ID: 1167284683

View in Genome Browser
Species Human (GRCh38)
Location 19:48592494-48592516
Sequence CTGGATGGACAGATAGACAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 422
Summary {0: 1, 1: 0, 2: 11, 3: 41, 4: 369}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167284674_1167284683 16 Left 1167284674 19:48592455-48592477 CCCTGGCTTTGGAGGGAAATCCA 0: 1
1: 0
2: 1
3: 22
4: 204
Right 1167284683 19:48592494-48592516 CTGGATGGACAGATAGACAAAGG 0: 1
1: 0
2: 11
3: 41
4: 369
1167284675_1167284683 15 Left 1167284675 19:48592456-48592478 CCTGGCTTTGGAGGGAAATCCAG 0: 1
1: 0
2: 2
3: 18
4: 163
Right 1167284683 19:48592494-48592516 CTGGATGGACAGATAGACAAAGG 0: 1
1: 0
2: 11
3: 41
4: 369
1167284680_1167284683 -4 Left 1167284680 19:48592475-48592497 CCAGGTGTGTGGAGGCGGACTGG 0: 1
1: 0
2: 1
3: 27
4: 168
Right 1167284683 19:48592494-48592516 CTGGATGGACAGATAGACAAAGG 0: 1
1: 0
2: 11
3: 41
4: 369

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167284683 Original CRISPR CTGGATGGACAGATAGACAA AGG Intronic
900485659 1:2921440-2921462 CTGGATGGACAGATGGACACAGG - Intergenic
900485667 1:2921482-2921504 CTGGATGGACAGATGGACAGAGG - Intergenic
900485675 1:2921524-2921546 CTGGATGGACAGACGGACACAGG - Intergenic
900485683 1:2921566-2921588 CTGGATGGACAGATGGACACAGG - Intergenic
900485691 1:2921608-2921630 CTGGATGGACAGATGGACACAGG - Intergenic
900485699 1:2921650-2921672 CTGGATGGACAGATGGACACAGG - Intergenic
900485707 1:2921692-2921714 CTGGATGGACAGATGGACGGAGG - Intergenic
900485716 1:2921734-2921756 CTGGATGGACAGATGGACGGAGG - Intergenic
900485725 1:2921776-2921798 CTGGATGGACAGATGGACGGAGG - Intergenic
900485735 1:2921818-2921840 CTGGATGGACAGATGGACGGAGG - Intergenic
900485744 1:2921860-2921882 CTGGATGGACAGATGGACGGAGG - Intergenic
900485753 1:2921902-2921924 CTGGATGGACAGATGGACAGAGG - Intergenic
900485761 1:2921944-2921966 CTGGATGGACAGATGGACAGAGG - Intergenic
900485769 1:2921986-2922008 CTGGATAGACAGATGGACAGAGG - Intergenic
900492433 1:2958940-2958962 CAGGATAGACACATGGACAAAGG + Intergenic
900930857 1:5736461-5736483 ATGGATAGATAGATAGACAAAGG + Intergenic
901264309 1:7898403-7898425 CAAGATGGACAGAGAGAGAAGGG + Intergenic
901266834 1:7917337-7917359 CAGGATAGACAAATTGACAATGG + Exonic
901826753 1:11866995-11867017 CTGCATGGAGAGAGACACAATGG - Intergenic
902155472 1:14482104-14482126 CTGCATGGATAGATGGCCAAAGG + Intergenic
902225880 1:14996257-14996279 CTGGGTGGACAGAGACACACGGG - Intronic
902603883 1:17558106-17558128 ATGGATGGATGGATGGACAATGG - Intronic
903341661 1:22658744-22658766 ATGGATGGATAGATGGACAGAGG + Intronic
903341681 1:22658819-22658841 ATGGATGGACAGATGGACAGAGG + Intronic
904618670 1:31763111-31763133 GGGGATGGACAGATAGACTCCGG + Intronic
904834161 1:33324238-33324260 CTGGACTGACAGATAGGCCAAGG - Exonic
905917942 1:41698872-41698894 CAGAAGGGACACATAGACAAAGG - Intronic
907814034 1:57900634-57900656 CTGGTTGGCCACATGGACAAAGG - Intronic
908056656 1:60294488-60294510 CAGGATGGAAAGATTGCCAAGGG - Intergenic
908077437 1:60535834-60535856 GTGGATGGACAGAGAGCCATAGG + Intergenic
908587026 1:65580943-65580965 CAGGATGGAGGGATACACAAGGG + Intronic
910371159 1:86516502-86516524 CAGGTTGGAAAGATGGACAAAGG - Intergenic
910905883 1:92177420-92177442 CTGGATGAACCGAAAGAAAATGG + Exonic
912948436 1:114104101-114104123 CTGGATGGGCAGGAAGTCAAGGG - Intronic
913530174 1:119728377-119728399 CTGGAAGGACAGATGGACAATGG - Intronic
914351392 1:146843111-146843133 ATGGATGGATAGATAGATGATGG + Intergenic
915080573 1:153349102-153349124 CAGGATGGACAGAGAGAAACTGG + Intergenic
915211542 1:154313249-154313271 CGGGATGGAGAGATACAGAAAGG - Intergenic
916742033 1:167654578-167654600 CTGGAAGGAGAGATTGACAGGGG + Intronic
917209472 1:172616686-172616708 CTGGATGGACAGGTGAACAGTGG + Intergenic
918259207 1:182779546-182779568 CAGGTTGGACAGATGGACAGTGG - Intergenic
