ID: 1167287010

View in Genome Browser
Species Human (GRCh38)
Location 19:48603910-48603932
Sequence AGCTGGGGGTCGGGGAGTAG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 770
Summary {0: 1, 1: 0, 2: 8, 3: 64, 4: 697}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167286998_1167287010 13 Left 1167286998 19:48603874-48603896 CCAGGCCTCGGTGCAGGCGTGCG 0: 1
1: 0
2: 1
3: 12
4: 189
Right 1167287010 19:48603910-48603932 AGCTGGGGGTCGGGGAGTAGGGG 0: 1
1: 0
2: 8
3: 64
4: 697
1167286995_1167287010 29 Left 1167286995 19:48603858-48603880 CCAGTCAGCAGGGTCACCAGGCC 0: 1
1: 0
2: 2
3: 27
4: 202
Right 1167287010 19:48603910-48603932 AGCTGGGGGTCGGGGAGTAGGGG 0: 1
1: 0
2: 8
3: 64
4: 697
1167286999_1167287010 8 Left 1167286999 19:48603879-48603901 CCTCGGTGCAGGCGTGCGTCACT 0: 1
1: 0
2: 0
3: 4
4: 57
Right 1167287010 19:48603910-48603932 AGCTGGGGGTCGGGGAGTAGGGG 0: 1
1: 0
2: 8
3: 64
4: 697

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167287010 Original CRISPR AGCTGGGGGTCGGGGAGTAG GGG Exonic
900187154 1:1337864-1337886 AGCTGGGGGTGGAGCAGCAGCGG + Intronic
900206880 1:1435398-1435420 GGCTGGGGGTCGGAGAGGGGTGG + Intronic
900288426 1:1913304-1913326 GGCTGGGGGGCGGGGGGTGGTGG + Intergenic
900460828 1:2801458-2801480 AGCTTGGGGACAGGGAATAGGGG - Intronic
900478556 1:2887447-2887469 AGGTGGGGGTGGGGAAGAAGAGG + Intergenic
900497152 1:2980921-2980943 AGCTGGGGGTGGGGGCGGGGGGG + Intergenic
900521281 1:3106567-3106589 AGGTGGGGCTTGGGGAGTTGTGG + Intronic
900661074 1:3784034-3784056 AGCTGGAGGCCGAGGAGCAGAGG - Exonic
900970808 1:5991770-5991792 AGCCGGGGGGCGGGGAGGAGGGG + Intronic
901020442 1:6252552-6252574 TGCTGGGGGTGGGGCAGTGGGGG + Intronic
901208865 1:7513172-7513194 AGCTGTGGGGTGGGGAGAAGCGG + Intronic
901292455 1:8134799-8134821 AGTTGGTGGTCGGGGAGAAGTGG + Intergenic
901377490 1:8849589-8849611 AGCTGGGGGTGGGTGTGTACTGG + Intergenic
901441380 1:9280432-9280454 AGCGGCGGGGCGGGGAGTGGGGG - Intergenic
901766096 1:11501141-11501163 AGCTGGGGGTCGGGAAGCCAGGG - Exonic
901872837 1:12148207-12148229 AACTGAGGCTCGGGGAGTGGGGG + Intergenic
901876443 1:12169455-12169477 AGCTGGGGGCCGGGGAGCTGGGG + Intronic
902092684 1:13916006-13916028 GGTTGGGGGCCGGGGAGTGGGGG + Intergenic
902598061 1:17522477-17522499 AGCCAGGGGTCGGGGGGTTGGGG - Intergenic
902764726 1:18606755-18606777 AGCTGGAGTTCCGGGAGTTGGGG - Intergenic
902798651 1:18815870-18815892 GGCTGGGGGTGGGGGACTGGCGG - Intergenic
903136634 1:21313556-21313578 AGGTGGGAGTGGGGGAGCAGGGG + Intronic
903172459 1:21562769-21562791 AGCAAGGGGTTGGGGAGCAGGGG - Intronic
903374935 1:22859926-22859948 GGCTGGGGATAGGGGAGCAGGGG - Intronic
903572751 1:24318570-24318592 GGCAGGGGGTGGGGGAGTAAAGG - Intergenic
904054141 1:27659249-27659271 AGCTGGGGGGTGGGGAGCATGGG + Intergenic
904771306 1:32882738-32882760 AGGTGGGGGATGGGGGGTAGGGG + Intergenic
904927110 1:34057907-34057929 AGCTGGGGGTTGGGGTGAGGAGG + Intronic
904942829 1:34177102-34177124 TGCTGGGGGCCGGGGACTAAGGG + Intronic
904970409 1:34414922-34414944 AGCTGTGGGTCTTGGAGAAGAGG + Intergenic
905612764 1:39369123-39369145 AGCAGGGGGTCTGGGCATAGTGG - Intronic
905882619 1:41474648-41474670 AACTGGGGGACGGGGACTCGGGG - Intergenic
906062807 1:42959199-42959221 AGCTGGGATGCGCGGAGTAGCGG + Intergenic
906197379 1:43937272-43937294 AGCAGGGGGTTGGGAAGAAGAGG + Intergenic
906460914 1:46034715-46034737 TGTTGGGGGTGGGGGAGAAGGGG - Exonic
906501551 1:46344730-46344752 AGGTGGGGGTCAGGTAGTAGGGG + Intronic
906607510 1:47182293-47182315 GCCTGTGGGTCGGGGAGCAGCGG - Intergenic
906836944 1:49094217-49094239 TGGTGGGGGTAGGGGAGTGGGGG - Intronic
906862636 1:49378239-49378261 GGATGGGGGTTGGGGAGTACAGG + Intronic
907328899 1:53658760-53658782 AGCAGGAGGTAGGGGTGTAGAGG + Intronic
908148057 1:61268397-61268419 GGGTGGGGGCAGGGGAGTAGAGG - Intronic
908695254 1:66832525-66832547 AGTTGGGGGTAGGGCAGTGGTGG + Intronic
910013557 1:82494731-82494753 AGCTGGGAGTAGGGAAGAAGAGG - Intergenic
910661555 1:89679122-89679144 ACAAGGGGGTCGGGGAGAAGAGG + Intronic
911001751 1:93173040-93173062 AGCTGGGGGTGGGGGACTTGGGG + Intronic
912260763 1:108109927-108109949 TGCTGGTGGTGGGGGAGGAGGGG - Intergenic
912381543 1:109250375-109250397 AGCTGGTGGTAGGGGAATATGGG - Exonic
912454613 1:109789188-109789210 TGGTGGGGGCCGGGGAGCAGAGG - Intergenic
912811041 1:112794786-112794808 AGCTGGGGGTAGTGGGGTGGAGG - Intergenic
912955027 1:114149355-114149377 GGCTGGGGGGAGGGGAGCAGAGG + Intronic
913657096 1:120971637-120971659 AGGTGGGGGTGGGGTGGTAGGGG + Intergenic
913689790 1:121268365-121268387 AGCTGGGGGCCAGTGAGTAAGGG + Intronic
914147809 1:145011907-145011929 AGCTGGGGGCCAGTGAGTAAGGG - Intronic
914443568 1:147728994-147729016 GGGCGGGGGTTGGGGAGTAGGGG - Intergenic
914521659 1:148422891-148422913 AGGTGGGGGTGGGGTGGTAGGGG + Intergenic
914794323 1:150907328-150907350 AGCTGGAGGTGGGGGATGAGGGG - Intergenic
914847064 1:151289230-151289252 AGCTGGGATGCTGGGAGTAGAGG - Exonic
914999223 1:152572928-152572950 AGATGGGGGTCGGGGAGGTAGGG + Intronic
915274630 1:154779689-154779711 AGCAGGGAGTCTGGGAGCAGTGG + Intronic
915476859 1:156158135-156158157 AAGTGGAGGTGGGGGAGTAGGGG + Intronic
915597004 1:156901681-156901703 AGCTGAGGGTCAGGGAAGAGGGG + Intronic
915903412 1:159862128-159862150 AGCTGGAGGTGGGGTAGGAGAGG - Intronic
915951030 1:160190196-160190218 AGCTGGGGCTGGGGGAGGGGAGG - Intergenic
917216820 1:172687620-172687642 AGGTGGGAGTAGTGGAGTAGAGG + Intergenic
918667903 1:187175002-187175024 AGTTGGGGGTGGGGGAGTTTAGG + Intergenic
920379298 1:205526533-205526555 AGCTGAGGGAGTGGGAGTAGTGG + Intronic
920477111 1:206286842-206286864 AGCTGGGGGCCAGTGAGTAAGGG + Intronic
920667158 1:207971552-207971574 AGGTGGGTTTGGGGGAGTAGGGG - Intergenic
920696265 1:208183386-208183408 AGCAGGGGATGGGGGAGTAGAGG + Intronic
920899645 1:210094782-210094804 GGCTTGGGGTTGGGGAGTGGGGG - Intronic
920967454 1:210712907-210712929 TGCTGGGGTTGGGGGACTAGGGG - Intronic
921218718 1:212958296-212958318 AGCTGGGGGCAGGGCAGTGGCGG - Intronic
922862863 1:228834306-228834328 GGCTGGGGTTTGGGGAGGAGAGG - Intergenic
923051751 1:230394997-230395019 AGCTCGGGGATGGGGAGGAGTGG - Intronic
923126890 1:231040652-231040674 AGCTGGGGTTCGGGGTGGCGCGG - Intergenic
923554843 1:234992468-234992490 AGTTGGGGGGCAGGGATTAGAGG + Intergenic
924232381 1:241972916-241972938 AGCTGGGGCTGGGGGTGGAGGGG + Intergenic
924648640 1:245903614-245903636 TGCTGGGGGTCAGGGAGAGGTGG - Intronic
1063074260 10:2699428-2699450 GGCTGGGGGCAGGGGAGCAGGGG + Intergenic
1063096706 10:2915239-2915261 AGGTGGGAGTAGAGGAGTAGAGG - Intergenic
1063580270 10:7300161-7300183 TGCTGGGGGATGGGGAGTGGAGG + Intronic
1063629066 10:7717412-7717434 AGCTGGAGATCGGGTAGGAGAGG + Intronic
1063814000 10:9750175-9750197 GGCGGGGGGTGGGGGAGTGGTGG + Intergenic
1064983283 10:21185366-21185388 TCCTGGGGGTCAGGGAGTAGAGG + Intergenic
1065287992 10:24203549-24203571 AGGTGGGGGTTGGGGGGTAGGGG - Intronic
