ID: 1167288209

View in Genome Browser
Species Human (GRCh38)
Location 19:48610692-48610714
Sequence GGGGTTCACCCCCAGCTGCT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 188
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 171}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167288198_1167288209 0 Left 1167288198 19:48610669-48610691 CCGGCCCCTACCTCCGTGTTCCA 0: 1
1: 0
2: 2
3: 22
4: 265
Right 1167288209 19:48610692-48610714 GGGGTTCACCCCCAGCTGCTGGG 0: 1
1: 0
2: 1
3: 15
4: 171
1167288204_1167288209 -6 Left 1167288204 19:48610675-48610697 CCTACCTCCGTGTTCCAGGGGTT 0: 1
1: 0
2: 1
3: 13
4: 126
Right 1167288209 19:48610692-48610714 GGGGTTCACCCCCAGCTGCTGGG 0: 1
1: 0
2: 1
3: 15
4: 171
1167288194_1167288209 8 Left 1167288194 19:48610661-48610683 CCCCTGGCCCGGCCCCTACCTCC 0: 1
1: 0
2: 5
3: 75
4: 763
Right 1167288209 19:48610692-48610714 GGGGTTCACCCCCAGCTGCTGGG 0: 1
1: 0
2: 1
3: 15
4: 171
1167288196_1167288209 6 Left 1167288196 19:48610663-48610685 CCTGGCCCGGCCCCTACCTCCGT 0: 1
1: 0
2: 1
3: 39
4: 540
Right 1167288209 19:48610692-48610714 GGGGTTCACCCCCAGCTGCTGGG 0: 1
1: 0
2: 1
3: 15
4: 171
1167288195_1167288209 7 Left 1167288195 19:48610662-48610684 CCCTGGCCCGGCCCCTACCTCCG 0: 1
1: 0
2: 3
3: 27
4: 467
Right 1167288209 19:48610692-48610714 GGGGTTCACCCCCAGCTGCTGGG 0: 1
1: 0
2: 1
3: 15
4: 171
1167288203_1167288209 -5 Left 1167288203 19:48610674-48610696 CCCTACCTCCGTGTTCCAGGGGT 0: 1
1: 0
2: 2
3: 8
4: 111
Right 1167288209 19:48610692-48610714 GGGGTTCACCCCCAGCTGCTGGG 0: 1
1: 0
2: 1
3: 15
4: 171
1167288201_1167288209 -4 Left 1167288201 19:48610673-48610695 CCCCTACCTCCGTGTTCCAGGGG 0: 1
1: 0
2: 3
3: 14
4: 211
Right 1167288209 19:48610692-48610714 GGGGTTCACCCCCAGCTGCTGGG 0: 1
1: 0
2: 1
3: 15
4: 171
1167288205_1167288209 -10 Left 1167288205 19:48610679-48610701 CCTCCGTGTTCCAGGGGTTCACC 0: 1
1: 0
2: 0
3: 3
4: 204
Right 1167288209 19:48610692-48610714 GGGGTTCACCCCCAGCTGCTGGG 0: 1
1: 0
2: 1
3: 15
4: 171
1167288197_1167288209 1 Left 1167288197 19:48610668-48610690 CCCGGCCCCTACCTCCGTGTTCC 0: 1
1: 0
2: 0
3: 20
4: 273
Right 1167288209 19:48610692-48610714 GGGGTTCACCCCCAGCTGCTGGG 0: 1
1: 0
2: 1
3: 15
4: 171
1167288193_1167288209 9 Left 1167288193 19:48610660-48610682 CCCCCTGGCCCGGCCCCTACCTC 0: 1
1: 0
2: 6
3: 121
4: 1230
Right 1167288209 19:48610692-48610714 GGGGTTCACCCCCAGCTGCTGGG 0: 1
1: 0
2: 1
3: 15
4: 171

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167288209 Original CRISPR GGGGTTCACCCCCAGCTGCT GGG Exonic
900120918 1:1048313-1048335 GGGCTTCACCTGCAGCTGCCCGG + Exonic
