ID: 1167272515

View in Genome Browser
Species Human (GRCh38)
Location 19:48513846-48513868
Sequence GAGGCAGGTTCATCGCGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167272508_1167272515 4 Left 1167272508 19:48513819-48513841 CCCTCAGGGTGTCTCATTGGAGA No data
Right 1167272515 19:48513846-48513868 GAGGCAGGTTCATCGCGGGAGGG No data
1167272509_1167272515 3 Left 1167272509 19:48513820-48513842 CCTCAGGGTGTCTCATTGGAGAA No data
Right 1167272515 19:48513846-48513868 GAGGCAGGTTCATCGCGGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167272515 Original CRISPR GAGGCAGGTTCATCGCGGGA GGG Intergenic
No off target data available for this crispr