1065421941 10:25554741-25554763 AGTTGGGGTTCGGGGTGAAGTGG + Intronic
1065584289 10:27202688-27202710 AGTTGGGAGTTGGAGAGTAGAGG - Intronic
1067059069 10:43068549-43068571 AGCAGGGGGTGGGGGATCAGGGG - Intergenic
1068241588 10:54308778-54308800 GTCTGGGGGTCGGGGAATAGGGG - Intronic
1068246495 10:54378000-54378022 AGCTTGGGGTTGGGGAGTGGAGG - Intronic
1068681263 10:59822942-59822964 AGCTGGAGGTTGGAGAGAAGCGG + Intronic
1068859520 10:61833128-61833150 ATCTGGGGGACGGGGAGAATGGG - Intergenic
1068889513 10:62134197-62134219 ATCGGGGGGTGGGGGACTAGGGG - Intergenic
1069034019 10:63629812-63629834 AGTTGGGGGAGGGGGAGAAGTGG - Intergenic
1069588892 10:69630109-69630131 TGCTGGGGGTCGGGGAGATGGGG - Intergenic
1069698426 10:70404623-70404645 AGCTGGGGGCGGGGGCGAAGCGG - Intronic
1069767877 10:70877100-70877122 AGCTAGGACTCGGGGAGAAGGGG + Intronic
1069888343 10:71637834-71637856 TGTTTGGGGTCGGGGGGTAGGGG - Intronic
1070756440 10:78996526-78996548 CGCTGGGGGTGGGGGCGGAGGGG - Intergenic
1070771556 10:79085328-79085350 AGCTGGGGGTGGGGGTCAAGGGG + Intronic
1071819516 10:89265207-89265229 TGCAGGGGGTTGGGGAGTGGGGG + Intronic
1072667305 10:97403101-97403123 GGCCGGGGGGCAGGGAGTAGAGG + Intronic
1072677923 10:97482512-97482534 TGCTGGGGGTTGGGAAGAAGAGG + Intronic
1073241841 10:102064394-102064416 AGGTAGGGGCCGGGGAGGAGAGG + Intergenic
1074637433 10:115336975-115336997 AGCTGGGGGGGGGGGACTACAGG + Intronic
1074756425 10:116627487-116627509 AGCTGGGGGTGGGGCAGTCCCGG + Intronic
1075031912 10:119029658-119029680 GGCCGGGGGGCGGGGAGGAGTGG + Intergenic
1075185915 10:120257007-120257029 TGTTGGGGGTCGGGGAAAAGGGG - Intergenic
1075811735 10:125229076-125229098 AGCTGGGGGTTGGACTGTAGAGG - Intergenic
1076379575 10:130015796-130015818 GGCTGGGGATTGGGGAGCAGGGG + Intergenic
1076871188 10:133195889-133195911 AGCTGGGGGTGGAGGAGCACGGG + Intronic
1076996871 11:301660-301682 AGCTGGGGGTGGGGGGGGTGGGG + Intergenic
1077123223 11:920492-920514 GGTTGGGGGACGGGGAGCAGGGG - Intergenic
1077191656 11:1258241-1258263 TGCTGGGGGTGGGGGAGTGCAGG + Intronic
1077333076 11:1991805-1991827 AGCTCGGGGTCGGGGAGAGGGGG + Intergenic
1077419123 11:2441392-2441414 GGCTGAGGGTGGGGGAGTAAGGG - Intergenic
1077449369 11:2627456-2627478 TACTAGGGGTCAGGGAGTAGGGG - Intronic
1077919451 11:6631879-6631901 AGCTGGTGTTTGGGGAGTGGGGG + Intronic
1078426236 11:11253478-11253500 AGAAGGGGGGCGGGGAGTGGAGG + Intergenic
1079399299 11:20092968-20092990 TGCAGGGGGTGGGGGGGTAGGGG - Intronic
1079486709 11:20942463-20942485 GGTTGGGAGTAGGGGAGTAGGGG + Intronic
1080230921 11:30017127-30017149 AGCCGGGGTGCGGGGAGTCGCGG - Intergenic
1081670382 11:44939062-44939084 TGCTGGCGGTGGGGGAGTGGGGG - Intronic
1081758450 11:45560762-45560784 AGCTGGGGGTCAGGGTGGACGGG - Intergenic
1081847707 11:46252607-46252629 AGCTGGGGCTGGGGCAGGAGAGG + Intergenic
1082171133 11:49007208-49007230 ATCTGGGGGTTGGGGGATAGGGG - Intergenic
1082795636 11:57376393-57376415 AGGTGGGGGGATGGGAGTAGGGG - Intergenic
1082795671 11:57376480-57376502 AGGTGGGGGGATGGGAGTAGGGG - Intergenic
1082972938 11:59042831-59042853 AGGTTGGGGTATGGGAGTAGGGG + Intronic
1082977342 11:59086401-59086423 AGGTTGGGGTATGGGAGTAGGGG + Intergenic
1083414259 11:62515096-62515118 ATGTGGGGGTGGGGGAGGAGTGG - Intronic
1083583370 11:63839276-63839298 AGCCGGGGGTCGGGGGGGTGCGG + Exonic
1083661054 11:64251923-64251945 AGCTGAGGGACTGGGAGTTGGGG - Intronic
1083901620 11:65646200-65646222 AGCTAGGGGTTGGATAGTAGGGG - Exonic
1084010425 11:66345328-66345350 AGCTGGGGGTGGGGGGATCGGGG - Intergenic
1084044319 11:66560081-66560103 GGCTGGGGGCCGGGGAGCTGGGG + Intronic
1084557314 11:69882827-69882849 AGCTGGGGCTCAGAGAGTGGAGG - Intergenic
1084595081 11:70112062-70112084 AGCTGGGGGTAGGGGAGCCCAGG - Intronic
1084859945 11:72011788-72011810 AGATGGGGGCGGGGGAGTGGGGG - Intronic
1084891957 11:72241013-72241035 ACCTGGGGGTAGGGGAATACAGG - Intronic
1084908637 11:72369411-72369433 GGATGGGGGTGGGGGAGGAGGGG - Intronic
1084935734 11:72585617-72585639 ATAGGGGGGTCGGGGTGTAGGGG + Intronic
1084973880 11:72785881-72785903 AGGAGGGGGTGGGGGAGAAGGGG - Intronic
1085832116 11:79912479-79912501 TGTTGGGGGTCGGGGATAAGGGG - Intergenic
1085870382 11:80342534-80342556 AGCTGTGGGACGGGAAGAAGAGG - Intergenic
1086014075 11:82143179-82143201 AGCCGGGGGGAGGGGAGGAGAGG + Intergenic
1086096598 11:83056175-83056197 AGCTGGGGGCAGGAGAGAAGTGG - Intronic
1086293253 11:85335791-85335813 ATCAGGGGGTGGGGGACTAGGGG + Intronic
1086579490 11:88382023-88382045 AGCAGGGGGACAGGGAGTTGTGG + Intergenic
1086694769 11:89829881-89829903 ATCTGGGGGTTGGGGGATAGGGG + Intergenic
1086711379 11:90014616-90014638 ATCTGGGGGTTGGGGGATAGGGG - Intergenic
1087014462 11:93542736-93542758 GCCTGGGGGTCGGGGAGTAGAGG - Intronic
1088939213 11:114436662-114436684 GGATGGGGGTGGGGGAGTAATGG + Intronic
1089194287 11:116684059-116684081 AGGTGGGGGTGGGGGTGGAGGGG - Intergenic
1089534850 11:119154640-119154662 AGCTGGGAGTGGGAGAGTGGTGG + Intronic
1089722142 11:120435801-120435823 AGCTTGGGGGCCGGGAGTGGTGG - Intronic
1090136498 11:124204484-124204506 TGCTGGGGGTGGGGGAGGAGTGG + Intergenic
1090184085 11:124725024-124725046 AGCTGGGGAGAGGGGAGGAGAGG - Intergenic
1090394104 11:126407697-126407719 AGCGGGGGGGTGGGGAGTGGGGG - Intronic
1090434493 11:126675549-126675571 AGCTGGGGATCTGGGGGTGGTGG + Intronic
1090639231 11:128716361-128716383 AGCTGGGGGTGGGGGTGCTGTGG + Intronic
1090734980 11:129604713-129604735 GGTTGGGGGTTGGGGAGTATAGG - Intergenic
1202816059 11_KI270721v1_random:46983-47005 AGCTCGGGGTCGGGGAGAGGGGG + Intergenic
1091443705 12:530994-531016 AGCTGGTGCTCTGGGAGAAGAGG + Intronic
1091968187 12:4763546-4763568 AGATGGGGATCGGGGAGCAAGGG - Intronic
1092161716 12:6318724-6318746 AGCTGGGGGTGGGGGCGTAGGGG - Exonic
1092203282 12:6600443-6600465 AGATAGGGGTCGGGGGGTGGGGG - Intronic
1093942548 12:25070271-25070293 AGCTGGGGGTTGGGGACAGGAGG - Intronic
1095166067 12:38973608-38973630 AGATGGCAGTTGGGGAGTAGGGG - Intergenic
1096553640 12:52390228-52390250 GGGTGGGGGTCGGGGGGCAGGGG + Intergenic
1096560320 12:52431402-52431424 AGCTGGGGCTTGGGTGGTAGGGG - Intronic
1096606286 12:52768739-52768761 AGCTCGTGGTCTGGGAGAAGCGG + Exonic
1096717386 12:53499617-53499639 GGCTAGGGGTCGGGGGGTGGGGG - Intronic
1096795039 12:54071468-54071490 GGTGGGGGGTGGGGGAGTAGGGG + Intergenic
1097221134 12:57451822-57451844 ATCTGGGGGTCGGGGATGTGTGG - Intergenic
1097324795 12:58264273-58264295 GGGTGGGGGTCGGGGGGTGGAGG - Intergenic
1099404507 12:82244169-82244191 TGTTGGGGGTTGGGGACTAGAGG - Intronic
1100142374 12:91634216-91634238 GGGTGGGGGTAGGGGAGAAGAGG - Intergenic
1100964953 12:100002493-100002515 AGCTGGGGGTGGGGGATGACTGG - Intergenic
1101238504 12:102814128-102814150 GGCAGGGGGTTGGGGAGGAGAGG - Intergenic
1102032825 12:109752902-109752924 AGCTGTGGGTCCAGGAGTTGGGG + Intronic