918655952 1:187027053-187027075 CAGGATGGCCACATAGAGAAGGG + Intergenic
919197330 1:194303189-194303211 GTGGTTGGAGAGATAGACAGGGG - Intergenic
919208594 1:194451190-194451212 CTAGATGGACAGGTAGACCTAGG - Intergenic
919381635 1:196868214-196868236 CTTTATGGAATGATAGACAAAGG - Intronic
919711028 1:200728607-200728629 ATGAATGGAAAGATATACAAAGG + Intergenic
920162097 1:204006579-204006601 CTAGTTGGAGAGATAGACATAGG + Intergenic
921346378 1:214189457-214189479 ATGGGTGTACAGATAGACCATGG - Intergenic
922369836 1:224898273-224898295 CTGAATAGACAAATGGACAATGG - Intronic
923366834 1:233270036-233270058 ATGGATGACCAGATGGACAAAGG - Intronic
1063217823 10:3939716-3939738 CTGGTTGGACAGATGGGAAAAGG - Intergenic
1063302928 10:4868282-4868304 CAGGATGGCCATATAGAGAAAGG - Intergenic
1064803667 10:19106454-19106476 CTGGTTGCACAGAAATACAAAGG - Intronic
1066444491 10:35469608-35469630 GTGGAGAGACAGATAGACAGGGG + Intronic
1068277334 10:54818097-54818119 CTACATGGATAGATAGACAGAGG - Intronic
1068992004 10:63159955-63159977 CAGGATGTACAGGAAGACAAAGG + Intergenic
1070266930 10:74912318-74912340 ATGGATAGACAGATAGATGAAGG + Intronic
1070538045 10:77394050-77394072 ATGGATGGGCAGACAGACAATGG + Intronic
1072539777 10:96389621-96389643 TGGGAGAGACAGATAGACAAAGG + Intronic
1072722048 10:97787160-97787182 AGAGATGGACAGATGGACAAAGG - Intergenic
1073107119 10:101038618-101038640 GTGGAGAGACAGAAAGACAATGG - Intronic
1073314505 10:102569504-102569526 CTGCTTGGAGAGATAGAGAAGGG - Intronic
1074125825 10:110528159-110528181 CTGGATGGACAGATCGGGATTGG + Intergenic
1075151351 10:119935526-119935548 ATGGATGGATAGATAGATATGGG - Intronic
1075906415 10:126085645-126085667 ACGGATGGACAGACAGACAAAGG - Intronic
1076470220 10:130713555-130713577 CTGTGTGGACAGAAGGACAAGGG + Intergenic
1077280503 11:1742895-1742917 ATGGATGGACAGATGGAGGATGG + Intronic
1077280556 11:1743142-1743164 ATGGATGGACAGATGGAGGATGG + Intronic
1077280559 11:1743165-1743187 ATGGATGGACAGATGAAGAATGG + Intronic
1077280564 11:1743203-1743225 ATGGATGGACAGATGAAGAATGG + Intronic
1077280576 11:1743274-1743296 ATGGATGGACAGATGGAGGATGG + Intronic
1077280579 11:1743297-1743319 ATGGATGGACAGATGAAGAATGG + Intronic
1077280616 11:1743486-1743508 ATGGATGGACAGATGGAGAATGG + Intronic
1077304201 11:1861544-1861566 ATGGATGGATAGATGGATAATGG + Intronic
1077312155 11:1893676-1893698 ATGGATGGATAGATAGATAATGG + Intergenic
1077479903 11:2808874-2808896 ATGGATGAACACATGGACAATGG + Intronic
1077735747 11:4788874-4788896 ATGGATGGAAGGATATACAAGGG + Intronic
1077874143 11:6289484-6289506 GTGGATGGAGAGGTAGAAAAGGG + Intergenic
1081534476 11:43987172-43987194 ATGGATGGAAGGATGGACAAAGG - Intergenic
1081668817 11:44932092-44932114 ATGGATAGAGACATAGACAAGGG - Exonic
1082213148 11:49531014-49531036 CTTGATGGAAAAATAGGCAAAGG - Intergenic
1082881594 11:58043387-58043409 ATGAATAGACAAATAGACAAAGG - Intronic
1083330954 11:61898144-61898166 ATGGATGGACAGACAGGCCATGG - Exonic
1083347726 11:62005268-62005290 ATGGATGGAAGGATAGAAAAAGG + Intergenic
1083731734 11:64655970-64655992 CTGGCTGGACAGAGAGAGCAGGG + Intronic
1084461919 11:69300995-69301017 ATGCATGGACAGATAGATAGTGG + Intronic
1084718988 11:70892142-70892164 ATGGATGGACTGATGGACTAAGG - Intronic
1084785656 11:71440394-71440416 GTGGATGGACAAATAGATGACGG + Intronic
1085462534 11:76702711-76702733 AGGGATGGATAGATGGACAATGG + Intergenic
1085703341 11:78764320-78764342 CTCGATGTACAGAAAGATAATGG - Intronic
1086084289 11:82938870-82938892 CTGAATGGATAGAGAAACAAGGG + Intronic
1086515133 11:87603071-87603093 CTGAATATACAAATAGACAATGG - Intergenic
1086636451 11:89093503-89093525 CTTGATGGAAAAATAGGCAAAGG + Intergenic
1086893339 11:92284191-92284213 ATGGTTGGACACATAGAAAAGGG + Intergenic
1087963437 11:104381024-104381046 CTGGCTGGACAGATCAAGAAAGG - Intergenic