900159873 1:1218449-1218471 AGGGCTCACCTCCAGCTCCTCGG + Exonic
900352499 1:2242174-2242196 GAGGTTCACCACTAGCGGCTGGG - Intronic
900873974 1:5328089-5328111 AGGGTTAGCCCTCAGCTGCTGGG - Intergenic
900919433 1:5661387-5661409 GGGGTTGAACACCTGCTGCTCGG - Intergenic
901533560 1:9868196-9868218 GGGAGTCACTCCCTGCTGCTGGG - Intronic
901778828 1:11579001-11579023 GAGGTCCACTCCCAGCTGCCTGG - Intergenic
902366054 1:15975355-15975377 GGGATTCAAACCCCGCTGCTGGG + Intronic
903812497 1:26042636-26042658 GGGGTTCTCCTCCTGCTGGTTGG + Exonic
904517058 1:31064913-31064935 GGGGTTCACCCCTTGCTAGTAGG - Intronic
905479927 1:38254650-38254672 GGTGCTCATTCCCAGCTGCTGGG - Intergenic
906175157 1:43764847-43764869 GGGCTTATTCCCCAGCTGCTGGG - Intronic
910092744 1:83484547-83484569 GGGCTTCACACTCAGCAGCTGGG - Intergenic
913400699 1:118429568-118429590 GGGGATCCCTCCCAGCTTCTAGG - Intergenic
916782968 1:168056312-168056334 GGCGCCCACCCCCAGCTGCCAGG + Intronic
917924088 1:179774519-179774541 GGGGATCATTCTCAGCTGCTAGG - Intronic
920791216 1:209094767-209094789 GGAGTTCACTGCCAGCAGCTAGG + Intergenic
922725533 1:227921319-227921341 GGGACTCACCCCACGCTGCTAGG + Exonic
924811628 1:247407752-247407774 GGGACTGACCCCCAGGTGCTTGG - Intergenic
1063162362 10:3428250-3428272 GCAGGTCACACCCAGCTGCTGGG - Intergenic
1066294103 10:34039379-34039401 GGTGGTCACCCCCAGCTGGAAGG - Intergenic
1067845101 10:49713361-49713383 GGGATTCACACCCAGCCACTTGG + Intergenic
1069918248 10:71800306-71800328 GGGGTTCACTCCTTCCTGCTTGG + Intronic
1070719236 10:78744971-78744993 GACGCTCTCCCCCAGCTGCTGGG - Intergenic
1070818913 10:79343413-79343435 GTGGCTCACCCTCAGCTGCTGGG - Intergenic
1070986317 10:80693035-80693057 AGCTTTCTCCCCCAGCTGCTGGG - Intergenic
1071690377 10:87812393-87812415 GTGGTGCACACCCAGCTACTCGG - Intronic
1075382370 10:122029806-122029828 GGGGTTGAACCTGAGCTGCTTGG - Intronic
1075742615 10:124705113-124705135 GGGTGTCACCCCCAGCTGCAAGG - Intronic
1076915296 10:133420337-133420359 GGTGTCCACTCCCACCTGCTTGG - Exonic
1077144807 11:1040092-1040114 GGGCTTCACCCCCTGAGGCTTGG + Intergenic
1077245240 11:1533732-1533754 TGGGCTCACCCCCAGCTTCAAGG + Intergenic
1077286136 11:1766844-1766866 GGTGTGGACCCCCAGCAGCTGGG - Intergenic
1078191425 11:9094716-9094738 GGGGTTCACCTCCAGCTTAAGGG - Intronic
1080319681 11:30992292-30992314 GGGGTTAACCCTCAGCTACATGG - Intronic
1080394537 11:31877480-31877502 TGCCTTCACCCCCAGCTCCTGGG - Intronic
1081526447 11:43931169-43931191 GGGGTACACCTCCAGCAGCTGGG - Intronic
1084305270 11:68278596-68278618 GTGGTGCACCCCCAGCTCCACGG - Intergenic
1084570949 11:69959555-69959577 AGGCTTCATCCCCAGCTGCGAGG + Intergenic