1102763184 12:115407466-115407488 AGGTGGGGGTGGAGGAGAAGAGG + Intergenic
1102803776 12:115761320-115761342 AGCTGGGGGTGGAGGAGAAAAGG - Intergenic
1102840568 12:116116227-116116249 GGGTGGGGGTTGGGGAATAGGGG - Intronic
1103538892 12:121652615-121652637 GGCTTGGGGTCGGGGAGTGGGGG - Intronic
1104092850 12:125530330-125530352 AGTTGGGGGTCGGGGAGTGGAGG - Intronic
1105027451 12:132858435-132858457 AGCAGGGTGGCTGGGAGTAGTGG + Intronic
1105589958 13:21783228-21783250 AGCTGGGGGTAAGGGAGTGAGGG + Intergenic
1105971371 13:25431889-25431911 AGCTGGGAGACAGGGAGAAGGGG - Intronic
1106168679 13:27270852-27270874 AGCTGGGAGTGCGGGACTAGAGG - Exonic
1108327995 13:49353804-49353826 AGATGGGGATAGGGGAGGAGAGG - Intronic
1108575874 13:51790161-51790183 AGCTGGGGGTGGGGTAGTGGAGG - Intronic
1109875760 13:68402782-68402804 TGGTGGGAGTCGGGGAGTACAGG - Intergenic
1110136033 13:72068237-72068259 TGTTGGGGGTTGGGGACTAGTGG + Intergenic
1110197448 13:72806518-72806540 ATCAGGGGGTGGGGGACTAGGGG - Intronic
1111600591 13:90469314-90469336 ATCAGGGGGTGGGGGACTAGGGG - Intergenic
1111799782 13:92967523-92967545 AGCTGGGGGGCTGGGTGTGGTGG - Intergenic
1112124877 13:96454053-96454075 AGCTAGGGGTGGGGGAGTGGTGG - Intronic
1112343020 13:98567943-98567965 AGGGGGGGGGTGGGGAGTAGAGG + Intronic
1112568578 13:100572387-100572409 AGCTGGGGGACGGGGAAAATGGG + Intronic
1114522566 14:23348305-23348327 AGCTGGGGGCAGGGGGGAAGGGG + Exonic
1114704729 14:24713622-24713644 AGCTGCGGATGGGGGAGAAGTGG + Intergenic
1117905780 14:60584137-60584159 AGCCGGGGGGCGGAGGGTAGGGG + Intergenic
1118179626 14:63479288-63479310 TGCTGTGGGTGGGGGAGGAGGGG + Intronic
1118843108 14:69527343-69527365 AGCTGGGGGCCAGGGCCTAGAGG - Intronic
1119215068 14:72863290-72863312 AGCTTTGGGCCGGGGAGGAGAGG - Intronic
1119796563 14:77403415-77403437 AGATGGGGGTAAAGGAGTAGGGG - Intronic
1121078384 14:91088101-91088123 AGCTGGGAGCCAGGGAGAAGAGG + Intronic
1121309499 14:92928011-92928033 AGCTGGGGGGCTGGGCATAGAGG - Intronic
1121614144 14:95301595-95301617 ACCTGGGGATGAGGGAGTAGGGG - Intronic
1122505126 14:102227283-102227305 ACCTGTGGGTAGGGGAGTGGTGG - Intronic
1122564422 14:102642133-102642155 AGCTGGGGCACGAGGAGTAAAGG - Intronic
1122637683 14:103138085-103138107 AGCTGGGGGTGGGGGAGGGCAGG + Intergenic
1122828435 14:104383570-104383592 AGGTGGGGGCTGGGGAGGAGAGG - Intergenic
1122959348 14:105087460-105087482 GGCTGGGGGTTGGGGAGGCGCGG - Intergenic
1122975548 14:105169245-105169267 AGGTGGGGGGCGCGCAGTAGGGG - Intergenic
1123449622 15:20351662-20351684 GGCTGGGGGGCAGGGAGCAGAGG + Intergenic
1123450566 15:20357078-20357100 TGATGGGGGTGGGGGAGGAGGGG + Intergenic
1123454449 15:20407126-20407148 AGCTGGGATTCTGGGAGTGGTGG + Intergenic
1123843242 15:24270069-24270091 CGCTGGGGCTGGGGGAGTACAGG - Intergenic
1123851515 15:24362000-24362022 AGCTGGGGCACAGGGAGCAGTGG + Intergenic
1123858321 15:24436286-24436308 CGCTGGGGCTGGGGGAGTACAGG - Intergenic
1123862949 15:24486750-24486772 CGCTGGGGCTGGGGGAGTACAGG - Intergenic
1124158978 15:27252321-27252343 AGCCTGGGGTCTGGGAGCAGGGG - Intronic
1124720277 15:32105587-32105609 AGCTGGTGGTCAGATAGTAGAGG + Intronic
1124949142 15:34300456-34300478 GGCTAGGGGTAGGGGAGTAGGGG - Intronic
1126280559 15:46943067-46943089 AGCTAGGGTTTGGGTAGTAGAGG - Intergenic
1126517741 15:49554655-49554677 TGCTGGGGGTTGGGGAGGGGTGG + Intronic
1126995252 15:54435579-54435601 GGGTGGGGGTGGGGGACTAGGGG + Intronic
1127317818 15:57814561-57814583 ACCTGGGGGTCAGGGACTTGAGG + Intergenic
1128086324 15:64888998-64889020 ACCTGGGGGTCAGGGGGTGGGGG + Intronic
1129674304 15:77624273-77624295 AGCTGGGGGCCGGGGAGTGGGGG - Intronic
1129706238 15:77796096-77796118 AGCAGGTGGTCGGGGTGCAGTGG + Intronic
1129706338 15:77796657-77796679 AGATGGGGGTTGGGAAGTTGAGG - Intronic
1131211289 15:90498960-90498982 AGCTGGGCGTTGGGGCGTGGTGG - Intronic
1132214768 15:100054336-100054358 AGCTGGGGTTAGGGGTGGAGGGG + Intronic
1132411712 15:101583861-101583883 CGTTGGGGGTCGGGGACAAGGGG - Intergenic
1132519456 16:380809-380831 GGCTGGGGGCCGGGAAGTCGGGG + Intronic
1132847164 16:2005934-2005956 AGCTGGGGGTGGAGGAGCTGCGG + Intronic
1132888107 16:2191244-2191266 AGCTGAGGGCAGGGGAGTTGAGG + Intronic
1133532006 16:6663897-6663919 AGCTGGGGCTCAGGCAGCAGTGG + Intronic
1134072941 16:11272041-11272063 ATTTGTGGGTCTGGGAGTAGTGG + Intronic
1134240762 16:12504400-12504422 GGCTGGGGGTTGGGGAGAAATGG - Intronic
1134548375 16:15127438-15127460 GGCTGGGGACCGGGGAGTACTGG - Intronic
1135264401 16:21010327-21010349 AGCTGGGGTAGGGGGGGTAGGGG - Intronic
1135290142 16:21229410-21229432 AGCGGGGGGTGGGGAAGTGGGGG - Intergenic
1135842210 16:25887122-25887144 ACCTGGGGGTGGGGGAGAAAAGG + Intronic
1135926504 16:26698418-26698440 AGCTGGGGATGAGGGAGTAGTGG - Intergenic
1135995457 16:27244521-27244543 AGCTTGGTGTGGGGGAGTGGGGG - Intronic
1136097389 16:27966970-27966992 AGCTGGGGGCAGAGCAGTAGTGG - Intronic
1136279490 16:29199659-29199681 AGCGGGGAGTCGGGGTGTAGTGG - Intergenic
1136403040 16:30028839-30028861 GGCGGGGGGACGGGGAGGAGAGG - Intronic
1136418314 16:30116846-30116868 GGCTGGGGGCAGGGGAGCAGGGG - Intronic
1137063237 16:35811145-35811167 AGCTGGGTGGTGGGGAGTGGGGG - Intergenic
1137290196 16:47047188-47047210 AGCTGGGGCTGGAGTAGTAGAGG + Intergenic
1138363967 16:56457379-56457401 AGCTGGGGGGAGGAGAGAAGAGG + Intronic
1138529011 16:57624996-57625018 AGCTGGCCGGCTGGGAGTAGAGG + Intronic
1138542197 16:57695227-57695249 TGGTGGGGGTGGGGGAGTGGTGG - Intronic
1138785821 16:59844960-59844982 AGTTGGGTGGCGGGGAGTGGGGG + Intergenic
1138806887 16:60100557-60100579 ACCTGGGGATAGGGGAGAAGTGG + Intergenic
1139807995 16:69585846-69585868 AGCTGGGGGTTGGGGAGGAATGG + Intronic
1140057842 16:71541065-71541087 AACTGGGAGTCGGGGGGTGGAGG + Intronic
1140442281 16:74997626-74997648 GGCTGGGGGTGGGGGGGTGGGGG - Intronic
1140458194 16:75116591-75116613 AGGTGGGGAGCGGGGAGCAGGGG - Intronic
1140734787 16:77888682-77888704 CGCTGGCGGTACGGGAGTAGAGG - Intronic
1140870503 16:79102036-79102058 GGGTGGGGGGCAGGGAGTAGGGG + Intronic
1141124716 16:81392897-81392919 TGCTGGGGGTCGGGGGGAGGTGG - Intergenic
1141128102 16:81415662-81415684 ATCGGGGGGTCGGGGGCTAGGGG - Intergenic
1141474177 16:84261051-84261073 CGCTGGGGGTCCCGGAGTCGAGG - Intergenic
1141787275 16:86210006-86210028 AGCTGGGGGCTGGGGAGAGGTGG - Intergenic
1141973091 16:87495821-87495843 AGATGGGGGTAGGGGAGGGGTGG - Intergenic
1141978512 16:87534511-87534533 AGGTTGGGGTTGGGGAGCAGGGG + Intergenic
1142083881 16:88165760-88165782 AGCGGGGAGTCGGGGTGTAGTGG - Intergenic
1142154206 16:88525840-88525862 AGCTGGGGGCCGGGGTGCAATGG + Intronic
1142161377 16:88559328-88559350 GGCTGGGGGGAGGGGAGGAGAGG + Intergenic
1142259486 16:89036177-89036199 AGCTGGGGGCCTGGGGGTGGGGG - Intergenic
1142511794 17:400616-400638 TGGTGGGGGTTGGGGAGTCGGGG - Intergenic
1142614250 17:1125576-1125598 TGCTGGGAGGCGGGGAGGAGCGG + Intronic
1142688853 17:1592841-1592863 GGCTGGGGGTTGGGGAGCAGGGG + Intronic