1088633931 11:111800854-111800876 ATGGGTGGACAGACAGACAATGG + Intronic
1092865028 12:12752886-12752908 CTGGCTAAACAGATAGAGAAGGG - Intronic
1094117992 12:26938276-26938298 CTGGGTGGAGAGACAGAGAAGGG - Exonic
1094287970 12:28815895-28815917 CTTGATGGACTGCTTGACAATGG + Intergenic
1094435288 12:30414306-30414328 CGGGTTGGACAGAGTGACAATGG - Intergenic
1094795075 12:33962345-33962367 CAGGAGGGACCGTTAGACAAGGG - Intergenic
1097500102 12:60391426-60391448 CTGTATGGACTGTTGGACAAGGG - Intergenic
1099694623 12:86002089-86002111 CTGGGAGGACAGGTAGACAGAGG - Intronic
1100515100 12:95319894-95319916 CTGGATGGTCACAGAGAGAAGGG - Intergenic
1100716064 12:97307141-97307163 CTGGATGGATGGATAGAAAGTGG + Intergenic
1101713168 12:107287509-107287531 CTGGAAGGACAGGGAGGCAAAGG + Intergenic
1103960934 12:124608964-124608986 CTGGAAGGACACACAGACACTGG + Intergenic
1104034648 12:125089902-125089924 ATGGATGGATAGATGGATAATGG - Intronic
1104034698 12:125090204-125090226 ATGGATGGATAGATGGATAATGG - Intronic
1104599947 12:130146034-130146056 TTGGATGGACAAATTGGCAAGGG - Intergenic
1104772618 12:131372966-131372988 ATGGATGGAAGGATGGACAAAGG - Intergenic
1105209450 13:18249283-18249305 AAAGATGGTCAGATAGACAATGG + Intergenic
1106008165 13:25791027-25791049 CTGGATGGATACATACCCAAAGG + Intronic
1106187276 13:27420627-27420649 GTGGATGGACTCGTAGACAATGG + Intergenic
1106343340 13:28852275-28852297 CTGGAGAGACAGATGAACAAAGG - Intronic
1106724481 13:32470189-32470211 CTTGATGGACCGCTTGACAATGG + Intronic
1106790538 13:33151393-33151415 CAGGAGGGAGAGATAGAAAAGGG + Intronic
1106871715 13:34029087-34029109 CTGAATATACAGATGGACAATGG + Intergenic
1108460591 13:50663273-50663295 CTGGATGGAAGGACTGACAAAGG + Intronic
1109004169 13:56848160-56848182 CTGAATTGAAAGATAGACATAGG - Intergenic
1109747277 13:66641723-66641745 ATGGATGGACAGAGAGATATAGG + Intronic
1110216413 13:73029502-73029524 CTGGAAGAAGAGAGAGACAAAGG - Intergenic
1110499840 13:76214172-76214194 CTGGATGGAGAGAGAGAAAAGGG + Intergenic
1112798854 13:103088364-103088386 CATGATGAACTGATAGACAAAGG + Intergenic
1113603761 13:111590156-111590178 CTGGATGGATGGATAGGCGATGG + Intronic
1114488606 14:23080810-23080832 CTGAAAGAACAGATACACAATGG + Intronic
1115303888 14:31914351-31914373 CAGGATGGCCACATAGAGAAGGG - Intergenic
1115486457 14:33915556-33915578 CTGGATAGTGAGATAGACCATGG + Intergenic
1116146083 14:41070788-41070810 CTGAATATACAGATAGAAAATGG - Intergenic
1116952425 14:50891878-50891900 TAAGATTGACAGATAGACAATGG - Intronic
1118909991 14:70053630-70053652 CTAGATTGATAGGTAGACAAGGG - Intronic
1119921420 14:78449945-78449967 TTGGGTAGACAGATAGCCAATGG - Intronic
1120461822 14:84806781-84806803 CTGGATGGACAATTTGGCAAAGG - Intergenic
1120537465 14:85714542-85714564 CTGGAGAGACAGATAGATATTGG + Intergenic
1120671936 14:87372624-87372646 ATGGATAGATAGATAGATAAAGG - Intergenic
1120954666 14:90071462-90071484 CAGGAGGGACAGAAAGACAGAGG - Intronic
1121530042 14:94645987-94646009 GTGGATGGACAGATAGATGCTGG + Intergenic
1122029899 14:98904721-98904743 GTGGATGGATAAATAGACAGTGG - Intergenic
1122854356 14:104552997-104553019 CTGGAAGGACAGAGAGGGAAAGG + Intronic
1122877508 14:104675641-104675663 ATGGATGGACAGATGGATAATGG + Intergenic
1124992224 15:34686584-34686606 TTGGATGGAAAGAAAGGCAAGGG - Intergenic
1126168863 15:45677236-45677258 ATGGATAGATAGATAGACAAAGG - Intronic
1126728922 15:51661739-51661761 ATGGATGAATAGATAGATAAAGG - Intergenic
1128308478 15:66615542-66615564 CTGGATGGACAGGCAGATGATGG + Intronic
1128550654 15:68596099-68596121 ATGGATGGACTGATACACATGGG - Intronic
1130784898 15:87085234-87085256 ATGGATGGATAGATAGATGAGGG - Intergenic
1131269853 15:90940510-90940532 ATGGATGGACAGACAGACAAAGG - Intronic
1132037914 15:98501860-98501882 CGGGATGGCCACATAGAGAATGG - Intronic
1132238825 15:100241786-100241808 CTTGATTGACATATAGAAAAGGG - Intronic
