ID: 1167288222

View in Genome Browser
Species Human (GRCh38)
Location 19:48610736-48610758
Sequence GCTGCTGGCGGTCCAGGAGC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 413
Summary {0: 1, 1: 0, 2: 4, 3: 41, 4: 367}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167288211_1167288222 12 Left 1167288211 19:48610701-48610723 CCCCAGCTGCTGGGCCAGTTCCA 0: 1
1: 0
2: 2
3: 49
4: 418
Right 1167288222 19:48610736-48610758 GCTGCTGGCGGTCCAGGAGCAGG 0: 1
1: 0
2: 4
3: 41
4: 367
1167288213_1167288222 10 Left 1167288213 19:48610703-48610725 CCAGCTGCTGGGCCAGTTCCAGG 0: 1
1: 0
2: 3
3: 57
4: 404
Right 1167288222 19:48610736-48610758 GCTGCTGGCGGTCCAGGAGCAGG 0: 1
1: 0
2: 4
3: 41
4: 367
1167288217_1167288222 -2 Left 1167288217 19:48610715-48610737 CCAGTTCCAGGAAGGCAGGCAGC 0: 1
1: 0
2: 4
3: 33
4: 337
Right 1167288222 19:48610736-48610758 GCTGCTGGCGGTCCAGGAGCAGG 0: 1
1: 0
2: 4
3: 41
4: 367
1167288210_1167288222 13 Left 1167288210 19:48610700-48610722 CCCCCAGCTGCTGGGCCAGTTCC 0: 1
1: 1
2: 2
3: 47
4: 385
Right 1167288222 19:48610736-48610758 GCTGCTGGCGGTCCAGGAGCAGG 0: 1
1: 0
2: 4
3: 41
4: 367
1167288218_1167288222 -8 Left 1167288218 19:48610721-48610743 CCAGGAAGGCAGGCAGCTGCTGG 0: 1
1: 0
2: 10
3: 77
4: 638
Right 1167288222 19:48610736-48610758 GCTGCTGGCGGTCCAGGAGCAGG 0: 1
1: 0
2: 4
3: 41
4: 367
1167288212_1167288222 11 Left 1167288212 19:48610702-48610724 CCCAGCTGCTGGGCCAGTTCCAG 0: 1
1: 0
2: 4
3: 38
4: 282
Right 1167288222 19:48610736-48610758 GCTGCTGGCGGTCCAGGAGCAGG 0: 1
1: 0
2: 4
3: 41
4: 367
1167288207_1167288222 24 Left 1167288207 19:48610689-48610711 CCAGGGGTTCACCCCCAGCTGCT 0: 1
1: 0
2: 3
3: 26
4: 221
Right 1167288222 19:48610736-48610758 GCTGCTGGCGGTCCAGGAGCAGG 0: 1
1: 0
2: 4
3: 41
4: 367

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167288222 Original CRISPR GCTGCTGGCGGTCCAGGAGC AGG Exonic
900146025 1:1158951-1158973 GCTGCTGGAGGACCCCGAGCTGG - Intergenic
900642100 1:3692627-3692649 GTTCCAGGCGGTCCAGCAGCCGG - Intronic
900765486 1:4502173-4502195 GCTGCTGATGGTCCAGGGGGTGG - Intergenic
901646006 1:10717068-10717090 GCTGCTGGAGGGACAGGAGCAGG + Intronic
902747310 1:18482439-18482461 GGTACTGGCGGCCCCGGAGCCGG - Exonic
902761136 1:18581459-18581481 GCTGGAGGTGGCCCAGGAGCAGG - Intergenic
902810644 1:18886053-18886075 GTGGCTGGGGGTCCAGGAACTGG - Intronic
902814279 1:18907386-18907408 GCTGCTGGCAGTGCAGGAGCTGG - Exonic
903068076 1:20711922-20711944 CCTCCTGGCAGTCCAGGAGGAGG - Intronic
903299482 1:22368544-22368566 GATGCTGGCAGCCCAGGAGCTGG + Intergenic
903330172 1:22593179-22593201 GGTGCTGGCTGTCCTGGGGCTGG + Intronic
904014601 1:27409913-27409935 GCTGCTGGTGGTGGAGGAGGAGG + Exonic
904625145 1:31798236-31798258 GCAGCTGGCCCCCCAGGAGCTGG - Exonic
905106322 1:35565591-35565613 GCTGCAGGCGGGCGAGGAGACGG + Exonic
905932843 1:41801773-41801795 GCCCCTAGGGGTCCAGGAGCAGG + Intronic
905960699 1:42040258-42040280 GCTGCTGGAGTGCCAGGAGGAGG + Intergenic
906674005 1:47680049-47680071 GCTGCTGGCCCTCCATGAGGTGG - Intergenic
906724657 1:48035517-48035539 GCAGCTGGAGGTCAAGCAGCTGG - Intergenic
907486515 1:54781722-54781744 GCTGCTGGCGGTGGACGAGGCGG - Exonic
908277927 1:62495669-62495691 TCTGCTGCAGGTCCAGGATCTGG - Exonic
908474030 1:64470903-64470925 GAGGCTGGCGGCCGAGGAGCTGG + Exonic
911771495 1:101748308-101748330 GCTGTTGGCAGACCAGAAGCTGG + Intergenic
912715799 1:111982734-111982756 GCGGCTGCCGGCCCAAGAGCTGG - Exonic
912993375 1:114510718-114510740 GAGGCTGGCGGTCCAGGAGGCGG + Exonic
913160406 1:116139999-116140021 GAGGCTGGTGGTCCAAGAGCAGG - Intergenic
