ID: 1167279849

View in Genome Browser
Species Human (GRCh38)
Location 19:48560518-48560540
Sequence CGGTATATATCTATGGAGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 58
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 53}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167279849 Original CRISPR CGGTATATATCTATGGAGGG TGG (reversed) Intronic
902661901 1:17910071-17910093 AAGTATATCTATATGGAGGGAGG + Intergenic
909233141 1:73117649-73117671 CTGTATATTTATATGGTGGGAGG + Intergenic
912197773 1:107419654-107419676 CTGTATATAGCTAAGGAAGGTGG - Intronic
913560187 1:120010766-120010788 GGGTATATACCTAGGAAGGGAGG - Intronic
913637937 1:120782804-120782826 GGGTATATACCTAGGAAGGGAGG + Intergenic
914280774 1:146170181-146170203 GGGTATATACCTAGGAAGGGAGG - Intronic
914541817 1:148621121-148621143 GGGTATATACCTAGGAAGGGAGG - Intronic
914624824 1:149450127-149450149 GGGTATATACCTAGGAAGGGAGG + Intergenic
917497580 1:175555219-175555241 CTGTATGTATCTATAGGGGGTGG - Intronic
918457355 1:184735815-184735837 ATGTATATGTGTATGGAGGGTGG - Intronic
1063921484 10:10937837-10937859 GTATATATATATATGGAGGGAGG + Intergenic
1064067399 10:12194406-12194428 TTGTATATATGTCTGGAGGGTGG - Intronic
1087563967 11:99829921-99829943 CAGTTTATATTTATAGAGGGAGG - Intronic
1088536181 11:110864250-110864272 CTGTATATGTTTAGGGAGGGAGG + Intergenic
1093843123 12:23930420-23930442 CTGTATATATTTATAGAGGGAGG + Intronic
1098596890 12:72283497-72283519 CAGTATATATCTATGCACAGAGG - Intronic
1110388238 13:74939923-74939945 AGGTTTATATCTATCCAGGGTGG + Intergenic
1111072885 13:83191971-83191993 GGGTATATACCTATGAATGGAGG - Intergenic
1113350332 13:109523450-109523472 CAGTATATATGTTTGGTGGGAGG - Intergenic
1115724381 14:36196826-36196848 CGGTATTTATCTTTGGATAGTGG + Intergenic
1120090925 14:80332733-80332755 CTTTATATATATATGGAGAGTGG - Intronic
1130730669 15:86488680-86488702 AGGTATGTATATATGTAGGGAGG - Intronic
1137459716 16:48649531-48649553 CGGAACATTTCTATGGAGAGTGG + Intergenic
1143366279 17:6410713-6410735 AGGTAGATATCTTTGGTGGGGGG - Intronic
1144698376 17:17321087-17321109 GTGTATATATCTAAGGCGGGAGG + Intronic
1167279849 19:48560518-48560540 CGGTATATATCTATGGAGGGTGG - Intronic
946510788 2:220353815-220353837 CAGGATAGATCTATGGAGGTGGG + Intergenic
1172180355 20:32999730-32999752 CAGTATATGTCAGTGGAGGGAGG + Intronic
1174530617 20:51210512-51210534 CTGTGTATATGTATGAAGGGAGG - Intergenic
1174958613 20:55130047-55130069 TCGTACATATGTATGGAGGGTGG - Intergenic
1177959350 21:27643136-27643158 CGTTATATATTTATGGAGGTAGG + Intergenic
1183932528 22:41244172-41244194 CTGTATATATATATGGGTGGGGG - Intergenic
954931192 3:54283350-54283372 CAGGAGATATCCATGGAGGGAGG - Intronic
959045996 3:101474396-101474418 AGGAATACATCTAAGGAGGGAGG - Intronic
966950945 3:184817243-184817265 GGGTATTTACCTAGGGAGGGAGG + Intronic
970828097 4:20302627-20302649 GGGGATATATTTAAGGAGGGAGG + Intronic
971066347 4:23036865-23036887 CAGTAAATATCTGTGGAGGGTGG + Intergenic
982783849 4:159520262-159520284 CAATATATATCCCTGGAGGGTGG - Intergenic
983109106 4:163726045-163726067 CTGTATATATGTAGGGATGGGGG - Intronic
985213005 4:187615441-187615463 CGGTATAGATCTAGAGATGGGGG + Intergenic
992165712 5:74049224-74049246 GGGTATATAGCGGTGGAGGGAGG - Intergenic
994613304 5:102073179-102073201 CTTTATATATCTAGGAAGGGAGG - Intergenic
998704311 5:144741076-144741098 GTATATATATATATGGAGGGAGG - Intergenic
1014860124 6:126455986-126456008 AGGAATATATCTAACGAGGGGGG + Intergenic
1015697324 6:135995213-135995235 TGGTACATATGTATGGAGCGTGG - Intronic
1016485677 6:144535456-144535478 AGGTAGATATCTGTGGAGTGTGG + Intronic
1023733139 7:43210844-43210866 CGGTAAATATCAATGGTGGACGG + Intronic
1024377913 7:48659831-48659853 CGGTATGTAACCATGGTGGGTGG + Intergenic
1027461144 7:78455148-78455170 CTGTATATGTGTGTGGAGGGAGG + Intronic
1037147262 8:15587453-15587475 CTGTATATATTTATGGAGTACGG + Intronic
1045892377 8:107172057-107172079 CGGTATATATTTAGGGAGAATGG + Intergenic
1059321758 9:113475755-113475777 GGGTATGTATCTGTGGAGGGAGG + Intronic
1190797515 X:53759138-53759160 CGGCATAGATATATGGAGTGGGG - Intergenic
1191722556 X:64246453-64246475 GTGTATATATTTATGAAGGGTGG + Intergenic
1193464793 X:81835198-81835220 TGGTATGTATGTGTGGAGGGGGG + Intergenic
1197924086 X:131628251-131628273 TAGAAAATATCTATGGAGGGGGG + Intergenic
1197966787 X:132072029-132072051 AGGTATTTATCTATGGTAGGAGG + Intergenic
1201275607 Y:12295240-12295262 GGGTATGTATCTATAGAGAGAGG - Intergenic