 GAACACATGCTTTCCAAATACGG - Intronic
1200255814 X:154582169-154582191 AAATACTCCCTTTCCAAAAGGGG - Intergenic
1200261955 X:154622234-154622256 AAATACTCCCTTTCCAAAAGGGG + Intergenic
1200405140 Y:2802548-2802570 GAACAGACACTTTTCAAAAAAGG - Intergenic
1201542298 Y:15118991-15119013 GAACAGACACTTTTCAAAAGAGG + Intergenic