913269107 1:117075551-117075573 GCCGCTGGTCCTCCAGGAGCAGG - Exonic
913702566 1:121386667-121386689 GCTGCTGCCCGTCTGGGAGCAGG + Intronic
914043129 1:144067162-144067184 GCTGCTGCCCGTCTGGGAGCAGG + Intergenic
914134957 1:144893326-144893348 GCTGCTGCCCGTCTGGGAGCAGG - Intronic
914463940 1:147909500-147909522 GCTGCTGGGGTTGGAGGAGCGGG - Intergenic
915472811 1:156135972-156135994 GCTGCTGGCGGAAAAGGAGCGGG + Exonic
917292166 1:173481668-173481690 GCTGCTGGCAGGCCAAGAGGAGG - Intronic
919758236 1:201079364-201079386 GCTGCTGGGAGGTCAGGAGCAGG - Intronic
920066530 1:203273475-203273497 GCTGCCGGGAGTCCAGGACCGGG - Intronic
920446756 1:206023749-206023771 GCTGCTGGTGCTCCTGGAGCTGG - Exonic
920489995 1:206405410-206405432 GCTGCTGCCCGTCTGGGAGCAGG + Intronic
922414002 1:225403821-225403843 GCTGGTGGAGGTGGAGGAGCTGG - Intronic
922822336 1:228493211-228493233 GCTGCAGGCGGTCTCGGAGCTGG + Exonic
923402905 1:233632537-233632559 GCTGCTGGCTGTCCTGGTGGTGG + Intronic
923955323 1:239011582-239011604 GCTGGTGGCTGGCCAGGGGCTGG - Intergenic
924324616 1:242883194-242883216 CCTGCTGGGGGTCCAGGTGCAGG - Intergenic
924482110 1:244445141-244445163 GCTGCTGAAATTCCAGGAGCAGG + Intronic
1062818683 10:518346-518368 GCTGCCAGCGGTGCAAGAGCAGG - Intronic
1063366236 10:5492728-5492750 GCTGATGGTGGCCCAGGAGGAGG + Intergenic
1064582708 10:16810447-16810469 GCTGCTGGGGGAACAGCAGCAGG - Intronic
1065917336 10:30364835-30364857 ACTGCTGGAGCTGCAGGAGCTGG - Intronic
1065917709 10:30366573-30366595 GCTGCAGCTGGTCCATGAGCTGG + Intronic
1067233454 10:44427535-44427557 GCAGCAGGAGGTCCAGGACCTGG - Intergenic
1069778338 10:70939624-70939646 GCTGCTGGAGGCACAGGGGCAGG + Intergenic
1069904640 10:71725140-71725162 GCTGCAGGCCTTCCCGGAGCAGG + Intronic
1069915751 10:71785651-71785673 TCCGCTCGCGGTCCAGGGGCCGG - Intronic
1069997703 10:72353228-72353250 GCTGCTGCGGGCTCAGGAGCAGG - Intronic
1070703348 10:78619084-78619106 GCTCCTGGGGGTGCAGAAGCAGG - Intergenic
1073081283 10:100862588-100862610 GCTGCTGGTGTTCCAGCAGGTGG - Intergenic
1075485036 10:122814962-122814984 GCTGCTGCCGGTCATGGACCCGG + Intergenic
1076242328 10:128917692-128917714 GCTGCTGCCAGTGCAGGGGCTGG - Intergenic
1076272119 10:129162917-129162939 GCTGCTGCGGGTCCTGCAGCAGG + Intergenic
1076541748 10:131219372-131219394 GCCGCTGGCGGTCCTGGGGTCGG - Intronic
1076718883 10:132384018-132384040 GCTGCTGGAGGCCCTGGGGCAGG - Intergenic
1076793594 10:132788575-132788597 TCTGCTCGCGGGCCAGGAGGTGG - Intergenic
1076885583 10:133261027-133261049 GCTACTGGAGGACAAGGAGCAGG - Intergenic
1077195288 11:1276845-1276867 GTTCCTGGCGGTCCAGGACGGGG - Exonic
1077545369 11:3166925-3166947 GATGCTGGCTGTCCAGGGCCTGG + Intergenic
1077662490 11:4082330-4082352 GCTGCTGGTGGCCAAGGAGGGGG + Exonic
1078050301 11:7960099-7960121 GCTGCTGGAGGTAAAGGAGCAGG - Exonic
1078144308 11:8712640-8712662 GCTGCTGGAGTGGCAGGAGCGGG - Exonic
1080870078 11:36229267-36229289 GCTGCTGGCTGCCTGGGAGCTGG - Exonic
1081706122 11:45182752-45182774 GCAGCTGGCTGTCCATGAGTGGG + Intronic
1081984227 11:47289951-47289973 GCTGCTCGCTCTCCAGCAGCCGG - Exonic
1082001533 11:47395811-47395833 GCTGTTGGGTGTCCAGGGGCGGG - Intergenic
1083636873 11:64125555-64125577 GCTGCTGGCGGGGCAGGAGCAGG - Intronic
1083800139 11:65041748-65041770 GCTGCTGCAGGCCCAGGTGCAGG + Exonic
1083927675 11:65818318-65818340 GCTCCCGGCGTTCCAGGAGGGGG - Intergenic
1084426074 11:69085191-69085213 CCACCTGGCGGGCCAGGAGCCGG - Exonic
1084468529 11:69341595-69341617 GCTGCTGTGGGTCCAGGGGCTGG - Intronic
1084791214 11:71476312-71476334 GCAGCTGGCTTTGCAGGAGCAGG + Intronic
1084936762 11:72590771-72590793 GCGTCCGGCGGTCCAGGAACAGG + Intronic