1085308525 11:75501941-75501963 GGGGCTCACACCCAGGTGTTTGG - Intronic
1089196223 11:116695379-116695401 GGGGTTCACCTTTAGGTGCTGGG - Intergenic
1089210490 11:116797612-116797634 GGTGTGCACTCCCAGCTACTTGG - Intergenic
1091156326 11:133377522-133377544 TGGGGCCACCCACAGCTGCTGGG - Intronic
1095265111 12:40147266-40147288 GCCTTTCTCCCCCAGCTGCTTGG + Intergenic
1096879377 12:54655055-54655077 GGGGGTCAGGCCCAGCTGCATGG + Intergenic
1097259861 12:57712912-57712934 TGGTATCACCCCCAGCTGTTAGG + Intronic
1097594794 12:61615807-61615829 GAGGTCCACCCACAGCAGCTGGG - Intergenic
1099285223 12:80708298-80708320 GGCCTTAACCTCCAGCTGCTTGG + Intronic
1101673978 12:106900873-106900895 GGGGTTCTCCCACAGGTGGTGGG + Intergenic
1103936399 12:124479830-124479852 GGGGTGCACTCCCAGCTGCCTGG + Intronic
1104616942 12:130278534-130278556 GGTGTTGACCACCAGCCGCTTGG + Intergenic
1105547164 13:21359354-21359376 AGAGTGAACCCCCAGCTGCTGGG + Intergenic
1110451478 13:75641778-75641800 GTGGTACACTCCCAGCTACTCGG - Intronic
1114393726 14:22337934-22337956 GGCCTTCACCCTCAGCTGCTGGG + Intergenic
1115274325 14:31590450-31590472 GGGTTTCAAAACCAGCTGCTGGG + Intronic
1117456903 14:55907085-55907107 GAGGTCCATCCCCAGCTTCTAGG + Intergenic
1119018956 14:71089584-71089606 GGGGTTCTCCCCCTTTTGCTTGG - Intronic
1119320836 14:73729444-73729466 GGGGGGCCCGCCCAGCTGCTTGG - Intronic
1120098721 14:80419985-80420007 GGTTTTCTCCCCCAGCTGCCTGG - Intergenic
1123425684 15:20168660-20168682 GCCCTGCACCCCCAGCTGCTGGG + Intergenic
1123534912 15:21175187-21175209 GCCCTGCACCCCCAGCTGCTGGG + Intergenic
1124126973 15:26945175-26945197 GGGGTTCCACCCCTGCTGCCAGG + Intronic
1124189009 15:27555165-27555187 GGTGTTCAGGCCCAGCAGCTAGG - Intergenic
1125327442 15:38550122-38550144 GTGGTGCACACCCAGCTACTCGG + Intronic
1126205332 15:46038764-46038786 GGGGTTCTCCCCCTTTTGCTTGG - Intergenic
1128175693 15:65553854-65553876 GTGGTTCAGCAGCAGCTGCTGGG + Intronic
1128182892 15:65620613-65620635 TGGGTTTACCCCCAGCGGGTAGG + Intronic
1128495920 15:68198372-68198394 GGGGGTCACCACCATCTGCTAGG - Intronic
1128699813 15:69795990-69796012 GGGGGTCCTCCCCAGCAGCTAGG - Intergenic
1132280686 15:100611943-100611965 GGGGATCAGTCCCAGCTACTTGG - Intronic
1132355706 15:101169828-101169850 AGGGTCCACCAGCAGCTGCTGGG - Intergenic
1132506963 16:315197-315219 GAGGTTCCTCCCCAGCTCCTGGG + Intronic
1132709204 16:1258940-1258962 GGCGTCCACCACCAGCTGCCTGG - Exonic
1132855801 16:2044080-2044102 GGGCTTCCCCACCAGCTGCCAGG + Intronic
1133295266 16:4748852-4748874 GGGGTTCACCCCTGGCTGCCAGG + Exonic
1137538110 16:49342628-49342650 GGGGTCCCCTCCCAGCAGCTGGG + Intergenic