1142690584 17:1604191-1604213 AGCTGGGCATCGTGGCGTAGTGG - Intronic
1142759418 17:2034518-2034540 AGCAGGGGATGGGGGAGCAGGGG - Intronic
1143107035 17:4535104-4535126 AGCTGGAGCTCGGGGAACAGGGG + Intronic
1143497023 17:7318216-7318238 GGGTGAGGGTGGGGGAGTAGGGG + Intronic
1143514389 17:7412085-7412107 AGATGGGGGTCGGGGGGAGGTGG - Intronic
1143598939 17:7931641-7931663 AGCTGGGGTTTGGAGAGGAGGGG + Intronic
1143642501 17:8207123-8207145 AGCTGGGGGTGAGGGAGCAGAGG + Intronic
1144524827 17:15980188-15980210 GGTTGGGGGGCGGGGAGTAGTGG + Intronic
1146766754 17:35529690-35529712 ATCTGGGGGTGGGGGGCTAGGGG + Intronic
1146794652 17:35772785-35772807 AGTTGGGGGTGGGGGAGCAGTGG + Intronic
1146905486 17:36615200-36615222 TGCTGTGGGCCGGGGAGGAGGGG + Intergenic
1147338546 17:39740702-39740724 AGCAGTGGGTTGGGGAGTTGGGG + Intronic
1147383913 17:40070955-40070977 AGATGGGGGATGGGGAGAAGGGG - Intronic
1147420383 17:40319522-40319544 AGCAGGGGGTGGGGGGGTCGGGG - Intronic
1147941415 17:44050984-44051006 AGCTGGGGGGCTGGACGTAGTGG + Intronic
1147944876 17:44075240-44075262 AGCTGGGGGTCGGGGTGGGGAGG + Intronic
1148104494 17:45112189-45112211 AGCTCGGGGTCGGGGCCAAGTGG + Exonic
1148152235 17:45403712-45403734 AGGTGGGGGTGGGGAAGTGGGGG + Intronic
1148209551 17:45799989-45800011 AGCTGGAGGTCGGGGCAGAGTGG - Intronic
1148218662 17:45847701-45847723 AGCTGGGGGAGGGGGAGGGGTGG + Intergenic
1148427346 17:47610667-47610689 AGCCGGGGGTCTGGGTGTGGTGG - Intronic
1148684173 17:49491457-49491479 AGCTTGGGGGTGGGGGGTAGGGG + Intergenic
1148787033 17:50150538-50150560 AGCGGGGGAGCGGGGAGCAGGGG - Exonic
1149596993 17:57870096-57870118 AGTTGGGGGTGGAGGAGCAGAGG - Intronic
1149655373 17:58307016-58307038 TGCTGGGGTTCGGGGCCTAGGGG - Intronic
1150042085 17:61874007-61874029 AGATGGGGGTCAGGGAGTCAAGG - Intronic
1150631152 17:66881397-66881419 AGCTGGGGGATGGGGGGTAAAGG - Intronic
1150802467 17:68292340-68292362 ACCTTGGGGTCGGGGACTACGGG - Intronic
1151116471 17:71740968-71740990 AGCTGGGGGAAGGGGAGAGGGGG - Intergenic
1151259850 17:72907874-72907896 AGCGGGGCGTAGGGGAGAAGTGG + Intronic
1151451341 17:74200135-74200157 GGCAGGGGGTCGGGGAGAAGAGG - Intergenic
1151558304 17:74858347-74858369 GGTTGGGGGTCGGGGGGTGGGGG + Intronic
1151627841 17:75288727-75288749 GGGTGGGGGTGGGGGAGGAGGGG + Intronic
1151676618 17:75602045-75602067 AACTGGGGGTGGGGGAGCGGGGG + Intergenic
1151843165 17:76632155-76632177 GGCTGGGGGTTGGGAAGTGGAGG - Intronic
1151947020 17:77325397-77325419 CGCTGGGTGGCGGGGAGGAGTGG + Intronic
1151964396 17:77423806-77423828 AGGTGGGGGTTGCAGAGTAGGGG + Intronic
1152134065 17:78493860-78493882 AGCTGGGGGCCGAGGAGGAGGGG - Intronic
1152337872 17:79708256-79708278 TGATGGGGGTGGGGGAGGAGGGG - Intergenic
1152908380 17:82982931-82982953 AGCTGGGGGTGGAGGAGATGGGG + Intronic
1153192962 18:2562760-2562782 AGCTGGGGGACGGGGGGATGGGG + Intronic
1153701805 18:7701847-7701869 GTCAGGGGGTTGGGGAGTAGGGG - Intronic
1155215493 18:23639897-23639919 GGCTGGGGGAAGGGGAGTATGGG + Intronic
1155502771 18:26503841-26503863 AGCTGGGGGTGGGGGTGGGGTGG + Intronic
1157124024 18:44938062-44938084 AGCAGGGAGTGGGGGAGCAGGGG + Intronic
1157516692 18:48316347-48316369 GGCTGGGGGTGGAGGAGGAGTGG - Intronic
1157584318 18:48791483-48791505 AGCTTGGGGGCTGGGGGTAGAGG - Intronic
1157827142 18:50822695-50822717 AGCTGGGGGGCGGGGGGCGGGGG - Intronic
1158287854 18:55904711-55904733 AGCTGGGGGGCGGGGGGGAAAGG - Intergenic
1158528588 18:58237210-58237232 AAGTGGGGGGCGGGGAATAGAGG - Intronic
1158902626 18:61980291-61980313 AGCTGGGGGTGGTGGGGTTGGGG - Intergenic
1158922312 18:62206802-62206824 AGCTGCGGGGCGGGGAGAGGGGG - Intronic
1160223735 18:76996693-76996715 AGCTGGGGGGCAGGGAGTGGAGG + Intronic
1160449553 18:78952978-78953000 AGCTAGGGGCCGGGGAGTACTGG + Intergenic
1160768718 19:821188-821210 GGCTGGGGGTCGGGGGCTGGGGG - Intronic
1160769164 19:822474-822496 AGCTGGGGGAGGGGGACTGGGGG + Intergenic
1160951128 19:1667846-1667868 AGCTGGGGCTCTGGCAGTGGGGG + Intergenic
1161171316 19:2813730-2813752 GGCGGGGGGTGGGGGAGTAAAGG + Exonic
1161230421 19:3172309-3172331 ATGTGGGGCTCGGGGAGGAGGGG - Intergenic
1161285232 19:3464932-3464954 GGGTGGGGGTCGTGGAGTGGGGG + Intronic
1161643147 19:5436573-5436595 AGTTGGGAGACAGGGAGTAGGGG + Intergenic
1161849461 19:6731110-6731132 AGCTGGGGGACGGGGCGGAGTGG + Exonic
1161915464 19:7224922-7224944 AGGTGGGGGTGGGGGAACAGAGG + Intronic
1161921161 19:7267229-7267251 AGGTAGGGGCCGGGGAATAGTGG - Intronic
1161961587 19:7526418-7526440 AGCTGGGGAGAGGGTAGTAGAGG - Exonic
1162504965 19:11078232-11078254 AGATGGGGGTGGGGGCGTGGGGG - Intergenic
1162562623 19:11426338-11426360 AGATGGGGGCGGGGGCGTAGGGG + Intronic
1163333879 19:16659494-16659516 AGCTGGGGGTCAGGGGGCTGAGG - Intronic
1163334448 19:16661548-16661570 AGCTGGGGGAGGGGAAGGAGAGG + Intronic
1163337378 19:16682115-16682137 AGCTTGGGGTCCTGGATTAGGGG + Intronic
1163371894 19:16905785-16905807 TGCTGGGGGTAGGGGTGGAGTGG + Intronic
1163642658 19:18470320-18470342 AGATGGGGGTTGGGGATGAGGGG + Intronic
1163668343 19:18613395-18613417 AGCTGGGGGTTGGGTGCTAGAGG - Intronic
1164512709 19:28910899-28910921 AGCTTGGGGCCGGGGACTGGGGG - Intergenic
1165001568 19:32767671-32767693 AGCTGGGGGGCAGGGAGAAGAGG + Intronic
1165156546 19:33792322-33792344 GGGTGGGGGTTGGGGAGGAGAGG - Intergenic
1165743519 19:38217378-38217400 AGCTGGGGGTGGGGGTGGGGGGG - Intronic
1165786434 19:38464618-38464640 TCCTGGGGGTGGGGGAGTGGAGG - Exonic
1166083278 19:40458328-40458350 CGCTGGGGGCCGAGGTGTAGGGG + Intronic
1166352091 19:42204077-42204099 AGGTGGGGGTGGGGGACAAGAGG - Intronic
1166759960 19:45218151-45218173 AGGTGGGGGTGGGGGAAAAGAGG - Intronic
1166774317 19:45303100-45303122 ATCTGGGGGACTGGGAGTGGGGG + Exonic
1166788254 19:45382468-45382490 AGTTGGGGGTTGGGGAAAAGGGG - Intronic
1167287010 19:48603910-48603932 AGCTGGGGGTCGGGGAGTAGGGG + Exonic
1168241764 19:55092325-55092347 AGCTGGGGGTCAGGTAGAGGAGG + Exonic
1168261356 19:55196840-55196862 AACTGGGGGTAGGGGTGGAGGGG - Intronic
1168615581 19:57834381-57834403 TGCTGGGGGATGGGGAGGAGTGG + Intronic
1168621203 19:57881066-57881088 TGCTGGGGGATGGGGAGGAGTGG - Intronic
1168700624 19:58437332-58437354 AGCTGTGGATGGGTGAGTAGTGG - Intronic
925179752 2:1809431-1809453 AGCTGGGGCTCTGAGAGCAGAGG + Intronic
925622435 2:5807207-5807229 AGATGGGGGTGGGGGAGGTGGGG - Intergenic
926133176 2:10318307-10318329 AGCTGGGGTTGGGGGAGTCTGGG - Intronic
926480907 2:13392477-13392499 AGCTGGGATTCCGGGAGTGGTGG - Intergenic
927086024 2:19674748-19674770 AGCTCGGGGGCGTGGGGTAGGGG + Intergenic
927539139 2:23891731-23891753 AGGTGGGGGTCGGGGCGGGGGGG - Intronic
927917195 2:26944851-26944873 GGATGGGGGTCTGGGAGAAGTGG + Intronic
928391847 2:30916507-30916529 AGCTGGGGGCTGAGGAGGAGGGG + Intronic
928505275 2:31945512-31945534 AAAAGGGGGTCGGGGAGTACAGG - Intronic
928606677 2:32949328-32949350 AGGAGGGGCTTGGGGAGTAGAGG + Intronic