1085295600 11:75430005-75430027 GCTGCTGGCGGACCCCGCGCTGG - Exonic
1086697625 11:89863934-89863956 GCTGCAGGCGCTGCAGGGGCAGG + Intergenic
1086708534 11:89980554-89980576 GCTGCAGGCGCTGCAGGGGCAGG - Intergenic
1088598263 11:111455683-111455705 GCTGCAGGGGGTCCCGGAACTGG + Intronic
1089163593 11:116458072-116458094 GCTGGTGGGGGGCCAGGGGCGGG + Intergenic
1089284164 11:117394988-117395010 TCTGCTGGAGGTCCAGGTGAGGG + Exonic
1089599219 11:119603219-119603241 GCTGGAGGCCGCCCAGGAGCGGG - Intergenic
1090422217 11:126583261-126583283 GCTGCTGGCAGGCCTAGAGCGGG - Intronic
1090797880 11:130150891-130150913 GCCGCTGCCGTCCCAGGAGCAGG - Intergenic
1091449931 12:566043-566065 GCTGAAGGCGGTGCTGGAGCAGG - Exonic
1093963726 12:25303360-25303382 GCTGCTGGCTGTGTGGGAGCTGG + Intergenic
1094494562 12:30981257-30981279 GCTGCTGGAGGGCCGGGTGCTGG - Intronic
1096195839 12:49648315-49648337 GCTGCTGGACGTGAAGGAGCTGG - Exonic
1096309180 12:50505206-50505228 GCAGCTGGCGGAGCTGGAGCTGG + Exonic
1100980543 12:100159020-100159042 GCTGCAGCCGGTCCACGAGCTGG + Intergenic
1103641366 12:122355198-122355220 GCTGCTGGCGGAACGGGATCTGG - Exonic
1104756130 12:131270405-131270427 CCTGCAGGCAGTCCCGGAGCGGG + Intergenic
1104777647 12:131400620-131400642 CCTGCAGGCAGTCCCGGAGCTGG - Intergenic
1104947626 12:132423622-132423644 GCTGCAGGCGGAGCAGGGGCTGG + Intergenic
1106027465 13:25968602-25968624 GCTGGAGGAGGTGCAGGAGCTGG + Exonic
1106665410 13:31846585-31846607 GCTGCTGGCGGCCCAGAGACTGG - Intergenic
1107910489 13:45101017-45101039 GCTGCTGGCATGCGAGGAGCTGG + Intergenic
1108518211 13:51222381-51222403 GCGTCTGGCGGCCCGGGAGCCGG - Exonic
1112376285 13:98844607-98844629 GCTGCTGGTGGCCAAGCAGCAGG - Intronic
1113254914 13:108495944-108495966 GCTGCGCGCGGTCCAAGCGCGGG + Intergenic
1117242686 14:53850744-53850766 TCAGCAGGTGGTCCAGGAGCAGG + Intergenic
1117351520 14:54886001-54886023 GCTGGTAGCATTCCAGGAGCTGG - Intronic
1117366951 14:55038541-55038563 GCTGCTGGAGTTCTGGGAGCTGG + Intronic
1117369380 14:55062837-55062859 GGTGCTGGGGGTCCTGGAGGTGG - Exonic
1122517644 14:102319885-102319907 GCTGCGGCAGGTCCTGGAGCAGG + Exonic
1122647737 14:103206380-103206402 GCTCCTGGGGGTCCTGGTGCCGG - Intergenic
1122975264 14:105168354-105168376 GCTGCTGGCGCTCTGGGTGCAGG - Exonic
1123119511 14:105910220-105910242 GCTGAAGGGGGTCCAGGACCAGG - Intergenic
1123120728 14:105915201-105915223 GCTGCTGGCTGTGGAGGAGCTGG + Intergenic
1123403445 15:20006764-20006786 GGTGCTGGCTGTGGAGGAGCTGG + Intergenic
1123473713 15:20572324-20572346 GCTGCTGGAGCTGCAGGAGATGG + Intergenic
1123512783 15:21013418-21013440 GGTGCTGGCTGTGGAGGAGCTGG + Intergenic
1123644296 15:22428029-22428051 GCTGCTGGAGCTGCAGGAGATGG - Intergenic
1123734013 15:23167335-23167357 GCTGCTGGAGCTGCAGGAGATGG + Intergenic
1123980480 15:25597449-25597471 GCTGCTGGTGGAGCAGGAACCGG - Intergenic
1124284516 15:28388646-28388668 GCTGCTGGAGCTGCAGGAGATGG + Exonic
1124298181 15:28522968-28522990 GCTGCTGGAGCTGCAGGAGATGG - Exonic
1124959073 15:34381829-34381851 GCTGCTGGAGCTGCAGGAGATGG - Exonic
1124975699 15:34528050-34528072 GCTGCTGGAGCTGCAGGAGATGG - Exonic
1125676035 15:41503058-41503080 GCCGCCGGTGGTCCAGGATCTGG - Exonic
1125685015 15:41558949-41558971 GCTGCGGGCGGGCCGGGAGGAGG + Intronic
1127772890 15:62244834-62244856 GCTGCAGCTGGTCCACGAGCTGG + Intergenic
1127793935 15:62422645-62422667 GCTGCTGGAGTGCCAGGAGATGG - Intronic
1127918722 15:63476520-63476542 GCAGCTGGAAGACCAGGAGCAGG + Intergenic
1128792752 15:70445100-70445122 GATGCTGGCCATCCTGGAGCTGG - Intergenic