1132592582 16:732604-732626 GAGGATGGACAGATGGACACTGG - Intronic
1132841914 16:1982222-1982244 CTGGTGGGACAGACACACAAAGG - Exonic
1134767912 16:16777869-16777891 CTGGATCTACAGATATACCAAGG - Intergenic
1136638804 16:31544196-31544218 CTGGATGTATAGATAGACTATGG - Intergenic
1136909328 16:34133574-34133596 CGGGATGGAGAGATAGAAATGGG - Intergenic
1137755366 16:50897807-50897829 ATGGATGGACATATGGACATTGG + Intergenic
1138414496 16:56863621-56863643 CTGGAGGTACACATAGACATTGG + Intergenic
1138846295 16:60571312-60571334 ATGGGTGGACAGAGAAACAAAGG - Intergenic
1139391944 16:66610731-66610753 GTGGCTGGACAGGTAGACAAGGG + Intronic
1140164185 16:72531821-72531843 TTGGACGCACAGATAGAGAACGG - Intergenic
1140572179 16:76120352-76120374 CTGAATGGACAAATAGAATAAGG + Intergenic
1141619786 16:85231001-85231023 ATGGATGGACAGATGGATGATGG + Intergenic
1141619820 16:85231182-85231204 ATGGATGGACAGATGGATGATGG + Intergenic
1141619847 16:85231335-85231357 ATGGATGGACAGATGGATGATGG + Intergenic
1141899321 16:86980206-86980228 TTGGATAGAGAGATAGATAATGG + Intergenic
1142152726 16:88519820-88519842 ATGGATGGACAGATAGATGGTGG + Intronic
1143484181 17:7244006-7244028 CTGGATGGACACATGGGCCAGGG - Exonic
1144261819 17:13528840-13528862 CGGGATGGACACATGCACAAAGG + Intronic
1144532255 17:16050635-16050657 CTGGATGGGCTGATTGAGAAAGG - Intronic
1146562818 17:33886181-33886203 CTGGCTGAAGAGATGGACAAAGG + Intronic
1146626877 17:34441706-34441728 CTGGATGGACAGATGGATGGAGG + Intergenic
1146826734 17:36029614-36029636 GTGGATGAACAGATGGACAGAGG - Intergenic
1148478726 17:47946169-47946191 CAGGATGGCCAGATGGACAGAGG - Intronic
1149552135 17:57548258-57548280 CTGCATGGACAGGGATACAAAGG - Intronic
1151326030 17:73380233-73380255 CTGCATAGACAGCTAGGCAAGGG - Intronic
1151420264 17:73992500-73992522 CAGGAAGGAAAGAAAGACAACGG + Intergenic
1151786307 17:76276721-76276743 CTGGATGGCCACATTTACAAGGG - Exonic
1151851485 17:76692967-76692989 CTGGAGGGACAGGCAGGCAAAGG - Intronic
1152343682 17:79738792-79738814 GTGGCTGCACAGACAGACAAGGG - Intronic
1152646416 17:81470813-81470835 ATGGATGGGCAGATGGACACAGG - Intergenic
1153190691 18:2534553-2534575 CTGTATGGATAGTTAGAAAAGGG - Intergenic
1155325080 18:24657000-24657022 CTGAATGGCCAGAAAGAAAATGG - Intergenic
1155620861 18:27777908-27777930 CTGGATGGAGAGAGAGAAAAGGG - Intergenic
1157051969 18:44176707-44176729 CTGGGTGGAGAGAGAGAGAAGGG + Intergenic
1157705479 18:49801596-49801618 CTGGATGTGAAGATACACAACGG + Intronic
1158197542 18:54905600-54905622 CTGGATTCACAAATATACAATGG - Intronic
1158512468 18:58103120-58103142 CTACATAGACAAATAGACAAAGG - Intronic
1159048067 18:63389032-63389054 CTTTATGGACAGATACTCAAAGG - Intergenic
1159963375 18:74573186-74573208 GTAGATGGATAGATAGATAATGG - Intronic
1160069767 18:75617087-75617109 AAGGATGGACACATAGATAAGGG + Intergenic
1160681772 19:414952-414974 ATGGATGGACAGATGGAAAATGG + Intergenic
1161258516 19:3322891-3322913 GTGGATGGATAGATGGATAAAGG + Intergenic
1161258539 19:3322991-3323013 GTGGATGGATAGATGGACAAAGG + Intergenic
1161879113 19:6934935-6934957 CTGGATATACAAATAGACAAGGG - Intronic
1162595201 19:11623269-11623291 CTGGAAAAACAGATAGAAAAGGG - Intergenic
1163604838 19:18268405-18268427 TTGGATGGACAGATAGATACAGG + Intronic
1163626363 19:18392126-18392148 CTGGGGGGACAGACAGACCAGGG + Intronic
1163952818 19:20606481-20606503 CTGGATGGACAGAACCACATGGG - Intronic
1164014039 19:21236159-21236181 CTGGACACACAGATAGAAAAGGG + Intronic
1164073505 19:21791387-21791409 CTGGAAAAACAGATAGAAAAGGG - Intergenic
1165919905 19:39289908-39289930 CTGGATGAACAGAAAGAAAGTGG - Intergenic
1165927454 19:39335814-39335836 CTGGAAGAACAGAGAGACAGTGG - Intronic
1166981707 19:46635285-46635307 TCGGATGGACAGAGGGACAACGG + Intergenic
1167233760 19:48301670-48301692 GCAGATGGACAGATAGACAATGG + Intronic
1167233775 19:48301731-48301753 CTGGATGGATGGATGGACATGGG + Intronic