929215064 2:39403779-39403801 AGCTGGGGTTAGGGGAGGGGTGG - Intronic
929440900 2:41965253-41965275 ACCTGGGGTTTGAGGAGTAGAGG - Intergenic
929546940 2:42861979-42862001 AGCGGGGGGTGGGGGAGATGGGG - Intergenic
929564449 2:42975663-42975685 AGCTGGGGCTTGGGGAGGAGGGG + Intergenic
929857725 2:45650755-45650777 AGCCGGGGATGGGGGAGTGGAGG - Intergenic
930109739 2:47668262-47668284 AGGTGGGTGTGGGGGAGGAGGGG + Intergenic
930346531 2:50189361-50189383 TGCTGGGGGTTGGGGGGTAGGGG + Intronic
930565966 2:53020989-53021011 AACTGAGGCTCGGGGAGGAGAGG - Intergenic
931309829 2:61066837-61066859 AGAAGGGGGTCGGGGAGGGGAGG + Intronic
932418934 2:71590135-71590157 AGCTGGGGCTCGGGGGGAGGTGG - Intronic
932475943 2:72005988-72006010 AGGTGGGGGTAGGAGAGGAGAGG - Intergenic
934562643 2:95321000-95321022 GGCTGGGGGTCAGGGAGGAGAGG - Intronic
934573142 2:95384570-95384592 AGCTGGGGGGCAGGGGGGAGAGG + Exonic
935101822 2:100003099-100003121 AGTTGGGGGTCGGGGGGGTGGGG + Intronic
935303909 2:101718561-101718583 AGGTGGGGGTGGGGGGGTGGGGG + Intronic
935367523 2:102309968-102309990 AGGTGGGGGTGGGGGAGGTGAGG + Intergenic
936682753 2:114793292-114793314 GTCTGGGGGTGGGGGACTAGAGG - Intronic
937040620 2:118817833-118817855 AGGAAGGGGTCGGGAAGTAGGGG + Intergenic
937098948 2:119254031-119254053 AGCTTTGGGTCGGGGAGTGTTGG + Intronic
937470438 2:122169645-122169667 ACCTGGGGGTGGGGGAGTCTTGG + Intergenic
937808101 2:126169393-126169415 AGCTGGAGGTTGGGGGCTAGGGG + Intergenic
937904797 2:127047843-127047865 AGCTGGAGGTCAGGGACTGGGGG - Intergenic
937938129 2:127262628-127262650 AGCTGGGGGTTGGGAACAAGAGG + Intronic
938584512 2:132676339-132676361 AGCTGGGGGAAGGGAAATAGGGG - Intronic
939504312 2:143026910-143026932 AGCTGGGCATCGGAGAGAAGTGG - Intronic
939528633 2:143328580-143328602 GTCAGGGGGTAGGGGAGTAGGGG + Intronic
940049629 2:149448536-149448558 AGGTGGGGGTAGGGGTGGAGAGG - Intronic
940272780 2:151909565-151909587 TGCTGGGGGTTGGGGAGTGAGGG - Intronic
941844473 2:170119539-170119561 AGTTGGGGGTTGGGGGGTGGGGG + Intergenic
943052453 2:182932442-182932464 GGCTGGGGATGGGGGAGAAGTGG + Intronic
943669825 2:190648964-190648986 AGCGCGGGGTGGGGGAGTGGAGG + Intronic
944651846 2:201838246-201838268 AGCTGGGGGTGGGGTGGTGGGGG + Intronic
944770195 2:202906375-202906397 GGCTTGGGGTGGGGGAGGAGGGG - Intronic
944842225 2:203635281-203635303 GAATGGGGGTCGGGGAGTGGAGG + Intergenic
945279587 2:208023694-208023716 GGTGTGGGGTCGGGGAGTAGGGG - Intronic
945400416 2:209374997-209375019 ATCAGGGGGTGGGGGACTAGGGG + Intergenic
945862582 2:215140553-215140575 AGCCGGGGGTGGGGGTGTGGTGG - Intergenic
947323540 2:228949309-228949331 TGCTGGGGGTTGGGAAGTATTGG + Intronic
947810883 2:233003293-233003315 TGCTGTGGGTCTGGGAGCAGAGG - Intronic
947816300 2:233039886-233039908 ATCTGGGTGTTGGGGTGTAGGGG + Intergenic
947905350 2:233757288-233757310 AGCTGGGGGTTGGGGGACAGGGG + Intronic
948205123 2:236159478-236159500 GGATGGGGGGCGGGGAGAAGGGG + Intergenic
948756505 2:240162653-240162675 AGCAGGTGCTCAGGGAGTAGTGG - Intergenic
948902996 2:240965551-240965573 AGCTGGGCGTCGGGGAGCAGAGG + Intronic
948907607 2:240987148-240987170 TGCTGGGGGTGGAGGAGCAGGGG + Intronic
948916228 2:241036094-241036116 GGGTGGGGGTTGGGGAGTAGAGG + Intronic
1169559868 20:6787967-6787989 AGCTGGGGGTGGGGTAGTGGGGG + Intergenic
1171115546 20:22522075-22522097 AGCCCGGGGGCGGGGAGTGGGGG - Intergenic
1171199106 20:23226817-23226839 AGCTGGGGTTGGGGGAGAAGAGG - Intergenic
1172260835 20:33564028-33564050 AGCGGGAGGTCGCGGAGTGGGGG - Intronic
1172284822 20:33732841-33732863 TGCTGGGCGTCGGGGAGGAAGGG + Intronic
1172428473 20:34872192-34872214 AGCAGAGGGTCTGGGAGAAGCGG - Intronic
1172754034 20:37270939-37270961 AGCTGGGGGCCTGGGTGTGGAGG - Intergenic
1172764819 20:37345912-37345934 AGCTGGGGGTCCGGGCGGGGTGG - Intronic
1172959753 20:38790324-38790346 AGCTGGGGGTGGGGACGTGGAGG - Intergenic
1173182646 20:40816358-40816380 AGCTGGGGGTGAGGGAGTGGGGG - Intergenic
1173257926 20:41408219-41408241 AGCTGGGGGTGGGGGTGGGGAGG + Intronic
1175047647 20:56122443-56122465 GGGTGGGGGTCGGGGGGTTGGGG - Intergenic
1175119569 20:56707680-56707702 AGCTGGGGGGCGGGGGTCAGGGG + Intergenic
1175262615 20:57684266-57684288 GGGTGGGGGTCGGGGAGTTAGGG + Intronic
1175468298 20:59207981-59208003 CTCTGGGGGTTGGGGAGCAGAGG - Intronic
1175788142 20:61724597-61724619 AGCCCGGGGTCGGGGCGAAGGGG - Intronic
1175804703 20:61821024-61821046 AGCTTTGGGGCGGGGGGTAGCGG - Intronic
1175816407 20:61885293-61885315 AGCTGGGGGTAAGGGAGTCGAGG - Intronic
1175872270 20:62214130-62214152 AGCTGGGGGACGGGACGTTGGGG + Intergenic
1176127924 20:63484238-63484260 AGGTGGGGGTAGGGGGGTGGGGG - Intergenic
1176263322 20:64194714-64194736 AGCTGGGGCCCGGGAAGGAGTGG + Intronic
1177533279 21:22391375-22391397 AGGTGGGGGTTGGGGAGGAAGGG + Intergenic
1177995730 21:28094859-28094881 AGATGGGGGTGGGGGAGTGAGGG + Intergenic
1178631912 21:34268733-34268755 AGCCGGGGGTGGGGCAGGAGAGG + Intergenic
1178826736 21:36023805-36023827 AGATGGGGGTAGGGGGGTGGGGG - Intergenic
1180305017 22:11066933-11066955 AGCGGGTGGTGGGGGATTAGGGG + Intergenic
1181265643 22:21629245-21629267 AGGCGGGGCTGGGGGAGTAGGGG - Intronic
1181387713 22:22557894-22557916 AGATGGGGGTGGGGAAGGAGGGG + Intronic
1181589793 22:23876976-23876998 GGCTGGGTGTCGTGGAGTGGGGG + Intronic
1181911144 22:26239250-26239272 AGCTGGGGGGCAGGGTGGAGTGG + Intronic
1182775558 22:32828818-32828840 AGCGGTGGGGAGGGGAGTAGGGG + Intronic
1182851282 22:33476690-33476712 GGCTGGGGGGCGGGGTGCAGTGG - Intronic
1183316139 22:37137832-37137854 GGCTTTGGGTCGGGGGGTAGGGG - Intronic
1183474913 22:38030855-38030877 AGCTGGGGGTGGGGTGGGAGAGG - Intronic
1184274806 22:43404226-43404248 AGCTGGGGGAGGGACAGTAGAGG - Intergenic
1184685099 22:46093047-46093069 AGCTGGGGCTCGGAGAGGAGAGG + Intronic
1184711040 22:46249754-46249776 AGCGGGGGGTTGGGGAGCGGGGG + Intronic
1184791648 22:46703853-46703875 GGCTGGGGGTGGGGGTGGAGGGG - Intronic
1184976462 22:48065902-48065924 AGCTGGGGGAGGCGGAGGAGAGG + Intergenic
1185170627 22:49291700-49291722 AGCTGTGGGGTGGGGGGTAGTGG - Intergenic
1185320254 22:50197416-50197438 GGCTGGGTGTTGGGGAGCAGTGG - Intronic
950031535 3:9857022-9857044 AGCTGGGGGAGAGGGAGTTGGGG - Intergenic
950290452 3:11779856-11779878 AGCTGGGGATCCAGGAGGAGGGG - Intergenic
950527029 3:13530272-13530294 AGCTGAGGCTGGGGGAGTGGAGG - Intergenic
951542844 3:23798569-23798591 TGCTGGGGGTTGGGGGGTGGCGG + Intergenic
951694274 3:25429163-25429185 ATGTGGGGGGTGGGGAGTAGAGG + Intronic
952355425 3:32579047-32579069 GACTGGGCGTCGGGGAGCAGGGG - Intergenic
952761048 3:36914584-36914606 AGCTGGGGATGGGGGATTGGGGG - Intronic
952764959 3:36945490-36945512 GGCTGGGGGTCCGGGAGTGAAGG + Intergenic
952838914 3:37627951-37627973 GGCTGGGTGTCGGGGAGGGGTGG + Intronic
953329815 3:42043491-42043513 GGCTGGGGGTAGGGGTGGAGGGG - Intronic
953571768 3:44076730-44076752 AGGTGGGGGGAGGGGAGTCGGGG + Intergenic