1128849483 15:70938517-70938539 GATGCTTGTGGTCCAGGAGGTGG + Intronic
1129030061 15:72611519-72611541 GCTGCAGCTGGTCCACGAGCTGG - Intergenic
1129038286 15:72664267-72664289 GCTGCAGCTGGTCCACGAGCTGG - Intronic
1129476319 15:75786534-75786556 GCTGCTGGAGCTGCAGGAGCTGG + Intergenic
1129728725 15:77917239-77917261 GCTGCAGCTGGTCCACGAGCTGG + Intergenic
1129839791 15:78736632-78736654 GCTGCAGCTGGTCCACGAGCTGG - Intergenic
1129921365 15:79322046-79322068 GCTGCGGGAGGCCCAGGACCGGG + Exonic
1129988921 15:79944713-79944735 GCTAGTAGCGTTCCAGGAGCTGG + Intergenic
1131282549 15:91033133-91033155 GCTGCAGCTGGTCCATGAGCTGG + Intergenic
1131731054 15:95281859-95281881 GCTTCTGGCTTTCCAGGACCTGG + Intergenic
1132641720 16:981208-981230 GCTGCCTGCGGTCCAGGACAGGG - Intronic
1132689613 16:1176670-1176692 GCTGATGGGGGTCCGGGGGCCGG + Intronic
1132915715 16:2342035-2342057 GCTGCTGCCGGTCCTGCCGCTGG + Intergenic
1133021705 16:2969754-2969776 GCTGCTGGCGGGCCGGTACCCGG - Exonic
1133203445 16:4218633-4218655 GCTGCTGGTGATGGAGGAGCAGG - Intronic
1134247633 16:12551837-12551859 GCTGCTGGGGACACAGGAGCAGG + Intronic
1134628735 16:15741567-15741589 GCGGCTGGCGGCCAAGAAGCAGG - Exonic
1135993252 16:27230184-27230206 GCAGCTGTCCGTCCAGGAGAAGG - Intronic
1136512790 16:30749105-30749127 GCTGCTGGTGGTGCTGGTGCTGG + Intronic
1136926030 16:34375199-34375221 GCTGCTGGCTTTCTAGAAGCAGG - Intergenic
1136978544 16:35036607-35036629 GCTGCTGGCTTTCTAGAAGCAGG + Intergenic
1137531968 16:49283434-49283456 GCTGCTGGCGATCCCAAAGCTGG - Intergenic
1137668623 16:50266503-50266525 GCTGCTGCCGCTGCCGGAGCAGG + Exonic
1137769510 16:51004706-51004728 GCTGGGGACAGTCCAGGAGCAGG - Intergenic
1138782655 16:59807923-59807945 GCTACTGGGGCTCCAGGATCTGG - Intergenic
1139584552 16:67893458-67893480 GCTGCAGGCTGACCAGGGGCAGG - Intronic
1140188457 16:72794917-72794939 GCAGCTGGCTGGCCAGGAGTGGG + Exonic
1140889433 16:79272397-79272419 GGGGCTGGCAGCCCAGGAGCAGG - Intergenic
1141967532 16:87456398-87456420 GCTGCTGGGGCTACAGGTGCCGG - Intronic
1142225804 16:88877100-88877122 GCTTCGGGCGGTCCAGGCACCGG + Exonic
1142482536 17:227702-227724 GCTGCTGGCTGTCCTTGTGCCGG - Intronic
1142496624 17:309599-309621 CCTGCTGGGGGTCCAGGATATGG + Intronic
1142496664 17:309712-309734 CCTGCTGGGGGTCCAGGATACGG + Intronic
1142623499 17:1179274-1179296 GAAGCTGCCGGTCCAGGGGCGGG + Intronic
1143650111 17:8258093-8258115 GCCGCTGGCCGTCTGGGAGCTGG - Exonic
1144021136 17:11240981-11241003 GCGACTGGCGCTCCGGGAGCAGG - Intergenic
1144458608 17:15439341-15439363 CCTCGTGGCTGTCCAGGAGCTGG + Intronic
1145235309 17:21203758-21203780 GCTGCTGGGTGGTCAGGAGCTGG - Intronic
1145401060 17:22533465-22533487 GCTGCCAGCGGCCCAGGATCTGG - Intergenic
1147334140 17:39716610-39716632 GCTGCTGGCGGGCTCAGAGCTGG + Intronic
1147514365 17:41101871-41101893 GCTGCTGGAGATGCAGCAGCTGG + Exonic
1147516584 17:41123673-41123695 GCTGCTGGAGATGCAGCAGCTGG + Exonic
1147768905 17:42854548-42854570 GCTGCTGGAGATGGAGGAGCAGG + Exonic
1148225222 17:45894571-45894593 GCTGCTGTTGGTGCCGGAGCTGG - Exonic
1148774467 17:50087889-50087911 GCTGGTGGAGGTCCCGGAGCAGG - Intronic
1150302188 17:64055867-64055889 GCTGCTGCTGCTGCAGGAGCTGG + Exonic
1150481760 17:65516607-65516629 GCTGCCGGAGGTCAGGGAGCAGG + Intergenic
1150854241 17:68735145-68735167 GCTGCTGGCTGTCAAGCAGCTGG - Intergenic
1151895084 17:76974724-76974746 GCTCTTGGGGGGCCAGGAGCAGG + Intergenic
1152465538 17:80464235-80464257 GCAGCTGGGGGACCTGGAGCCGG + Intergenic
1152466925 17:80471731-80471753 GCTGGTGCTGGGCCAGGAGCAGG - Exonic
1152554484 17:81046101-81046123 GCAGCTGGGCGTGCAGGAGCCGG - Intronic