1167233824 19:48301985-48302007 CTGGATGGAGAGATAGATATAGG + Intronic
1167233872 19:48302239-48302261 CTGGATGGAGAGATAGATATAGG + Intronic
1167233919 19:48302508-48302530 ATGGATGGATAGATGGACATGGG + Intronic
1167284683 19:48592494-48592516 CTGGATGGACAGATAGACAAAGG + Intronic
1167640744 19:50679988-50680010 ATGGAGAGACAGAGAGACAATGG + Intronic
1167808630 19:51809015-51809037 CTGGAAAAACAGATAGAAAAGGG - Intronic
1167882849 19:52476477-52476499 CTGGAAAAACAGATAGAAAAGGG - Intronic
1167937868 19:52922495-52922517 CTGGATGTACAGAGAGATGAAGG - Intergenic
1167999453 19:53432848-53432870 CTGGATGTACAGAGAGATGAAGG + Intronic
925451571 2:3973651-3973673 CTGGATATACAAAGAGACAATGG - Intergenic
929582688 2:43092956-43092978 CTTGATGGAAAGAGAGTCAAAGG + Intergenic
930774068 2:55155370-55155392 CGGGAAGGACACAGAGACAAGGG - Intergenic
931282428 2:60806066-60806088 CTGGCTGGAGAGACAGACACTGG - Intergenic
932336128 2:70932464-70932486 ATGGATCGACAGACAGAGAATGG - Intronic
932892082 2:75606149-75606171 ATGGGTGGATAGATGGACAAAGG + Intergenic
935199683 2:100845417-100845439 CTGAATGTACAAATGGACAATGG - Intronic
937200417 2:120200437-120200459 ATGGATGGATAAATATACAATGG + Intergenic
937474331 2:122201682-122201704 CTGGAAGGAGAGATGGCCAAAGG - Intergenic
937813198 2:126221587-126221609 CTGAATATACAGATGGACAATGG + Intergenic
938108156 2:128547180-128547202 ATGGATGGATAGATGGAGAATGG - Intergenic
938108195 2:128547361-128547383 ATGGATGGATGGATAGATAATGG - Intergenic
938368065 2:130751062-130751084 ATGGATGGATGGATAGACACAGG + Intergenic
938660610 2:133483071-133483093 CTAGATAGATAGATAGATAAAGG - Intronic
938929486 2:136074194-136074216 CTGGAAAAACAGATAGAAAAGGG - Intergenic
944773130 2:202933608-202933630 CGGGATGGCCACATAGAGAATGG - Intronic
947956866 2:234199682-234199704 CTGGCTGGACAGATAGGTAATGG - Intergenic
948122322 2:235540053-235540075 CAGGATGGACAGATGGACAGTGG + Intronic
1170276267 20:14593721-14593743 CTGGAAGGATACAAAGACAAAGG - Intronic
1170939779 20:20839369-20839391 CTGGATGCACAGATAGAGCTTGG + Intergenic
1171289616 20:23974704-23974726 ATGGGTGGACAGATGGACAATGG - Intergenic
1171290604 20:23980950-23980972 AAAGATGGTCAGATAGACAATGG + Intergenic
1171904795 20:30892344-30892366 CGGGATGGAGAGATAGATATGGG - Intergenic
1173146469 20:40529004-40529026 CAGGATTGGCAGAGAGACAACGG - Intergenic
1173871520 20:46344999-46345021 ATGGATGGAGAGATGGATAATGG - Intergenic
1174264908 20:49324280-49324302 CTGGCTGGACAGCTGGACCAAGG - Intergenic
1175696263 20:61105453-61105475 AGGGAAGGAAAGATAGACAATGG + Intergenic
1175779247 20:61671877-61671899 GTGGATGGACAGATGGAGGATGG + Intronic
1176295718 21:5071073-5071095 CTGGACGGACAGACAGGCAGAGG + Intergenic
1177657285 21:24035065-24035087 CTGGATGGACAGAATAGCAAGGG + Intergenic
1179098547 21:38336703-38336725 CAGGAGGGAGAGAGAGACAAGGG + Intergenic
1179474340 21:41633678-41633700 ATGGATGGACAAATGGATAATGG - Intergenic
1179541138 21:42083873-42083895 CTGGAAGGACAGATGGGCAGAGG + Intronic
1179623649 21:42634720-42634742 GTGGATGAATAGATGGACAATGG - Intergenic
1179623662 21:42634834-42634856 GTGGATGAAAAGATGGACAATGG - Intergenic
1179623676 21:42634944-42634966 GTGGATGAATAGATGGACAATGG - Intergenic
1179623690 21:42635050-42635072 GTGGATGAATAGATGGACAATGG - Intergenic
1179623705 21:42635164-42635186 GTGGATGAACAGATGGACAATGG - Intergenic
1179623720 21:42635278-42635300 GTGGATGAAAAGATGGACAATGG - Intergenic
1179623732 21:42635384-42635406 GTGGATGAATAGATGGACAATGG - Intergenic
1179623744 21:42635490-42635512 GTGGATGAAAAGATGGACAATGG - Intergenic
1179623759 21:42635604-42635626 GTGGATGAATAGATGGACAATGG - Intergenic
1179861328 21:44191051-44191073 CTGGACGGACAGACAGGCAGAGG - Intergenic
1180182440 21:46124021-46124043 GTGGATGGACAGACGGACAGTGG + Intronic
1180338222 22:11598479-11598501 CGGGATGGAGAGATAGAAATGGG - Intergenic