1140040515 16:71404470-71404492 GTGGTCCAACCCCAGCTCCTGGG + Intergenic
1140263400 16:73399877-73399899 AGGGTACACCCCCAGAGGCTGGG + Intergenic
1140415519 16:74771449-74771471 GTGGTGCCCTCCCAGCTGCTTGG - Intronic
1141086010 16:81096168-81096190 GGCGCCCACCCCCAGCTGCCAGG + Exonic
1141841448 16:86576719-86576741 GAGGTTCACCCCCAGGACCTAGG + Intronic
1203120131 16_KI270728v1_random:1529351-1529373 GCCCTGCACCCCCAGCTGCTGGG - Intergenic
1142560372 17:805934-805956 GTGTTTGACCCCCAGCAGCTGGG - Intronic
1142604331 17:1073307-1073329 GGGTTTCTCTCCCAGCTGCTCGG - Intronic
1142919153 17:3169469-3169491 TGGGTTCTGACCCAGCTGCTGGG - Intergenic
1143857367 17:9862126-9862148 GGGGATTCCCCACAGCTGCTAGG - Intronic
1143873140 17:9972015-9972037 GGGCTTCTCCCCCAGCTACAGGG + Intronic
1148954834 17:51345049-51345071 GAGGTTGAACCCCAGCTACTCGG + Intergenic
1151971679 17:77460628-77460650 GGGGGCCACCCCCAGCAGCTGGG + Intronic
1152448963 17:80364313-80364335 GGGGTCCAGGCCCAGCGGCTGGG - Intronic
1152722099 17:81928200-81928222 GGGGATCGCCCCTCGCTGCTGGG - Intergenic
1153015725 18:580797-580819 GAGGTTCTCCCCCAGCTCGTTGG - Exonic
1154481525 18:14831051-14831073 GGGCTCCAGCCCCAGCTACTGGG + Intronic
1156584381 18:38415752-38415774 GGGGTACACCCCAAGCTGCTGGG - Intergenic
1160873426 19:1286887-1286909 GGGGCTGACCCCCAGCTCCCCGG - Intronic
1161016345 19:1985608-1985630 GGGAGCCACCCCCAGGTGCTGGG - Exonic
1161068142 19:2248262-2248284 GGGGTTCACCCCCAGGCCCCGGG + Exonic
1165716286 19:38047877-38047899 GGGGTTAATCCCCAGCTGACTGG - Intronic
1165902112 19:39173832-39173854 TGGGTCCACCACCAGCTGCAGGG - Exonic
1166074917 19:40408342-40408364 GAGGGTCACCTCCAGCTCCTTGG + Exonic
1167288209 19:48610692-48610714 GGGGTTCACCCCCAGCTGCTGGG + Exonic
925980316 2:9171311-9171333 GGCATTCATTCCCAGCTGCTGGG - Intergenic
933967166 2:87439652-87439674 GGTGGCCACCCCCAGCTGCAAGG + Intergenic
934044414 2:88160710-88160732 GAGCTTCTTCCCCAGCTGCTGGG + Intergenic
936030671 2:109067920-109067942 GGGCTCCAGCTCCAGCTGCTGGG + Intergenic
936326629 2:111510843-111510865 GGTGGCCACCCCCAGCTGCAAGG - Intergenic
947549543 2:231036937-231036959 GGGTTTCAACCCCAGCGCCTGGG + Intergenic
947766757 2:232642808-232642830 GAGGGTCACCTCCAGCTGGTTGG + Intronic
1169429687 20:5525448-5525470 GTGGTGCACTCCCAGCTACTCGG + Intergenic
1172863686 20:38078040-38078062 GTGGTTCATGCCCAGCTACTGGG + Intronic
1173780746 20:45754863-45754885 GGGATTCATCCCCAGATGCAAGG + Intronic
1174115623 20:48224668-48224690 GGGCTTCACGCCCAGCTCCAGGG + Intergenic
1175999520 20:62825711-62825733 GGGCAACACCCCCAGCTGCTTGG + Intronic
