ID: 1167271724

View in Genome Browser
Species Human (GRCh38)
Location 19:48509990-48510012
Sequence ACGCCATGACCAGCATCCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 101
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 93}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167271724_1167271736 23 Left 1167271724 19:48509990-48510012 CCATGGGATGCTGGTCATGGCGT 0: 1
1: 0
2: 1
3: 6
4: 93
Right 1167271736 19:48510036-48510058 CTGCGGGGCAGGCATTGGCAGGG 0: 1
1: 0
2: 0
3: 24
4: 203
1167271724_1167271728 0 Left 1167271724 19:48509990-48510012 CCATGGGATGCTGGTCATGGCGT 0: 1
1: 0
2: 1
3: 6
4: 93
Right 1167271728 19:48510013-48510035 GGGGCAGTACCTGAGTGTGAAGG 0: 1
1: 0
2: 3
3: 9
4: 156
1167271724_1167271730 7 Left 1167271724 19:48509990-48510012 CCATGGGATGCTGGTCATGGCGT 0: 1
1: 0
2: 1
3: 6
4: 93
Right 1167271730 19:48510020-48510042 TACCTGAGTGTGAAGGCTGCGGG 0: 1
1: 0
2: 0
3: 24
4: 202
1167271724_1167271735 22 Left 1167271724 19:48509990-48510012 CCATGGGATGCTGGTCATGGCGT 0: 1
1: 0
2: 1
3: 6
4: 93
Right 1167271735 19:48510035-48510057 GCTGCGGGGCAGGCATTGGCAGG 0: 1
1: 0
2: 1
3: 26
4: 283
1167271724_1167271731 8 Left 1167271724 19:48509990-48510012 CCATGGGATGCTGGTCATGGCGT 0: 1
1: 0
2: 1
3: 6
4: 93
Right 1167271731 19:48510021-48510043 ACCTGAGTGTGAAGGCTGCGGGG 0: 1
1: 0
2: 1
3: 30
4: 385
1167271724_1167271734 18 Left 1167271724 19:48509990-48510012 CCATGGGATGCTGGTCATGGCGT 0: 1
1: 0
2: 1
3: 6
4: 93
Right 1167271734 19:48510031-48510053 GAAGGCTGCGGGGCAGGCATTGG 0: 1
1: 0
2: 2
3: 36
4: 344
1167271724_1167271733 12 Left 1167271724 19:48509990-48510012 CCATGGGATGCTGGTCATGGCGT 0: 1
1: 0
2: 1
3: 6
4: 93
Right 1167271733 19:48510025-48510047 GAGTGTGAAGGCTGCGGGGCAGG 0: 1
1: 0
2: 3
3: 29
4: 378
1167271724_1167271729 6 Left 1167271724 19:48509990-48510012 CCATGGGATGCTGGTCATGGCGT 0: 1
1: 0
2: 1
3: 6
4: 93
Right 1167271729 19:48510019-48510041 GTACCTGAGTGTGAAGGCTGCGG 0: 1
1: 0
2: 1
3: 24
4: 219

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167271724 Original CRISPR ACGCCATGACCAGCATCCCA TGG (reversed) Intronic
901161426 1:7179033-7179055 ACACCAGTACCAACATCCCAGGG + Intronic
906521287 1:46468578-46468600 CCACCATGACCGGGATCCCAGGG - Intergenic
907474044 1:54693644-54693666 AGGCCATGCACAGCTTCCCACGG + Intronic
907514723 1:54986344-54986366 CCGTCAAGGCCAGCATCCCAGGG + Exonic
922504445 1:226118516-226118538 ACACCATGAGCAGCAGGCCAAGG - Intergenic
923102518 1:230827589-230827611 GAGCCAAGAGCAGCATCCCAGGG - Intergenic
1067052383 10:43029357-43029379 ACGCCATGGCCAGCTCCTCAGGG + Intergenic
1071325650 10:84514134-84514156 AGGCCAAGACAAGCATCCCAAGG + Exonic
1073597052 10:104811655-104811677 AAGCCAAGAGCAGCATCTCATGG + Intronic
1075482580 10:122795418-122795440 ACGCCATGATCACCAACACAGGG + Intergenic
1075526872 10:123194382-123194404 CCCCCTTGACCCGCATCCCAGGG + Intergenic
1088982869 11:114879409-114879431 ACCACATGACTAGAATCCCATGG + Intergenic
1089617488 11:119703154-119703176 ACGGCATGACCAGGAGACCAAGG + Intronic
