ID: 1167286239

View in Genome Browser
Species Human (GRCh38)
Location 19:48600172-48600194
Sequence CAGCTCTAGCAGCTCTAGCT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167286230_1167286239 22 Left 1167286230 19:48600127-48600149 CCTGAACACAGTGTGCCTGGCAG No data
Right 1167286239 19:48600172-48600194 CAGCTCTAGCAGCTCTAGCTCGG No data
1167286231_1167286239 7 Left 1167286231 19:48600142-48600164 CCTGGCAGCGACTCCCCATCTTC No data
Right 1167286239 19:48600172-48600194 CAGCTCTAGCAGCTCTAGCTCGG No data
1167286228_1167286239 30 Left 1167286228 19:48600119-48600141 CCACAGCTCCTGAACACAGTGTG No data
Right 1167286239 19:48600172-48600194 CAGCTCTAGCAGCTCTAGCTCGG No data
1167286233_1167286239 -7 Left 1167286233 19:48600156-48600178 CCCATCTTCCCCTCCACAGCTCT No data
Right 1167286239 19:48600172-48600194 CAGCTCTAGCAGCTCTAGCTCGG No data
1167286234_1167286239 -8 Left 1167286234 19:48600157-48600179 CCATCTTCCCCTCCACAGCTCTA No data
Right 1167286239 19:48600172-48600194 CAGCTCTAGCAGCTCTAGCTCGG No data
1167286232_1167286239 -6 Left 1167286232 19:48600155-48600177 CCCCATCTTCCCCTCCACAGCTC No data
Right 1167286239 19:48600172-48600194 CAGCTCTAGCAGCTCTAGCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167286239 Original CRISPR CAGCTCTAGCAGCTCTAGCT CGG Intergenic
No off target data available for this crispr