953932599 3:47013189-47013211 AGATGGGGGTAGGGGAGCACCGG - Intergenic
954373149 3:50180231-50180253 AGCAGGGAGTCGGGGGGTGGAGG - Intronic
955359943 3:58265029-58265051 AGCTGGGGGTAGGGGAGAAGTGG - Intronic
956959535 3:74382517-74382539 GGCTGGTGGTGGGGGAGTTGGGG - Intronic
957083106 3:75655568-75655590 GGCTGGGGGAGGGGGAGGAGGGG + Intergenic
957350355 3:79016925-79016947 AGCTAGGGGTGGGGGACTGGAGG + Intronic
957530246 3:81431522-81431544 TGTTGGGGGTGGGGGGGTAGGGG + Intergenic
958063564 3:88513513-88513535 GTCTGGGGGTCGGGGGCTAGGGG + Intergenic
958464706 3:94443228-94443250 AGCTGGGGGTTGGTGAGCAAGGG - Intergenic
958617492 3:96514599-96514621 AGCTGGGGATAGGGGAGTGGTGG - Intergenic
958760098 3:98296568-98296590 ACCTGGGGTTGGGGGAGGAGTGG - Intergenic
959679498 3:109076823-109076845 GGCGGGGGATCGGGGACTAGGGG + Intronic
960269904 3:115661991-115662013 TGGTGGGGGTCGGGGGGAAGGGG + Intronic
960684524 3:120283795-120283817 AGCTGGGGGTGGAAGAGAAGGGG + Intronic
960796304 3:121492017-121492039 AGGTGGGGGTAGGGGGGTGGTGG - Intronic
961006904 3:123411581-123411603 GGCTGGGGGTTGGGGATAAGAGG - Intronic
961028827 3:123584846-123584868 GGCTGGGGCTCGGGGAGGCGGGG - Intronic
961038271 3:123658717-123658739 TGCTGGAGGTGGGAGAGTAGCGG - Intronic
961055651 3:123786518-123786540 GGGTGGGGGTGGGGGAGGAGGGG + Intronic
961241393 3:125414921-125414943 AGCTGGGGGTGGGTGAGAAGAGG + Intergenic
961328413 3:126125123-126125145 AGGTGTAGGTGGGGGAGTAGAGG - Intronic
961484730 3:127208756-127208778 GGCTGGAGGTCAGGGAGCAGTGG + Intergenic
961533156 3:127552331-127552353 GGCTGGGGGTGGTGGAGTAGGGG - Intergenic
961714154 3:128847392-128847414 AGCTGGGGGACAGGGAGTTGGGG + Intergenic
962349557 3:134646759-134646781 TACTGGGGCTCTGGGAGTAGAGG + Intronic
962354387 3:134681176-134681198 AGCTGGGGGTCGGGGGGTGGTGG + Intronic
962367514 3:134796032-134796054 AGCTGGGCGTTGGGGAGAAAGGG + Intronic
962688252 3:137868209-137868231 TGCTGGGGGTCAGGGAGGGGTGG - Intergenic
962898666 3:139737864-139737886 AGCTGTGGACCGGGCAGTAGGGG - Intergenic
962919046 3:139935041-139935063 AGTTGGGGGTCGGGGCCTTGGGG + Intergenic
963320675 3:143806087-143806109 GGGTGGGGGACGGGGGGTAGGGG - Intronic
963848849 3:150187591-150187613 AGGTTGGGGGCAGGGAGTAGGGG - Intergenic
964205639 3:154171862-154171884 AGTTGGGGGTGGGGGAGGACTGG + Intronic
964258314 3:154804922-154804944 TGCTAGGGGTCGGGGGGCAGGGG - Intergenic
965742455 3:171890165-171890187 ACCTGGGGTTGGGGGAGTAGTGG + Intronic
966552323 3:181219059-181219081 TGCTGGGGTTGGGGGAGGAGGGG + Intergenic
966874962 3:184316225-184316247 GGCTGTGGGGAGGGGAGTAGGGG + Intronic
967207837 3:187139583-187139605 AGCTGTGGCTCGGGGAGCCGTGG + Intronic
967592372 3:191293860-191293882 AGCCGGGGGTGGGGGAGTCGGGG + Intronic
968531531 4:1094400-1094422 AGCTGGGGGTGGGGGAGGCTTGG + Intronic
968581458 4:1397241-1397263 AGCTGGGAGGCGGGGAGGTGAGG - Intergenic
968624111 4:1618829-1618851 GGCTGGGGGTCGGGGGCTGGGGG - Intronic
969059593 4:4424420-4424442 ATCTGGGCATGGGGGAGTAGCGG + Intronic
969402128 4:6962641-6962663 AGCTGGGGGGTGGCCAGTAGGGG - Intronic
969404870 4:6984299-6984321 AGCATGGGGTCGTGGAGCAGTGG + Intronic
970561663 4:17287647-17287669 AGCTGGAGGTGGAGGTGTAGGGG - Intergenic
970770438 4:19606096-19606118 TGCTGGGGGTCAGGGACCAGAGG - Intergenic
971923572 4:32976000-32976022 AGGTGGGGGTAGGGGATTACTGG + Intergenic
972253318 4:37328390-37328412 TGCTGGGGGTGGGGGGCTAGGGG - Intronic
972349827 4:38226280-38226302 GGCTGGAGGTGGGAGAGTAGTGG - Intergenic
972688570 4:41374200-41374222 AGCTGGGGGCAGGAGGGTAGAGG + Intronic
972775149 4:42233321-42233343 AACTGGGGGTGGGGTAGGAGAGG + Intergenic
972948307 4:44285467-44285489 TGTAGGGGGTCGGGGTGTAGGGG + Intronic
973159172 4:46993994-46994016 TGCTGGGCGTCGGGTGGTAGCGG + Exonic
974590541 4:63942910-63942932 GACTGGGGGCCGGGGAGCAGGGG + Intergenic
976099858 4:81550206-81550228 AGCTGGGCCTCGAGGAGCAGCGG - Intronic
976217784 4:82731150-82731172 AGCTGGGGGTAGGGGCAGAGAGG + Intronic
976549135 4:86374252-86374274 TGTTGGGGGTGGGGGACTAGGGG + Intronic
977259727 4:94783967-94783989 AGCTGGAGGTAGGGAAGGAGGGG + Intronic
978384819 4:108168498-108168520 AGATGGGGGCCGAGGAGGAGGGG + Intronic
978484728 4:109238924-109238946 TGGTGGGGGTAGGAGAGTAGAGG + Intronic
978558421 4:110005888-110005910 AGATGGGAGCTGGGGAGTAGGGG - Intronic
978605060 4:110470928-110470950 AGCAGGGGGTTGGGGGGCAGGGG + Intronic
978785194 4:112601260-112601282 AGCTGGGCAGCCGGGAGTAGTGG + Intronic
979676271 4:123413480-123413502 AGATGGGGGTTGGGGGGTTGGGG - Intergenic
980081347 4:128347721-128347743 AGCTGTGGGTAGGGGAGGATGGG - Intergenic
981028044 4:140095825-140095847 AGCTGGGTGAAGGGGAGGAGGGG - Intronic
981558727 4:146023879-146023901 TGCTGGGGCTGGGGGAGGAGAGG + Intergenic
982777387 4:159455755-159455777 AGCTGGGGGGCGGGGGGAGGGGG - Intergenic
983550461 4:169012104-169012126 AGATGGGGGTCGGGGGGGTGGGG - Intergenic
984808848 4:183776244-183776266 AGCTGGGAGGCCGGGAGGAGAGG - Intergenic
985485851 5:148238-148260 AGTGGGGGGTGGGGGAGAAGAGG + Intronic
985758604 5:1733466-1733488 CCCTGGGGGTCAGGGAGGAGAGG - Intergenic
985865297 5:2509638-2509660 GGCTTGGGGTAGGGGAGAAGGGG - Intergenic
986379296 5:7166813-7166835 AGGTGGGGCTTGGGGAGCAGAGG - Intergenic
986771827 5:10980889-10980911 TGCTGGGGGTCAGGGGCTAGGGG + Intronic
989164757 5:38423427-38423449 AGGTGGGGGTAGGGGAGGGGAGG - Intronic
989503920 5:42203191-42203213 AGCTGTGGTTCGGGGGGTGGGGG + Intergenic
989710367 5:44389572-44389594 AGAAGGGGGTGGGGGAGCAGGGG + Intronic
990185697 5:53206779-53206801 AGCTGGGGGCCAGGAAGTGGTGG - Intergenic
990309835 5:54527340-54527362 AGGTGGTGGTCGGGGAGCCGGGG + Intronic
990486955 5:56268695-56268717 TGCGGGGGGTGGGGGACTAGGGG - Intergenic
990553534 5:56908589-56908611 ATCTGGGTGTTGGGGAGGAGCGG + Intergenic
990982094 5:61611004-61611026 GACTTGGGGTTGGGGAGTAGGGG - Intergenic
990993522 5:61708217-61708239 AGATGGGGGCAGGGGTGTAGTGG + Intronic
992106240 5:73451303-73451325 AGCTTGGGGGCGGGGAGCCGGGG - Intergenic
992231260 5:74666562-74666584 AGCAGGGAGTGGGGGAGTTGGGG - Intronic
992244700 5:74808470-74808492 AGATGGGGGTAGGGGAAAAGGGG + Intronic
992276688 5:75128254-75128276 GGCAGGGGGTGGGGGACTAGGGG + Intronic
992610993 5:78508482-78508504 AGGTGGGGGATGGGGAGTAATGG - Intronic
994065921 5:95542074-95542096 AGCTGGGGGTCGGAGGGCACAGG + Intronic
994978119 5:106837858-106837880 TGTTGGGGGTGGGGGACTAGGGG - Intergenic
997507837 5:134432481-134432503 AGGTGGTGGTCGTGGAGTAGGGG + Intergenic
997519637 5:134514537-134514559 GGTTGGGGGTAGGGGAGAAGTGG - Intergenic
997609830 5:135208105-135208127 AGCTGGGGGTCAGGGCACAGGGG - Intronic
997631638 5:135373197-135373219 CGTTGGTGGTCGGGGAGGAGGGG + Intronic
997670985 5:135671852-135671874 GGGTGGGGGTGGGGGAGTAGAGG - Intergenic
998400402 5:141845864-141845886 AGATGGGGGTGGGTGGGTAGGGG - Intergenic
999240537 5:150124902-150124924 GGCCGGGGGTAGGGGAGTGGGGG - Intronic