1091303461 11:134522763-134522785 CACCCATGACCAACATCCCAGGG - Intergenic
1091349106 11:134878959-134878981 AGTGCAGGACCAGCATCCCAGGG + Intergenic
1096258753 12:50078137-50078159 ACCCCAGGACCAGCCTCCCATGG - Intronic
1096386179 12:51196835-51196857 GCGCCATTCCCAGCATGCCAGGG - Exonic
1104675591 12:130709975-130709997 ACACCATGACCAACTCCCCATGG + Intronic
1108589938 13:51904080-51904102 ACCTCATGCCTAGCATCCCAGGG - Intergenic
1110677156 13:78262587-78262609 ACTCCATCACCATCATGCCAGGG + Intergenic
1111679322 13:91424721-91424743 TAGCCATGACTAGCATCCCAAGG + Intronic
1112401648 13:99084030-99084052 ACGCCAGGTTCAGAATCCCATGG - Intronic
1121616037 14:95314485-95314507 ACTCCTTGACCACCTTCCCAGGG + Intronic
1122326263 14:100882392-100882414 ACGTCATGACCATCATAACAGGG - Exonic
1125525078 15:40369503-40369525 TCCCCAGTACCAGCATCCCATGG - Exonic
1128313567 15:66646438-66646460 ACGCACTGACCACTATCCCAGGG - Intronic
1129229333 15:74188194-74188216 CCGCCATGACCAGCATGCCCAGG + Intronic
1132396237 15:101476937-101476959 ACGCCATAACCAGGGACCCAGGG + Intronic
1132699742 16:1217333-1217355 ACGCCATGCCCAACGTCACATGG + Intronic
1133040434 16:3057572-3057594 ACGCCATCGCCAACATCCGAGGG + Exonic
1135590448 16:23701302-23701324 ACCCAATGACCAGCATTTCATGG + Intronic
1137399565 16:48142260-48142282 ACTGCATGGCCAGCATCCAATGG - Intronic
1141632362 16:85295180-85295202 ACTCCATGCCCCGCTTCCCAGGG + Intergenic
1146057156 17:29587236-29587258 ATGCCAGGGCCAGCATCCTAGGG + Intronic
1148869465 17:50647748-50647770 ACACCATGCCCAGCCTCCAAGGG - Intronic
1155107516 18:22682195-22682217 ACGCCCTGCACAGCACCCCATGG - Intergenic
1156461976 18:37326327-37326349 AGGCCATGGCCAGGGTCCCAGGG - Intronic
1157259753 18:46167776-46167798 CCACCGCGACCAGCATCCCAGGG + Intergenic
1157684268 18:49630131-49630153 CCACCATTACCACCATCCCAAGG + Intergenic
1158051721 18:53229268-53229290 ACCCCATTACCCTCATCCCAAGG - Intronic
1160436311 18:78855344-78855366 ACTCCATGACCACCATCCACTGG + Intergenic
1160783588 19:889540-889562 TCTCCATCACCAGCATCCCCTGG - Intronic
1167271724 19:48509990-48510012 ACGCCATGACCAGCATCCCATGG - Intronic
927747028 2:25632633-25632655 AGGCCATGCACACCATCCCATGG - Intronic
931779369 2:65566092-65566114 TCACGCTGACCAGCATCCCAGGG - Intergenic
932598435 2:73108453-73108475 ACACAAAGACCAGCATTCCAGGG + Intronic
937229785 2:120390865-120390887 CCGCCTTGGCCACCATCCCAGGG - Intergenic
948201023 2:236129922-236129944 ACACCAAAACCAGCATCTCATGG - Exonic
948264598 2:236627624-236627646 ACCCCATGACCTGGATTCCAGGG + Intergenic
948376539 2:237524811-237524833 ACTCCATTCCCAGCATCCCCTGG + Intronic
1169508049 20:6234159-6234181 ATGCCATAAGCAGCATCACATGG + Intergenic
1175012290 20:55750762-55750784 ACACCATGACCCAGATCCCAAGG + Intergenic
1181442151 22:22942189-22942211 GCCCCATGACCAGCACCCCGAGG + Intergenic
1181556726 22:23675566-23675588 ACACATTGACCAGCCTCCCAGGG - Intergenic
1184257232 22:43294256-43294278 AGGCCATGACCAGCATCTCTAGG + Intronic
1185013488 22:48330189-48330211 CCACCATTACCAGCATCCTAGGG + Intergenic
950474889 3:13208961-13208983 ACACCAAGACCAACACCCCAAGG + Intergenic