1152594358 17:81230961-81230983 GCTGGGGTCTGTCCAGGAGCCGG - Intronic
1152630669 17:81409455-81409477 GGTTCTGGAGGGCCAGGAGCGGG + Intronic
1152662164 17:81547546-81547568 GGTGCTGGTGGTGCAGGAGATGG + Exonic
1152754024 17:82079509-82079531 GCTCCTGGCGGTCCAGGCCCTGG + Exonic
1152799081 17:82322769-82322791 CCTGCTGGGGCTCCAGGAGAGGG - Intronic
1153522164 18:5963456-5963478 GCTGCTTGCGGGCCAGGTGGAGG - Intronic
1153815135 18:8784687-8784709 GCTGCAGGCCTTCCTGGAGCAGG + Exonic
1154049030 18:10935796-10935818 GCTGCTGGCGAGGCAGGAGCAGG - Intronic
1155030408 18:21979006-21979028 GCAGCTGGGGGTTCCGGAGCAGG + Intergenic
1156418966 18:36929806-36929828 GCAGCTGGAAGTCCAGGATCAGG - Intronic
1157479035 18:48040978-48041000 GCTCCTGGTGGTGCAGGAGCAGG - Exonic
1157715141 18:49879784-49879806 ACTGATGGCAGCCCAGGAGCTGG + Intronic
1158570839 18:58595890-58595912 GATGCTGGTGGTCCAAGACCAGG + Intronic
1160183421 18:76655671-76655693 GGTCCTGGAGGACCAGGAGCAGG - Intergenic
1160500051 18:79396878-79396900 GGTCCTGCAGGTCCAGGAGCCGG - Intronic
1160747656 19:719547-719569 GGTGCTGGGGGTCCCGGGGCAGG - Intronic
1160747666 19:719568-719590 GCTGCTGGGGGTCCCAGGGCAGG - Intronic
1160792619 19:929570-929592 GCAGCGGGCGCGCCAGGAGCTGG + Exonic
1161428523 19:4217518-4217540 GCTGCGGGCGGCCCTGGAGCAGG + Exonic
1161553831 19:4929275-4929297 GGCTCTGGCGGACCAGGAGCTGG - Exonic
1162517214 19:11155668-11155690 GCTGCTGGGGCGCCACGAGCAGG - Exonic
1162937832 19:13990351-13990373 GCTGCAGGGGGTCCAGCAGCTGG + Intronic
1163042659 19:14614146-14614168 GCTGCGGACAGTACAGGAGCTGG - Intergenic
1163282861 19:16327656-16327678 GCAGCTGGCAGTCCCGGTGCTGG - Exonic
1163766267 19:19165122-19165144 GGTGCTGGGGATGCAGGAGCAGG + Intronic
1164065049 19:21708076-21708098 GCGGCTGGCCGGCCAGGGGCTGG - Intergenic
1164105350 19:22105378-22105400 GCGGCTGGCGGGCCAGGGGCTGG - Intergenic
1164156590 19:22601193-22601215 GCTGCAGCTGGTCCATGAGCTGG - Intergenic
1164156983 19:22602983-22603005 GCTGCTGGAGTTGCAGGAGCTGG + Intergenic
1165313012 19:35039973-35039995 GCGGCCGGCGGGGCAGGAGCTGG - Intronic
1165863362 19:38921262-38921284 ACTCCTGGCGGTACAGGAGGTGG - Intronic
1166081032 19:40444238-40444260 GCTGTGGGCGTTCCAGGAGGTGG - Exonic
1166213970 19:41323895-41323917 TCTGCTGGGGGAGCAGGAGCCGG - Exonic
1166331171 19:42078873-42078895 GCTCCTGGTGCTCCAGGAGCTGG - Exonic
1166748368 19:45152699-45152721 GCTGCTGGCGGTGCAGGCGCAGG - Exonic
1166898044 19:46036325-46036347 GCTCTTGGGGGGCCAGGAGCAGG + Intergenic
1167145998 19:47681072-47681094 GCTGCTGGAGGCCCAGGGGCAGG - Exonic
1167233073 19:48297500-48297522 GCAGGTGGAGCTCCAGGAGCAGG - Exonic
1167288222 19:48610736-48610758 GCTGCTGGCGGTCCAGGAGCAGG + Exonic
1167300132 19:48673207-48673229 GCCCCCGGCGGTCCAGCAGCAGG + Intergenic
1168153896 19:54462875-54462897 GCTGGAGGCGGCCCAGGAGAGGG - Exonic
1168324201 19:55529906-55529928 GCTGAGGGCGGTCCCGGGGCTGG + Exonic
1168594468 19:57664333-57664355 GCTGGCGGCGGGCGAGGAGCTGG + Intergenic
925608593 2:5684108-5684130 GCTGCTGGGGAACCAGGAGATGG - Intergenic
926575430 2:14575488-14575510 GCTGCTGGCTCCCCAGGGGCAGG - Intergenic
927672649 2:25082063-25082085 GCTGCTGGTGGCCCAGGTGAGGG + Intronic
928245766 2:29625774-29625796 GCTGCTGGAGGGCCAGGCTCTGG + Intronic
929966637 2:46542159-46542181 GGTGGTGGCGGTCCTTGAGCTGG - Intronic
935971524 2:108534453-108534475 GCTACTGGCGGGCCCGGAGCAGG - Intronic
936116825 2:109709408-109709430 GCTGCTTGCTTCCCAGGAGCAGG - Intergenic
936252463 2:110877149-110877171 GCTGCTGGCTGTGCTGGAGAAGG - Intronic
940900772 2:159124441-159124463 GTTGCTGTTGGTCCAGGGGCTGG + Intronic