1180766817 22:18350117-18350139 AAAGATGGTCAGATAGACAATGG - Intergenic
1180779496 22:18512261-18512283 AAAGATGGTCAGATAGACAATGG + Intergenic
1180812212 22:18769582-18769604 AAAGATGGTCAGATAGACAATGG + Intergenic
1181198371 22:21203829-21203851 AAAGATGGTCAGATAGACAATGG + Intergenic
1181401374 22:22651970-22651992 AAAGATGGTCAGATAGACAATGG - Intergenic
1181648158 22:24244919-24244941 AAAGATGGTCAGATAGACAATGG + Exonic
1181703341 22:24633052-24633074 AAAGATGGTCAGATAGACAATGG - Intergenic
1182358940 22:29735384-29735406 CTGGGTGGCCAGAGGGACAATGG + Intronic
1182785631 22:32905411-32905433 CTGCATGGTCAGGAAGACAAAGG + Intronic
1182822430 22:33228842-33228864 GAGGGTGGAGAGATAGACAAAGG + Intronic
1183365459 22:37404386-37404408 CAGGATGGAGAGAGAGACCAAGG + Intronic
1183467298 22:37986193-37986215 CTGGATGGACAGAGGGACGAGGG + Intronic
1183645315 22:39123111-39123133 CTGGATGATCAGACAGACAGGGG + Intronic
1184389292 22:44193972-44193994 ATGGATGGACAGACAGAAAGAGG - Intronic
1184800074 22:46753741-46753763 CTGGATGGAAAGAGAGACTGGGG - Intergenic
1185212921 22:49581940-49581962 ATGGATGGACAGATGAATAATGG - Intronic
1185293841 22:50043103-50043125 ATGGATAGACAGATAAACAGTGG + Intronic
1185293863 22:50043323-50043345 ATGGATGGATAGATAAACAGTGG + Intronic
1203228436 22_KI270731v1_random:91008-91030 AAAGATGGTCAGATAGACAATGG - Intergenic
950623603 3:14227512-14227534 CTGGAAAAACAGATAGAAAAGGG + Intergenic
951690215 3:25387244-25387266 CTGGATGGACAGGAGGACACTGG + Intronic
951858356 3:27223421-27223443 TTGGATGTGCAGATGGACAATGG - Intronic
952117079 3:30195627-30195649 TTGGATGGTCATATAGAGAAAGG + Intergenic
952299061 3:32087831-32087853 CTGAACAGACAGATAGAAAAGGG - Intergenic
953173658 3:40529883-40529905 CTGGATGGACAAAGGAACAAAGG - Intronic
954623675 3:52010403-52010425 ATGGATGGACAGATGGATAGAGG - Intergenic
954943090 3:54393083-54393105 CAGGATGGACGCATAGAGAAGGG + Intronic
955041931 3:55325923-55325945 ATGGATGGATGGATAGACAGAGG + Intergenic
955411099 3:58656028-58656050 ATGGATGGACAGGTAGATAGAGG - Intronic
956329312 3:68087647-68087669 ATGGATGGATATATGGACAAAGG - Intronic
956671436 3:71695135-71695157 GTAGCTGGACAGATAGAAAACGG - Intronic
957617525 3:82550331-82550353 CTGTATTGACAAATAGCCAATGG - Intergenic
957874324 3:86125787-86125809 GTGGATTCACAGATACACAAAGG + Intergenic
957955075 3:87176005-87176027 CTGGTTATACAGATAGAAAATGG - Intergenic
959300108 3:104588124-104588146 ATGGAAGGACAGATAGTTAAGGG + Intergenic
960057229 3:113284312-113284334 CTGGAAGGACAGAAAAATAAAGG - Intronic
960192166 3:114719582-114719604 ATTGATGGACAGTTAGATAAAGG - Intronic
960248151 3:115422374-115422396 CAGGATGGACAGAAGGGCAAAGG + Intergenic
961842162 3:129723841-129723863 CTGGTTGAATAGACAGACAAAGG - Intronic
962410100 3:135133413-135133435 ATGGATGGACAGATGGACAGAGG + Intronic
962959452 3:140296974-140296996 GTGGATGGTCAGACAGACAGAGG + Intronic
964706114 3:159620464-159620486 CTGGATAAAGAAATAGACAATGG + Intronic
966916943 3:184590033-184590055 ATGGATGAATGGATAGACAATGG + Intronic
967283300 3:187843535-187843557 CTAGAAGGACAGATAGAAATAGG - Intergenic
967340308 3:188389922-188389944 CTGGATGAACAGAAATGCAAAGG - Intronic
968928105 4:3560607-3560629 GTGGATGGACAGATGGGGAATGG - Intergenic
969471313 4:7391025-7391047 GTGGATGGACACAAAGACATGGG + Intronic
969571570 4:8012025-8012047 ATGAATGGACAGATAGTTAAAGG - Intronic
971390132 4:26177996-26178018 TTGGATGGATAGATTGAAAATGG + Intronic
971465638 4:26956976-26956998 CTGTATGGACAGATATACAGTGG + Intronic
973020218 4:45195626-45195648 CAGGATTAACACATAGACAAAGG - Intergenic
973577475 4:52304977-52304999 CTGGCTGGATAGGTAGATAAAGG + Intergenic
974350735 4:60742827-60742849 CAGGACAGAGAGATAGACAAAGG + Intergenic
975749151 4:77505152-77505174 CCAGATATACAGATAGACAAAGG - Intergenic
978265199 4:106815602-106815624 GTGGATGGACAGAAAGATAAAGG + Intergenic