953388913 3:42523278-42523300 AGGCCTTGACCACAATCCCAGGG + Intronic
954682120 3:52351464-52351486 CCCCCACGACCAGCATCCCTAGG + Intronic
956688464 3:71854441-71854463 ACCCAATGCCCAGCAGCCCATGG - Intergenic
957538691 3:81539982-81540004 ACGCCATGGCCAGCATACCAAGG + Intronic
962417578 3:135197152-135197174 AAGCTGTGACCAGTATCCCATGG + Intronic
968378940 4:71959-71981 ACTCAATGACCACCCTCCCAAGG - Intronic
969080008 4:4610902-4610924 TGGCCATGACCAGCATGCCCCGG + Intergenic
969614557 4:8244742-8244764 ATGGAATGATCAGCATCCCAAGG + Intergenic
975393929 4:73853404-73853426 ACGCCAAGAACAGCATCTCCTGG - Exonic
984463089 4:180059582-180059604 AAACCATTACCAGCATCACAGGG - Intergenic
985677358 5:1238932-1238954 ACTCCCTGCCCAGCATCCCGAGG + Intronic
985871202 5:2558155-2558177 ATGGCATGACCAGCCTCCCCTGG + Intergenic
989495776 5:42110146-42110168 ATGCAAGGAGCAGCATCCCAAGG - Intergenic
1000016806 5:157285254-157285276 GCACCATGACCAGCATCCTTTGG - Intronic
1004367915 6:15027550-15027572 CCACCATGACCACCAGCCCAGGG - Intergenic
1005293733 6:24403260-24403282 ACTGCAAGACCAGCGTCCCAAGG - Intronic
1006934231 6:37706014-37706036 CCTCCATGCCCACCATCCCAGGG + Intergenic
1010326296 6:74566562-74566584 AAGCCAAGACCAGTATCCTAAGG - Intergenic
1010560238 6:77340462-77340484 CCACCACGACCAGCAGCCCATGG + Intergenic
1018225106 6:161621303-161621325 GCCACACGACCAGCATCCCAGGG - Intronic
1018631872 6:165828719-165828741 CAGCCGTCACCAGCATCCCAAGG + Intronic
1019127118 6:169848153-169848175 ACCCCAGGACCAGCAGCCGAGGG - Intergenic
1019287626 7:231506-231528 ACGCCAGGACCCTCCTCCCACGG - Intronic
1019492451 7:1321725-1321747 AGGCCTTGACCAGCTGCCCAAGG - Intergenic
1024630657 7:51244265-51244287 ACGCCTGGACCAGCATGCCCCGG + Intronic
1026832245 7:73617379-73617401 CTGCCATGCCCAGAATCCCAGGG + Intronic
1028213182 7:88100800-88100822 CCACCATGCCCAGCCTCCCAAGG + Intronic
1034785430 7:153922021-153922043 ACGTCAGGCCCAGCAACCCAAGG + Intronic
1034945071 7:155256611-155256633 ACCCCATATCCAGCATCACAGGG + Intergenic
1035006075 7:155662145-155662167 AAGCCATGACAACCATCCCAGGG - Intronic
1035937026 8:3852415-3852437 ACGTCTTGACCAGCAGCACAGGG - Intronic
1036647838 8:10623184-10623206 ACACCATGAACAGCACCCCCAGG - Exonic
1038240202 8:25801041-25801063 TCGACTTGACCAACATCCCAGGG - Intergenic
1042651965 8:71052827-71052849 ACGACATGATCAGCCTGCCATGG - Intergenic
1050240175 9:3626455-3626477 ACCCCATGAGCTCCATCCCAAGG + Intergenic
1051357754 9:16255117-16255139 ACTCCCTGACCAGTCTCCCAGGG + Intronic
1056778207 9:89529501-89529523 ACTCCATGAGCAGCATACCCAGG - Intergenic
1056821417 9:89844795-89844817 ATGTCATGACCTGCATCCCTAGG - Intergenic
1058828596 9:108796074-108796096 ACCCAGTGACCAGCATCCCTGGG - Intergenic
1061861038 9:133468979-133469001 AAGCCAGGACCAGCATCTCCAGG - Exonic
1195312904 X:103650872-103650894 ACGCCATCACCAGAATAACATGG - Intergenic
1195647094 X:107245010-107245032 GCGCCACTACCTGCATCCCAGGG - Intergenic
1198118453 X:133567400-133567422 ACCCCATGAACAGCATCCTCTGG + Intronic
1199339419 X:146659515-146659537 ACACCAGCAGCAGCATCCCAAGG - Intergenic