941819165 2:169827657-169827679 GCTGCAGGCGCTGCTGGAGCGGG + Exonic
944402915 2:199348880-199348902 GATGCTGGTGAGCCAGGAGCCGG + Exonic
945891458 2:215435751-215435773 GCTGCTGGCCGTCCAGTGCCTGG - Exonic
947874812 2:233461132-233461154 GCACCTGGCGGGCGAGGAGCAGG - Intronic
948577583 2:238964713-238964735 GCCGCCGGCAGCCCAGGAGCCGG + Intergenic
948767496 2:240230812-240230834 TCTGCTGGGGGTCCAGGGACTGG + Intergenic
948907605 2:240987146-240987168 GCTGCTGGGGGTGGAGGAGCAGG + Intronic
1168757554 20:327102-327124 GCTGGTGGCTGTGCAGGAGGGGG - Exonic
1169091254 20:2862605-2862627 CCTGCGGGAGATCCAGGAGCTGG + Exonic
1170570054 20:17627521-17627543 GCTGGAGGCGGGCCAGGCGCGGG - Exonic
1170571752 20:17636654-17636676 GCAGCTGGTGGCCCGGGAGCAGG - Exonic
1171233959 20:23509561-23509583 GCTGCTGGCCTCCCAGGAGTGGG + Intergenic
1171345416 20:24462137-24462159 GCTGTTGGGGGCACAGGAGCAGG - Intergenic
1172200990 20:33125811-33125833 ACTGCCAGGGGTCCAGGAGCAGG + Intergenic
1172447437 20:35000593-35000615 GCTGCGGGCTGCCCTGGAGCAGG + Exonic
1172522725 20:35578835-35578857 GCTGCAGGAGCTCCAGGGGCAGG - Intergenic
1172707631 20:36894039-36894061 GCAGGTGGGAGTCCAGGAGCTGG - Exonic
1172789799 20:37495058-37495080 GTTGCTGGCCCTCCAGGATCAGG + Intronic
1173475341 20:43355232-43355254 GCTGCTGGGTTTCCAGGGGCTGG - Intergenic
1173672921 20:44810437-44810459 CCGGCGGGCGGGCCAGGAGCTGG + Intergenic
1173726076 20:45298615-45298637 GCTGCTGCCAGTCCAGAATCTGG - Intronic
1173792079 20:45834215-45834237 GCCGCAGCCGGTGCAGGAGCCGG - Exonic
1174072058 20:47906176-47906198 GCTGCTGTGTGTCCAGCAGCTGG - Intergenic
1174147191 20:48460150-48460172 GCTGCTGTGTGTCCAGCAGCTGG + Intergenic
1174151984 20:48492493-48492515 GCTGCTGTGTGTCCAGCAGCTGG + Intergenic
1175256732 20:57652394-57652416 GCTGCTCGGGGTCCCGAAGCTGG + Exonic
1175443735 20:59007062-59007084 GCTGCTGGCGGGCGCGGCGCAGG - Exonic
1175771374 20:61626675-61626697 GCAGCAGGTGGTCCTGGAGCCGG + Intronic
1175913197 20:62414261-62414283 GCTGCTGCTGGGCCAGGAGCAGG + Exonic
1175981762 20:62742274-62742296 AATGCTGGCGTTCCAGGAGGTGG + Intronic
1176039440 20:63056551-63056573 GCTCCTGGCGGTCGAGGGGAGGG - Intergenic
1176099794 20:63359728-63359750 GGTGCAGGCGGGACAGGAGCCGG + Intronic
1176284501 21:5012367-5012389 GCTGCTGGAGGGACAGGGGCAGG + Intergenic
1176856698 21:13980328-13980350 GCTGGCTGCGCTCCAGGAGCAGG + Intergenic
1178513801 21:33229833-33229855 GCCGCTGGCGGGGCTGGAGCAGG - Intergenic
1179008090 21:37531838-37531860 GCTGGAGGCTGTCCAGGAGTGGG - Intergenic
1179054104 21:37915845-37915867 GCTGCTCGCAGGCGAGGAGCTGG - Intronic
1179544980 21:42107779-42107801 GCTGGAGAGGGTCCAGGAGCAGG - Intronic
1179872680 21:44251108-44251130 GCTGCTGGAGGGACAGGGGCAGG - Intronic
1179936975 21:44612258-44612280 GCAGCTGGAGGCACAGGAGCGGG - Exonic
1180120943 21:45747685-45747707 TCTGCTGGCTGGCGAGGAGCGGG - Intronic
1180222749 21:46369851-46369873 GGTGCTGATGCTCCAGGAGCAGG - Intronic
1180225771 21:46391276-46391298 GCAGCAGGCGGCCCAGGAGCAGG + Exonic
1180837233 22:18936014-18936036 GCTGCTGGCGCGCCACGAGCAGG - Exonic
1180841481 22:18960863-18960885 GCTGCTGGCGCGCCCTGAGCAGG + Intergenic
1181064729 22:20300011-20300033 GCTGCTGGCGCGCCACGAGCAGG + Intergenic
1181147418 22:20858759-20858781 GGCGCTCGCGGGCCAGGAGCGGG - Exonic
1181342782 22:22196036-22196058 ACTGCTGCCGGTGCAGGAGATGG - Intergenic
1182061586 22:27402312-27402334 GCTGCTGGTGGTTCAGTACCTGG - Intergenic
1182569334 22:31224860-31224882 CCAGTTGGCGGTCCAGGGGCTGG - Intronic
1182593612 22:31400722-31400744 GGTGGTGGAGGTCCAGGAGAAGG + Exonic
1184669354 22:46004664-46004686 TGTGCTGGGGGTCCAGGAGAGGG + Intergenic