999248608 5:150168246-150168268 AGCTGGGGTAAGGGGAGGAGGGG - Intronic
999406736 5:151313118-151313140 TGCTGGGGGTGGGGGAGGGGTGG + Intergenic
1000159983 5:158587620-158587642 TGCTGGGGGTTGGGGAGGGGTGG + Intergenic
1001419820 5:171578119-171578141 AGCTGGGGGTGGGTGAGTGAAGG + Intergenic
1001422163 5:171596386-171596408 GGCCGGGGGTGGGGGAGGAGGGG - Intergenic
1001579785 5:172790711-172790733 AGCGGGGGGTAGCTGAGTAGAGG + Intergenic
1001712319 5:173788816-173788838 TGCTGGGGGTAGGGGGGTTGAGG + Intergenic
1001798323 5:174520518-174520540 AGCTGGGGGTCAGGGAGAGGCGG - Intergenic
1001824880 5:174736421-174736443 TGCTGGGGGAGGGGGAGTGGAGG - Intergenic
1001962487 5:175888039-175888061 AGCAGGTGGTTGGTGAGTAGGGG - Intergenic
1002081571 5:176740614-176740636 GGCTGGGGGTAGGGGCGGAGTGG + Intergenic
1002175488 5:177399113-177399135 AGGTGGGGGTCAGGGGGTGGGGG - Intergenic
1002277753 5:178114387-178114409 AGCTGCGGGTCTGCGGGTAGGGG + Intronic
1002579489 5:180199063-180199085 AGGTGGGGGTTGGGGAGGAGAGG - Intronic
1003086637 6:3065527-3065549 AGATGGGTGTGGGGGAGGAGGGG + Intronic
1003334062 6:5154359-5154381 AGCTGGAGATGGGGGAATAGGGG - Intronic
1003342453 6:5234915-5234937 CTCTGGGGGTTTGGGAGTAGGGG - Intronic
1004366707 6:15019084-15019106 GGCTGGGGGTGGGGGAGAATAGG + Intergenic
1005554192 6:26956637-26956659 GGCTGGGGGGCGGGGGGCAGGGG + Intergenic
1005900505 6:30213294-30213316 AGCTCGGGACCGGTGAGTAGGGG - Exonic
1005993782 6:30919877-30919899 AGTTGGGGGTCCTGGAGGAGAGG + Intronic
1006012361 6:31053824-31053846 AGCTGGGTGTCAGAGGGTAGAGG - Intergenic
1006089710 6:31621030-31621052 AGGTGCGGGTCCCGGAGTAGAGG - Intronic
1006214539 6:32429065-32429087 GGATGGGGGTTGGGGACTAGCGG + Intergenic
1006305094 6:33213899-33213921 TGCTTGGGGTCCGGGAGGAGGGG - Intergenic
1006434805 6:34020526-34020548 AGTTGGGGGTGGGGGGGTGGGGG - Intronic
1006648885 6:35534852-35534874 AGCTGGGGGTTTGGGGGAAGAGG - Intergenic
1007017360 6:38482194-38482216 AGCAGGGGTTGGGGGCGTAGAGG - Intronic
1007257347 6:40538297-40538319 AGCTGGAGGCCCGGGAGTAGGGG - Intronic
1007486088 6:42181722-42181744 AGCTGGGTGTGGGGGAGGTGTGG + Intergenic
1007746157 6:44044080-44044102 AGCTGGGGGAGGGGGGGTTGTGG - Intergenic
1007777266 6:44230682-44230704 AGCTGGGGTTTGGGGTATAGGGG + Intronic
1008019678 6:46561885-46561907 GGCTGGGGTTAGGGGAGTTGGGG + Intronic
1008177741 6:48288975-48288997 TGCTGGGGGTGGGGGAGGGGTGG + Intergenic
1008956533 6:57222012-57222034 CGGTGGGGGACGGTGAGTAGCGG - Exonic
1009512052 6:64564791-64564813 GGGTGGGGGTCGGGGGCTAGGGG + Intronic
1009948215 6:70364574-70364596 AGCTGGATGTCGGGGAGAAGCGG - Intergenic
1010397058 6:75404711-75404733 AGCTGAGGGGCGGGCAGTTGAGG - Intronic
1010773677 6:79861330-79861352 AGCTGGGGGGCGGGGTGGGGAGG + Intergenic
1013010761 6:106117917-106117939 AGCAGGGGGTCCGGGTGGAGAGG + Intergenic
1013821180 6:114154975-114154997 AGCTGGGGGTGGGGTGGTGGAGG - Intronic
1014693967 6:124595918-124595940 AGCTGGGGCTTGGGGAGCACGGG + Intronic
1015111665 6:129598920-129598942 AGGTAGGGGTAGGGGTGTAGGGG + Intronic
1015231869 6:130923974-130923996 GGCTGGGGGAGGGGGAGTTGAGG - Intronic
1015960193 6:138640771-138640793 AACTGGGGGTGGGGGGTTAGGGG - Intronic
1017770060 6:157638097-157638119 AGGTGGAGGCAGGGGAGTAGAGG + Intronic
1017890221 6:158631642-158631664 AACTGGGGGTCAGGGAGAGGAGG + Intronic
1018182700 6:161238058-161238080 GGCTGGGGGTGGGGGGGTAATGG + Intronic
1018628712 6:165804747-165804769 AGCGCGGGGTCGGGGAGCGGCGG + Intronic
1018959931 6:168441083-168441105 AGGTGGGGCTGGGGGAGGAGAGG + Intergenic
1019167286 6:170107119-170107141 TCCTGGGGGACGGGCAGTAGAGG - Intergenic
1019268656 7:133794-133816 GGGTGGGGGTCGGGGGTTAGGGG + Intergenic
1019268673 7:133826-133848 GGGTGGGGGTCGGGGGTTAGGGG + Intergenic
1019268690 7:133858-133880 GGGTGGGGGTCGGGGGTTAGGGG + Intergenic
1019470734 7:1219158-1219180 AGCTGGGTGTGGGGGAGTAGGGG + Intergenic
1019504498 7:1384002-1384024 AGCTGGGGGTCCGGCCGTGGAGG - Intergenic
1019514313 7:1433067-1433089 ACCTGGGTGTCGAGGAGTAGGGG - Intronic
1019514812 7:1434983-1435005 AGCTGGGGGTGGGGGGGGGGCGG - Intronic
1020119590 7:5495574-5495596 AGCTGGGGGTCACGGTGTGGGGG + Intronic
1020338437 7:7083584-7083606 GTCTGGGGGTAGGGGGGTAGGGG - Intergenic
1020847623 7:13306919-13306941 AGTTGGGGGATGGGGAGAAGGGG + Intergenic
1021537671 7:21723741-21723763 AGCTGGGGGTGGAGGGGTGGGGG - Intronic
1021639198 7:22721781-22721803 AGACGGGGGTCGGGGAGAGGTGG - Intergenic
1022948021 7:35307040-35307062 AGCTTGGGAACTGGGAGTAGAGG - Intergenic
1023114418 7:36847612-36847634 AGTGGGGGGTGGGGGACTAGGGG + Intergenic
1023759439 7:43450244-43450266 AGCTGGAGGTTGGGGGGTTGGGG - Intronic
1023965517 7:44961563-44961585 GGCTGGGGGTCGGGGGGCTGAGG + Intergenic
1024247188 7:47479475-47479497 ACGGGGGGGTGGGGGAGTAGGGG - Intronic
1025159061 7:56637079-56637101 AGCCGCTGGTGGGGGAGTAGGGG - Intergenic
1026645602 7:72165435-72165457 AGCTGGGGTGCTGGGATTAGAGG - Intronic
1026879971 7:73901893-73901915 AGTTGGGGGAGGGGGAGTTGGGG - Intergenic
1027430017 7:78102193-78102215 GGCTGGGGGTTGGGGAAAAGGGG + Intronic
1027906866 7:84196118-84196140 AGGTGGGGGGTGGGGAGTGGTGG - Intronic
1028071984 7:86461512-86461534 AGGTGGGGGTGGGGGGGCAGTGG - Intergenic
1028082742 7:86598949-86598971 CCCTGGAGGTGGGGGAGTAGGGG + Intergenic
1028645638 7:93093582-93093604 TGCTGGGGTTCGGGGAGGTGTGG + Intergenic
1028744372 7:94310518-94310540 TGCAGGGGGTCGGGGGGTGGCGG - Intergenic
1028986456 7:97012899-97012921 AGCTGGGGGTGGGGTAGAGGAGG + Intergenic
1029246467 7:99205560-99205582 AGATGGGGGGCTGGGAGCAGTGG + Intronic
1029248155 7:99217521-99217543 AGCTGGGGTTGGGGGTGGAGAGG + Intergenic
1029270713 7:99375164-99375186 GGATGGGGGCCGGGGAGCAGGGG - Intronic
1029436961 7:100568910-100568932 AGCCGAGGGTCAGGGAGGAGAGG - Intergenic
1030080493 7:105773855-105773877 AAGTGAGGGTCGGGGAGAAGTGG + Intronic
1032354102 7:131193741-131193763 TGGTGGGGGTTGGGGAGTTGAGG - Intronic
1032428643 7:131842806-131842828 GGCTGGGGGGCAGGGTGTAGAGG - Intergenic
1033322457 7:140352228-140352250 AGGTGGGGGTGGGGGAGAGGTGG + Intronic
1033472261 7:141660681-141660703 AGCTGGGGGTAGGTGGTTAGAGG - Exonic
1033595756 7:142856666-142856688 AAGTGGGGGGCGGGGAGGAGTGG - Intronic
1033740727 7:144273915-144273937 AGCTGGGGGTGGGGGAAGATGGG - Intergenic
1033753179 7:144375698-144375720 AGCTGGGGGTGGGGGAAGATGGG + Intronic
1033916137 7:146328684-146328706 AGCTGGGGGCTGGAGAGAAGAGG - Intronic
1034368177 7:150570008-150570030 AGGTGGGGGTGGGGGATTTGGGG + Intronic
1034832554 7:154322046-154322068 AGCTGGGGGTTGGGGGTTGGGGG - Intronic
1034963080 7:155374332-155374354 AGCTGGGGGAGCGGGAGCAGGGG + Intergenic
1035117710 7:156538371-156538393 AGCTGGGCAGCTGGGAGTAGTGG - Intergenic
1035375506 7:158404657-158404679 AGCTGGGGGCCGGGGAGCTGAGG - Intronic
1035375529 7:158404716-158404738 AGCTGGGGGCCGGAGAGCTGGGG - Intronic
1035375545 7:158404760-158404782 AGCTGGGGGCCGGGGAGCTGAGG - Intronic