1176073517 20:63238448-63238470 GAGACTCACTCCCAGCTGCTGGG + Exonic
1179117474 21:38507299-38507321 TGGCTTCATCCCCAACTGCTCGG + Intronic
1181807470 22:25383726-25383748 GCTGTTCACCCGCAGCTGCCTGG - Intronic
1182257280 22:29048384-29048406 GGGGATGACCCGCAGCTCCTGGG - Exonic
1183095274 22:35548200-35548222 AGGGCTCACACCCAGGTGCTGGG - Intronic
1183762234 22:39832183-39832205 GTGATGCACTCCCAGCTGCTTGG + Intronic
1185273820 22:49941332-49941354 GGGGTTCACTCCCATCAGGTGGG + Intergenic
1185395054 22:50582563-50582585 GGGGTAAACCCTCAGCTCCTCGG + Exonic
949882466 3:8672591-8672613 GGTGTACACCCCCTGCTGTTTGG + Intronic
950053954 3:10010998-10011020 GAGGGTCACCCCCCGCAGCTTGG - Intronic
950703713 3:14767280-14767302 GGGCTCCAACCCCAGCTGCTAGG + Intronic
950709822 3:14806131-14806153 GAGGTTCACCCCCTTCTGCGTGG + Intergenic
954806728 3:53224925-53224947 GGATTTCTCCCCCTGCTGCTCGG - Intronic
955537721 3:59942068-59942090 AGGGTCCACCCCTAGTTGCTAGG - Intronic
957124075 3:76135075-76135097 GGAGTTCCCCTCCAGCTGGTAGG + Intronic
960939961 3:122927136-122927158 GGGGTTCAACCCCAAGGGCTAGG + Intronic
961390711 3:126550844-126550866 GGGGCTGAACCCCTGCTGCTGGG - Intronic
961404975 3:126672364-126672386 GGGGTTCACCCCCAGGCCCCAGG - Intergenic
961957518 3:130819220-130819242 GGCGTTCTCCTCCAGCTGCAAGG - Intergenic
963531452 3:146477042-146477064 GGGGTTCTCACCCAGCTGGGAGG - Intronic
965448353 3:168804620-168804642 GTGGTGCACTCCCAGCTACTTGG + Intergenic
967779731 3:193423500-193423522 GGGATTCACCCCAAGATGCAAGG + Intronic
968434549 4:577585-577607 GGGGTGCAGGCCCAGCTGCTCGG - Intergenic
968929256 4:3569881-3569903 GCTGGTCACCCCCAGCAGCTTGG + Intergenic
968969308 4:3785270-3785292 GGGGTTGATGCCAAGCTGCTTGG + Intergenic
971266840 4:25103238-25103260 TGGGGTCGCCCCAAGCTGCTGGG - Intergenic
972399615 4:38688733-38688755 GGAGTTCACCCCCTTCGGCTGGG + Exonic
975682149 4:76887319-76887341 GGGGTTCACTCCCAGCTTCAAGG + Intergenic
975774569 4:77771185-77771207 GTGGTGCACGCCCAGCTACTTGG + Intronic
982034806 4:151335151-151335173 GGGGTTTCACCCCATCTGCTAGG - Intergenic
985775351 5:1838234-1838256 CAGGTTCACCCCCAGCAGCGAGG - Intergenic
987085785 5:14466196-14466218 GAGGTTTGCCCCCAGCTTCTAGG - Intronic
989195126 5:38708931-38708953 TGGGTGAACCCCCAGCTTCTAGG - Intergenic
998338179 5:141392959-141392981 GGGGTCCAGCCCCAGGTCCTTGG - Exonic
998409230 5:141896579-141896601 GGCGTCCACACCCAGCTGCCAGG + Intergenic
998516656 5:142761569-142761591 GGGGCTCACGCCCAGGAGCTGGG - Intergenic
999055399 5:148570094-148570116 TGGGCTCACACCCAGCTGCTTGG - Intronic
1001503199 5:172255207-172255229 GGAGTTCACCTCCTTCTGCTGGG - Intronic