980420619 4:132555319-132555341 ATAGATAGACAGATAGATAATGG - Intergenic
982091652 4:151884774-151884796 CAGGATGGCCAGGCAGACAAGGG + Intergenic
982173460 4:152683404-152683426 CTGGATGTACAAATGGACAGTGG - Intergenic
983770249 4:171540055-171540077 ATGGATGGATAGATAGGTAATGG - Intergenic
983770273 4:171540217-171540239 ATAGATGGACAGATAGATGAGGG - Intergenic
983794107 4:171838501-171838523 CTGGATGGAGAGAGAGTGAAGGG - Intronic
985709249 5:1419062-1419084 TAGGATGGACAGATGGATAATGG - Intronic
986815390 5:11404338-11404360 CTGGAGGGCCAGATCGATAATGG - Intronic
990358285 5:54992716-54992738 ATAGATAGACAGACAGACAATGG + Intronic
991166761 5:63571846-63571868 CTGTATTGACAAATACACAAAGG - Intergenic
991573322 5:68077885-68077907 TTGGATGGCCAGCTGGACAATGG + Intergenic
992250830 5:74874469-74874491 CAGCATGGTCAGAGAGACAAGGG + Intergenic
993530782 5:89022572-89022594 ATGGATTGAAAGAGAGACAATGG + Intergenic
995836545 5:116405478-116405500 CTGGTTGGACAGATTCCCAATGG + Intronic
997610118 5:135209915-135209937 CTGGTGGGACAGACAGAGAATGG - Intronic
999378955 5:151106588-151106610 CAGGAAGGACAGAGAGACACAGG - Intronic
999692429 5:154159928-154159950 CTGGAAGGACAGAGAGATAGTGG - Intronic
1001835949 5:174832658-174832680 CAGGCTGGAGAGAGAGACAAGGG - Intergenic
1003224122 6:4189389-4189411 CTGGAAGGACAGAGAGAAACGGG + Intergenic
1006228787 6:32564302-32564324 CTGGAAAAACAGATAGAAAAGGG - Intronic
1007667641 6:43524846-43524868 CTGGAAGGCCAGATGGACCAGGG + Exonic
1008475212 6:51928858-51928880 CAGGATGGAGAGAAAGACAATGG - Intronic
1009694485 6:67083544-67083566 GTGGATGGAAAGGAAGACAAGGG + Intergenic
1009994342 6:70881843-70881865 TTGGATGGACAGACAGACAGAGG - Intronic
1011301675 6:85881404-85881426 CTTGATGGACTGGTAGAGAAAGG - Intergenic
1013462636 6:110389963-110389985 CTGAATGTACAAATGGACAATGG - Intergenic
1015769023 6:136750058-136750080 CTGGAAGGACAGAAGGCCAATGG - Intronic
1016964986 6:149710499-149710521 CTGAATATACAGATGGACAATGG - Intronic
1019076735 6:169394005-169394027 ATGGATGGACAGGTACACAGTGG - Intergenic
1019345554 7:528402-528424 ATGGATGGATGGATAGATAATGG + Intergenic
1019345591 7:528686-528708 ATGAATGGATGGATAGACAATGG + Intergenic
1019704869 7:2492764-2492786 GTGGATGGATAGATGGACAGAGG - Intergenic
1019845310 7:3493298-3493320 CTGAATGGACAGTTAGATGAAGG - Intronic
1020452322 7:8334463-8334485 TTGGAGGGAGAGAAAGACAAGGG + Intergenic
1020521938 7:9201353-9201375 ATGGATGGATAGATAGAGAGAGG + Intergenic
1020644566 7:10799045-10799067 CAGGATGGCCAGAATGACAAGGG + Intergenic
1022533347 7:31080660-31080682 CTGGATGGACAGAAAGACAGCGG - Intronic
1023347375 7:39285293-39285315 CATGATGCACAGATTGACAAAGG + Intronic
1023971584 7:44995207-44995229 CTGAATATACAAATAGACAATGG + Intergenic
1025956746 7:66189034-66189056 CTAGATGGACAGGTAGAGGATGG - Intergenic
1026281900 7:68929479-68929501 CTGTATAGATTGATAGACAAGGG + Intergenic
1026581410 7:71621579-71621601 ATGGATGGATGGACAGACAATGG + Intronic
1026696941 7:72603305-72603327 ATGGATGGACAGATAGATGATGG + Intronic
1026782463 7:73278453-73278475 ATGGATGGATAGATAGATAAGGG - Intergenic
1027251258 7:76400244-76400266 CTGGAGGGACAGACAGACTGTGG - Intronic
1028778008 7:94702525-94702547 CTGGCTGGAGCGAGAGACAAAGG - Intergenic
1030244211 7:107363159-107363181 CTGGAAAGTCAGAGAGACAATGG + Intronic
1031164887 7:118216072-118216094 GTGAATGTACAAATAGACAATGG + Intronic
1033588277 7:142790227-142790249 TAGGATGGAGACATAGACAAGGG + Intergenic
1035068612 7:156125068-156125090 CTGCATGGACAGAAACACCACGG + Intergenic
1035291978 7:157845051-157845073 CTTGGTGTAGAGATAGACAAAGG + Intronic
1035421219 7:158730205-158730227 ATGGACAGACAGATGGACAAAGG + Intergenic
1035647963 8:1242908-1242930 ATGGATGGACAGATAGACAGTGG + Intergenic
1037156388 8:15704678-15704700 TTGGATGTACAGACAGACACAGG - Intronic
1037280441 8:17235640-17235662 TTGGAAGGAAAGGTAGACAAGGG - Intronic
