ID: 1167274391

View in Genome Browser
Species Human (GRCh38)
Location 19:48527821-48527843
Sequence TGGCCAAGCCCAATATCCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167274389_1167274391 15 Left 1167274389 19:48527783-48527805 CCAAACTTCTGCTTGCATCATGT No data
Right 1167274391 19:48527821-48527843 TGGCCAAGCCCAATATCCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167274391 Original CRISPR TGGCCAAGCCCAATATCCCA TGG Intergenic
No off target data available for this crispr