1184709539 22:46240449-46240471 GAGGCTGGCAGTCCAGGAGATGG - Exonic
1184962320 22:47940463-47940485 GCTCCTGGCAGTCCTGGTGCAGG + Intergenic
1203287326 22_KI270734v1_random:161313-161335 GCTGCTGGCGCGCCACGAGCAGG - Intergenic
949518353 3:4827183-4827205 GGTGCTGTCGGGGCAGGAGCAGG - Intronic
950668018 3:14509077-14509099 GCAGGGGGCGCTCCAGGAGCAGG + Intronic
950785116 3:15427797-15427819 GTTCCTCGCGGTCCAGCAGCGGG - Exonic
952905855 3:38138704-38138726 GCTGCAGGAGGTCCCGGCGCGGG + Exonic
953793742 3:45967416-45967438 GCAGCTTGCCCTCCAGGAGCTGG + Exonic
954005621 3:47588222-47588244 GAGGCTGGCGGGCCAGGAGCAGG + Exonic
954367964 3:50156101-50156123 GCAGCTGGGGGTCAAGGGGCTGG - Intronic
955402382 3:58601948-58601970 GCTCCTGGAGGTCAAGGAACTGG + Intronic
955774641 3:62420443-62420465 TCAGATGGTGGTCCAGGAGCTGG + Intronic
958636173 3:96750201-96750223 GCTACTGGGGGACCAAGAGCAGG + Intergenic
959295763 3:104531820-104531842 ACAGCAGGCAGTCCAGGAGCTGG + Intergenic
959863780 3:111243302-111243324 GCTCTTGGGGGGCCAGGAGCAGG - Intronic
960687217 3:120306806-120306828 GGGGCTGGCTGGCCAGGAGCGGG - Intergenic
961012787 3:123447600-123447622 GGTGCTGGCCGTCCAGGTGGTGG - Exonic
961656550 3:128445603-128445625 GCTGCTGGTGGTGCTGGAGGTGG + Intergenic
962129829 3:132660561-132660583 GCAGCAGCGGGTCCAGGAGCTGG + Exonic
962151801 3:132901860-132901882 GCTGCTGGGGGTAGAGGAGGGGG - Intergenic
962259871 3:133895548-133895570 GCGGCCGGCGGTGCGGGAGCCGG + Exonic
962318146 3:134371322-134371344 GCTGCTAGCCATCCAGCAGCAGG - Exonic
964716986 3:159732818-159732840 GCTGAAGGCTTTCCAGGAGCTGG + Intronic
966558035 3:181285713-181285735 GCTGCTGGGGTTAAAGGAGCCGG - Intergenic
966721240 3:183064527-183064549 GCTGGTGGCGTGCCATGAGCAGG - Intronic
966861374 3:184232750-184232772 GCTCCTGATGGTTCAGGAGCAGG + Intronic
967281222 3:187825923-187825945 GCTGCTGGGGAAACAGGAGCAGG - Intergenic
967724445 3:192848795-192848817 GCTGCTGGCTGTACATGACCAGG - Intronic
968965077 4:3765702-3765724 GCTGCAGGCGGCCCTGGAGGGGG + Intergenic
969411593 4:7031951-7031973 GCTCCTCGAGGTGCAGGAGCAGG + Exonic
969485104 4:7467783-7467805 GCTGCTGTGGCTCCCGGAGCCGG + Intronic
970664307 4:18319337-18319359 GGTGCTGGGGGAGCAGGAGCGGG + Intergenic
979378786 4:119983451-119983473 GTTCCTGGAGCTCCAGGAGCAGG - Intergenic
982745675 4:159102921-159102943 GCCGCTGGCGGGCGGGGAGCGGG + Intergenic
985115715 4:186588606-186588628 GCTGCTGGGAATCCAGGGGCGGG + Exonic
988100460 5:26669800-26669822 GCAGCTGAAGGTGCAGGAGCTGG - Intergenic
990974210 5:61543564-61543586 GCTGGTGGCAGTCCAGGTGGAGG - Exonic
995745057 5:115394167-115394189 GCTCTTGGGGGGCCAGGAGCAGG - Intergenic
997350174 5:133225373-133225395 GCTGCTGGCTGCCCAGGGGCTGG - Intronic
997583936 5:135033895-135033917 GCGGCGGGCGCTCCAGGGGCCGG + Exonic
1000776165 5:165422865-165422887 GATGCTGGTGGTCCATGTGCTGG + Intergenic
1001569468 5:172720767-172720789 GGTGCAGGCTGTCAAGGAGCTGG + Intergenic
1002047266 5:176549159-176549181 GCTCCTGGCGCTCCTGGGGCTGG - Intronic
1002123358 5:177022810-177022832 GTTGCTGGAGGGCCAGGAGCCGG + Exonic
1002252608 5:177939059-177939081 GCTGCTGGGGAGCCTGGAGCTGG + Intergenic
1002382291 5:178839493-178839515 GCTGCTGAGTGTCCTGGAGCAGG + Intergenic
1003198935 6:3941047-3941069 GCTGCTGACAGCCCATGAGCCGG - Intergenic
1004273697 6:14216792-14216814 GCTGCCGCCGGTCCTGGAGCGGG + Intergenic
1004755021 6:18601617-18601639 GCTGCTGGCGATGGAGCAGCTGG + Intergenic
1005966599 6:30731013-30731035 GCAGGTGGCAGTGCAGGAGCAGG - Exonic
1006117424 6:31782579-31782601 GCTGGTGGCGCTGAAGGAGCGGG - Exonic
1006599200 6:35214389-35214411 GCTACTGGCGGCCCAGCCGCCGG - Intergenic