1035375562 7:158404805-158404827 AGCTGGGGGCCGGGGAGCTGGGG - Intronic
1035375577 7:158404834-158404856 AGCTGGAGGCCGGGGAGCTGGGG - Intronic
1035375644 7:158405023-158405045 AGCTGGGGGCCGGGGAGCTGGGG - Intronic
1035375652 7:158405038-158405060 AGCTGGGGGCCGGGGAGCTGGGG - Intronic
1036420239 8:8588696-8588718 ATCTGGGGGTCAGGGCGTGGGGG + Intergenic
1038764409 8:30414097-30414119 AGGAGGGGGTGGGGGAGGAGGGG - Intronic
1039772997 8:40707217-40707239 AGATGGGGGTGGGGGGGTGGGGG - Intronic
1041374093 8:57194079-57194101 AGTTGGGGCTTGGGGAGTGGGGG + Intergenic
1043019621 8:74984421-74984443 AGGTGGGGGTGGGCGAGGAGGGG + Intergenic
1043724419 8:83591214-83591236 TGCTGGGAGTGGGGGAGAAGTGG + Intergenic
1043785448 8:84392766-84392788 AGCTGGCGGGTGGGGAGAAGAGG + Intronic
1044206424 8:89496556-89496578 AGCTGGGGCTCTGGGAGTCTGGG + Intergenic
1044736830 8:95287537-95287559 AGTTGGGGGTGGGGGGCTAGGGG - Intergenic
1045075024 8:98555882-98555904 TGATGGGGGTGGGGGATTAGTGG + Intronic
1045287576 8:100805254-100805276 GGCAGGGGGTGGGGGAGTGGTGG - Intergenic
1045337942 8:101224786-101224808 GGCTCGGGGTCCAGGAGTAGGGG - Intergenic
1047702016 8:127458113-127458135 AGTTGGGGGTGGGGGAGGAATGG + Intergenic
1047992194 8:130297721-130297743 AGCGGGGGGGCGGGGAGCAGAGG + Intronic
1048201100 8:132374413-132374435 AGAAGTGGGTCGGGGAGTGGAGG - Intronic
1048881676 8:138877105-138877127 GGCTGGGGGTGGGGGAGGGGAGG - Intronic
1048986824 8:139739217-139739239 GGCTGGGTGTCCGGGAGGAGAGG - Intronic
1049032620 8:140048840-140048862 AGCTGGGAGTAGGGGAGCAGGGG - Intronic
1049292655 8:141812829-141812851 TGCTGGGGGTCAGGGAGTGAGGG - Intergenic
1049292713 8:141812988-141813010 TGCTGGGGGTCAGGGAGATGAGG - Intergenic
1049292721 8:141813012-141813034 TGCTGGGGGTCAGGGAGATGAGG - Intergenic
1049292737 8:141813058-141813080 TGCTGGGGGTCAGGGAGTGAGGG - Intergenic
1049292778 8:141813173-141813195 TGCTGGGGGTCAGGGAGATGAGG - Intergenic
1049292802 8:141813243-141813265 TGCTGGGGGTCAGGGAGATGAGG - Intergenic
1049292858 8:141813401-141813423 TGCTGGGGGTCAGGGAGATGAGG - Intergenic
1049292866 8:141813425-141813447 TGCTGGGGGTCAGGGAGATGAGG - Intergenic
1049292952 8:141813652-141813674 TGCTGGGGGTCAGGGAGATGAGG - Intergenic
1049473557 8:142786883-142786905 GGGTGGGGGGCGGGGGGTAGCGG - Intergenic
1049609883 8:143549996-143550018 AGCTGGGTGTTGGGGAGGGGAGG - Intergenic
1050040741 9:1490719-1490741 AGTTTGGGGCCGGGGAGAAGAGG + Intergenic
1050303298 9:4281443-4281465 TGCTGGGAGTTGGGGAGAAGGGG - Intronic
1051418378 9:16867687-16867709 GGGTGGGGGTGGGGGGGTAGAGG - Intronic
1051724826 9:20078313-20078335 GGTTGGGGGTTGGGGAGTGGGGG - Intergenic
1051849709 9:21492212-21492234 TTCTGGGGGTCGGGGGGTGGGGG + Intergenic
1053015992 9:34662519-34662541 AGCTGGGGGTCTGGGTGAATGGG - Intronic
1053157774 9:35792243-35792265 TGCTGGGGGCCGGGGAGAGGAGG - Exonic
1053316822 9:37059154-37059176 TGTTGGGGGTGGGGGAGGAGGGG - Intergenic
1053326319 9:37155071-37155093 AGATGGCGGGCGGGGTGTAGTGG + Intronic
1055834127 9:80419094-80419116 AGCTGGGGTTCCGGGGGAAGAGG + Intergenic
1055876361 9:80946772-80946794 AAGTGGGGGTTGGGGAGAAGAGG + Intergenic
1056806189 9:89730810-89730832 AGCTGGGGGTGGTGGAGCGGCGG + Intergenic
1057587723 9:96344708-96344730 AGCTGGGGGTGGGGGAGGGATGG + Intronic
1057909043 9:99004091-99004113 AGCCAGGGGTCGGGGAGAAATGG + Intronic
1061306451 9:129735809-129735831 GGGTGGGTGTCGGGGAGTGGTGG - Intergenic
1061403760 9:130382658-130382680 GGCTGGGGGTGGGGGAGAGGGGG - Intronic
1061445612 9:130635657-130635679 GGGTGGGGGTGGGGGAGAAGGGG - Intronic
1062222492 9:135424961-135424983 GGCTGGGGGGCGGGGGGTGGGGG - Intergenic
1062234843 9:135502810-135502832 AGCCGGGGGTAGGGGAGATGTGG + Intronic
1062534810 9:137016737-137016759 GCCTGGGGGTCGGGGAGGGGAGG + Exonic
1062612337 9:137380644-137380666 AGAGGGGGGTTGGGGAGGAGGGG - Intronic
1185455408 X:307915-307937 AGCTTGGGGTCAGGGACCAGAGG - Intronic
1185914020 X:4014961-4014983 AGCTGAGGGACAAGGAGTAGTGG + Intergenic
1186448759 X:9654697-9654719 ATTTAGGGGGCGGGGAGTAGGGG - Intronic
1186797224 X:13058652-13058674 ATTTGAGGGTCGGGGAGAAGAGG + Intergenic
1186875878 X:13817216-13817238 AGTTGGGGGTAGGGGGGTGGGGG + Exonic
1187226562 X:17378955-17378977 AGCTGTGGGTCGGTCACTAGCGG + Intronic
1187419722 X:19123154-19123176 TGCTGGGGGTCGAGGTGGAGGGG + Intergenic
1187423760 X:19159515-19159537 AGTTGGGGGGCGGAGAGTTGTGG + Intergenic
1187502748 X:19853405-19853427 AGGGGGTGGTCAGGGAGTAGGGG + Intronic
1187617798 X:21016840-21016862 AGCTGGGGGCCTGGGGGCAGAGG + Intergenic
1188061096 X:25603149-25603171 AGTTGGGGGTCGGGGTGAGGCGG - Intergenic
1189071247 X:37866363-37866385 AGCCGGGGGTTGGGGGGTGGAGG - Intronic
1189212008 X:39291444-39291466 AGCTGGGGGTCTGGGAGAGCAGG + Intergenic
1189528485 X:41853013-41853035 ATCTGGGGGTGGGGAAGCAGAGG - Intronic
1190712588 X:53081337-53081359 AGCGGGGGGGCGGGGGGCAGGGG + Intergenic
1192545347 X:72008286-72008308 ACCTGTGAGTCGGTGAGTAGAGG + Intergenic
1192657021 X:73003143-73003165 AGCTGGGGGACGGAGAGGCGGGG - Intergenic
1192665099 X:73079858-73079880 AGCTGGGGGACGGAGAGGCGGGG + Intergenic
1192736037 X:73850680-73850702 AGAGGGGGGTAGGGGGGTAGGGG + Intergenic
1193421440 X:81287648-81287670 GTCTGTGGGTGGGGGAGTAGGGG + Intronic
1194292742 X:92095105-92095127 AGCTGGGGATTGGGGGTTAGGGG - Intronic
1194522196 X:94932424-94932446 AGCTGGGGGTAGGGGTGTGAAGG + Intergenic
1195534620 X:105997238-105997260 GTCTGGGGGTGGGGGACTAGGGG + Intergenic
1195995942 X:110731800-110731822 AGCTGGGGGAAGGGGAGAATGGG + Intronic
1197639006 X:128947524-128947546 GTCTGGGGGTGGGGGACTAGGGG - Intergenic
1199078011 X:143546085-143546107 AGCTGGGGGTGGTGGGGGAGGGG + Intergenic
1199358184 X:146885852-146885874 TGCTGGGGGTCGGGGAGGGGTGG - Intergenic
1199590948 X:149468096-149468118 AGGTGGGGGTGAGGGAGCAGAGG - Intergenic
1199599798 X:149535204-149535226 AGGAGGGGGTGGGGGAGGAGTGG - Intergenic
1199607316 X:149586872-149586894 CACTGGGGGTCAGAGAGTAGCGG - Intronic
1199631807 X:149782495-149782517 CACTGGGGGTCAGAGAGTAGCGG + Intronic
1199649615 X:149939239-149939261 GGCTGGGGCTCGGGGAGGGGTGG + Intergenic
1199650842 X:149945048-149945070 AGGAGGGGGTTGGGGAGGAGTGG + Intergenic
1200070417 X:153526305-153526327 AGCTGGTGGTGGGAGGGTAGGGG + Intronic
1200071074 X:153529710-153529732 GGCTGGGGGCTGGGGAGTTGGGG - Intronic
1200082234 X:153583452-153583474 GGCTGGGGGGTGGGGAGTTGGGG - Intergenic
1200083357 X:153590509-153590531 AGCTTGGGGGTGGGGAGTTGGGG + Intronic
1200096970 X:153669075-153669097 AGCTGGGGCTCTGGGAGCAGTGG - Intergenic
1200143790 X:153915225-153915247 GGCTGGGGGGTGGGGAGTTGGGG + Intronic
1200179517 X:154141763-154141785 GGCTGGGGGGTGGGGAGTTGGGG - Intergenic
1200610248 Y:5319667-5319689 AGCTGGGGATTGGGGGTTAGGGG - Intronic
1200712446 Y:6499718-6499740 TGTTGGGGGTAGGGGACTAGTGG - Intergenic
1200795109 Y:7333565-7333587 AACAGGGGGAAGGGGAGTAGAGG - Intergenic