1001942469 5:175750509-175750531 GGGGTTCAGCCACAGTCGCTTGG + Intergenic
1003528630 6:6919536-6919558 GATCTACACCCCCAGCTGCTTGG - Intergenic
1006375645 6:33670390-33670412 CAGGTCCACGCCCAGCTGCTGGG - Exonic
1006472992 6:34238359-34238381 GGGGTTTAGCCCTAGCCGCTAGG + Intronic
1006799838 6:36752822-36752844 GGAGTTCCCTCCAAGCTGCTTGG + Intronic
1008510078 6:52267803-52267825 GGCGTGCACCCCCAACTTCTTGG + Intronic
1011522657 6:88226284-88226306 GTGGTGCACTCCCAGCTACTTGG - Intergenic
1022788122 7:33659529-33659551 GGAGTTCAAGACCAGCTGCTTGG - Intergenic
1027309604 7:76941043-76941065 GGGCTTCACACTCAGCAGCTGGG - Intergenic
1030246992 7:107393555-107393577 GGGGTGGGCCCACAGCTGCTTGG + Intronic
1033756299 7:144400218-144400240 GGGGGTCACCCCCACCGTCTGGG + Exonic
1034110093 7:148528506-148528528 GTTGCTCACCCGCAGCTGCTGGG - Intergenic
1035943730 8:3934719-3934741 GTGGTGCACTCCCAGCTACTCGG + Intronic
1039884570 8:41647724-41647746 GGGGTTCAACCCCAGATGTGGGG - Intronic
1040881382 8:52208690-52208712 GTGGTGCAGTCCCAGCTGCTAGG + Intronic
1042040928 8:64587474-64587496 TGGGTTCACACGCAGCTGCCAGG + Intergenic
1044522046 8:93209904-93209926 GAGGTTCACTCCCAGCAGCAGGG - Intergenic
1044711105 8:95058915-95058937 GTGGTGCACGCCCAGCTACTAGG + Intronic
1045400488 8:101811718-101811740 TGGGTTCACTCCCAGCTGGAAGG - Intronic
1048503115 8:134996706-134996728 CGGGGTCACCCCTAGCTGCAAGG + Intergenic
1049670925 8:143869534-143869556 GGCCTTCACCGCCGGCTGCTCGG + Exonic
1052830603 9:33212204-33212226 AGGGTTAGCCCCCAGCAGCTGGG + Intergenic
1052909246 9:33865328-33865350 GTGGTGCACTCCCAGCTACTCGG - Intronic
1052915764 9:33923440-33923462 GAGGTTCACCCCATGTTGCTTGG + Exonic
1053803953 9:41783318-41783340 GCTGGTCACCCCCAGCAGCTTGG + Intergenic
1054141327 9:61532139-61532161 GCTGGTCACCCCCAGCAGCTTGG - Intergenic
1054192256 9:61994816-61994838 GCTGGTCACCCCCAGCAGCTTGG + Intergenic
1054461019 9:65462576-65462598 GCTGGTCACCCCCAGCAGCTTGG - Intergenic
1054646150 9:67593875-67593897 GCTGGTCACCCCCAGCAGCTTGG - Intergenic
1057314079 9:93958046-93958068 GGTGTGCACCCCCAGCTCCTTGG + Intergenic
1060158370 9:121336455-121336477 AGAATTCACCCCCACCTGCTAGG - Intergenic
1061140866 9:128765667-128765689 GGGTTTTCCCCCCAGCTCCTAGG - Intronic
1061189554 9:129074075-129074097 GGAGTTCATCCCCAGTTGATTGG - Intergenic
1061416198 9:130448185-130448207 GGGGTGCCCCACCCGCTGCTGGG + Intronic
1062625138 9:137439044-137439066 TGGGTTCACCCACAGCCCCTCGG - Intronic
1188481653 X:30642246-30642268 GGGTTTCACACCCAGATGATGGG + Intergenic
1198463897 X:136887850-136887872 GTGGTTCAATCCCAGCTACTCGG - Intergenic