1038843867 8:31211044-31211066 CTGAATGTACAAATAGACAATGG + Intergenic
1038958642 8:32494792-32494814 CTGGATGCACAGACACAAAAGGG - Intronic
1039645891 8:39282450-39282472 CTAGATTGAGGGATAGACAAGGG + Intronic
1040584392 8:48726256-48726278 ATGGATGGATAGATAGATGATGG - Intronic
1040835460 8:51725783-51725805 CTGCAAGGACAGATAGTAAATGG + Intronic
1041691141 8:60688543-60688565 CTGGTTGCACTGATGGACAAAGG - Intronic
1042320146 8:67467360-67467382 ATGGAGGGGAAGATAGACAATGG - Intronic
1042659063 8:71133791-71133813 CAGGTTGGACAGATAGATAGAGG - Intergenic
1043108648 8:76149557-76149579 CTGGCTGTACTGATAGGCAATGG - Intergenic
1043730936 8:83680508-83680530 CTGTATGAACAGAAAGAAAAAGG + Intergenic
1045363521 8:101454480-101454502 GGGGATGCATAGATAGACAATGG - Intergenic
1045471647 8:102518072-102518094 CTGGAGGGAAATATACACAAGGG - Intergenic
1045628598 8:104087387-104087409 ATGGATGGATGGATGGACAAGGG + Intronic
1047805493 8:128355312-128355334 GTGGAGGGAGAAATAGACAAAGG - Intergenic
1047855532 8:128905849-128905871 CTTGATTGACAGCTAAACAAAGG + Intergenic
1048278978 8:133090753-133090775 CTGGAAGCTCAGAAAGACAAAGG + Intronic
1048642268 8:136377042-136377064 GTGGATGGTCAGATAGAAGAAGG + Intergenic
1048894256 8:138975278-138975300 CTGAATACACAGATGGACAATGG - Intergenic
1049350585 8:142162409-142162431 GTGGATGGATAGATGGACAGAGG + Intergenic
1049364272 8:142229175-142229197 ATGGATGGACAGATGGTGAATGG + Intronic
1049447831 8:142639513-142639535 ATGGGTGGACAGACAGACAGGGG + Intergenic
1049632688 8:143667101-143667123 TTGGATGCACAGAGAGACATGGG - Intergenic
1049833131 8:144714586-144714608 ATGGATGAACAGATACAGAATGG - Intergenic
1050688545 9:8199360-8199382 CTGGATAGACATATACACCATGG - Intergenic
1051014454 9:12458720-12458742 CTGAATATACAAATAGACAATGG + Intergenic
1052692300 9:31830740-31830762 GTGTATGGAATGATAGACAATGG + Intergenic
1052901919 9:33800655-33800677 CACGATGGACAGATACACACGGG + Intergenic
1053476031 9:38382516-38382538 CCGTGTGAACAGATAGACAACGG + Intergenic
1054740599 9:68802448-68802470 ATGGATGGATGGATAGACAGAGG + Intronic
1055490581 9:76800735-76800757 CTGGATGGATAGAGAAGCAAGGG + Intronic
1056288709 9:85118726-85118748 TTGCAGGGACAAATAGACAAGGG + Intergenic
1056470051 9:86896954-86896976 GTGGCTGGAGAGATAGGCAAGGG - Intergenic
1056961167 9:91125150-91125172 CTGGGTGGGCAGTTTGACAAGGG - Intergenic
1057273182 9:93662139-93662161 ATGGATGGATGGATAGACAGAGG + Intronic
1057401078 9:94724191-94724213 CTGAATGGAAAGATAGACTTGGG + Intergenic
1057706536 9:97398995-97399017 CTGGAGGGGGAGATGGACAAAGG - Intergenic
1059304922 9:113346668-113346690 CTTGATGAACAGATAGGGAAAGG + Intergenic
1059305718 9:113351557-113351579 CTGGGTGGAAAGATTTACAAGGG + Intronic
1059409081 9:114120791-114120813 CTGGCTGGATAGATAGATGATGG + Intergenic
1060985698 9:127817874-127817896 ATGGATGGATAGATGGACAGTGG + Intronic
1061749022 9:132762617-132762639 CTGGATAGCCACATAGAAAACGG + Intronic
1185874552 X:3691882-3691904 ATGGATGGATGGATGGACAATGG + Intronic
1189560002 X:42182785-42182807 CTTTATGGGCACATAGACAAGGG + Intergenic
1190219072 X:48499355-48499377 ATGGATGGACAGATGGACAGTGG + Intergenic
1193923059 X:87453226-87453248 CAGCATGGAGAGAGAGACAAGGG + Intergenic
1194752152 X:97697182-97697204 ATGGATGGGGAGCTAGACAAGGG - Intergenic
1196462103 X:115942326-115942348 CTGGATGCACAGAGAGAAATGGG + Intergenic
1196981258 X:121216079-121216101 AAGGATAGACAAATAGACAAAGG - Intergenic
1199754255 X:150849721-150849743 CAGGATGTACTGATATACAAGGG - Intronic
1200131247 X:153848017-153848039 CAGTATGGATAGATAAACAAAGG - Intergenic
1201073342 Y:10169509-10169531 CGGGATGGAGAGATAGAAATGGG - Intergenic
1201404345 Y:13634956-13634978 CAGGAGGGATAGATAGGCAAAGG - Intergenic
1201644131 Y:16208846-16208868 TTGGATGGATGGATAGACAGTGG + Intergenic
1201658684 Y:16376475-16376497 TTGGATGGATGGATAGACAGTGG - Intergenic