1006640436 6:35486633-35486655 GCTGCTGGCGTTCCAGCTGTTGG + Exonic
1006749319 6:36366689-36366711 GCCGCTGGAGAGCCAGGAGCAGG - Exonic
1007576684 6:42929639-42929661 GCTGCTGCCGGCCCCGGAGCTGG + Exonic
1007784560 6:44272288-44272310 GCGGCAGGCAGTCCAGGAGGAGG - Intronic
1007924639 6:45641415-45641437 CGTGCTGGTGGTCCGGGAGCTGG + Intronic
1011426741 6:87239376-87239398 GCGGCTGGCGGGCCGGGGGCTGG + Intronic
1012582827 6:100889840-100889862 GGTGCTGGGGGTCCTGGAGGTGG - Intergenic
1015275045 6:131375521-131375543 ACTGCTGGAGGGCCAGAAGCTGG - Intergenic
1015376143 6:132512828-132512850 GCCGCAGGCGCTCCGGGAGCTGG + Intronic
1015544937 6:134352161-134352183 GCAGCTGGAGGGCTAGGAGCTGG - Intergenic
1018173283 6:161158849-161158871 GGTGGAGGCGGTGCAGGAGCAGG - Intronic
1019459995 7:1152793-1152815 GGGGCTGGAGGTCCAGGCGCAGG - Intronic
1019468596 7:1204819-1204841 GCTGCTTGCAGTCAGGGAGCGGG + Intergenic
1019530095 7:1498998-1499020 GCTGCTGGCGGTGCAGAAGCTGG - Exonic
1019705998 7:2497685-2497707 GCTCGTGGGTGTCCAGGAGCTGG + Intergenic
1021610644 7:22454673-22454695 GCTGCAGGTGCTGCAGGAGCTGG + Intronic
1023132491 7:37016676-37016698 GCTGCTGGCGGTGCAGGCCTTGG - Intronic
1023177656 7:37448872-37448894 GCAGCCGGCGGTGCAGCAGCCGG - Exonic
1024520377 7:50300596-50300618 GCTGCTGGGGGTGAAGGAGCAGG - Intergenic
1025235090 7:57228905-57228927 GCTGCTGTGTGTCCAGCAGCTGG - Intergenic
1025610347 7:63071889-63071911 GCTGCAGGAGCTGCAGGAGCTGG - Intergenic
1026734907 7:72943217-72943239 GCTGCTGGCGGTCTGGGTGGTGG - Exonic
1026785240 7:73298132-73298154 GCTGCTGGCGGTCTGGGTGGTGG - Intergenic
1027056333 7:75052451-75052473 GCTTCTTGGGGTGCAGGAGCTGG - Intronic
1027108834 7:75421792-75421814 GCTGCTGGCGGTCTGGGTGGTGG + Exonic
1027232990 7:76282764-76282786 GCGGCTGGAGCTCCAGGAGCGGG - Exonic
1027421099 7:78019318-78019340 TCTGCTGGCGGCCGAGGCGCCGG + Exonic
1028477161 7:91265078-91265100 GCTGCTGGGGGTCCGGGCCCAGG + Exonic
1029479734 7:100805290-100805312 GCTGCCGCTGGTCCAGGAGAGGG + Exonic
1029595505 7:101535560-101535582 GCTGCTGGAGGCCATGGAGCTGG - Intronic
1033145843 7:138869469-138869491 GCTGCGGGGGGCACAGGAGCAGG - Intronic
1034339319 7:150341693-150341715 GCTGGAGGGGGTCCAGGAGGTGG - Intergenic
1034429610 7:151034591-151034613 GCGGCTGGCAGTACCGGAGCAGG - Exonic
1035560700 8:601720-601742 GCTACTGCCTGGCCAGGAGCAGG + Intergenic
1037887153 8:22601159-22601181 GCTTCTGGCTGGCCAGGAGTCGG - Exonic
1037947887 8:23000475-23000497 TTTGCTGGCGGTTCCGGAGCTGG + Intronic
1041070103 8:54119959-54119981 GATGCTGGAAGTCCAGGACCAGG - Intergenic
1042271563 8:66961622-66961644 GCGGCTCGCGTTCCGGGAGCGGG - Exonic
1043982422 8:86657724-86657746 GCTGCAGGAGCTGCAGGAGCTGG - Intronic
1045674186 8:104589418-104589440 GCTGCTGGATGCCCAGGGGCTGG + Intergenic
1047807236 8:128373210-128373232 GCTGCTGGAGATGCAGGTGCTGG + Intergenic
1047807257 8:128373393-128373415 GCTGCTGGTGGTACTGGTGCTGG + Intergenic
1048306281 8:133286975-133286997 GCTGCTGGCGGTCCACCATCTGG + Intronic
1048697957 8:137049782-137049804 GCTGCTGGAGCTGCTGGAGCTGG - Intergenic
1049208117 8:141372744-141372766 GCTTCTGGCGGGCCAGGCACAGG + Intergenic
1049466240 8:142752418-142752440 GCGGCTGGCGCTCCTGGCGCTGG - Exonic
1049608158 8:143539260-143539282 GCTGCTGGGGTACCAGGGGCCGG + Exonic
1049612509 8:143562068-143562090 GCTGCTGGAGGGCCTGGAGGGGG + Exonic
1049709451 8:144057087-144057109 GCTGCTGTCGGCCCTGGGGCTGG - Exonic
1049714787 8:144084752-144084774 GGTGCAGGCGCTCCAGGAGGTGG - Exonic
1049748575 8:144273209-144273231 GCAGCTGCCGGTTCAGTAGCTGG + Intronic
1049945106 9:586854-586876 CCTGCTGGGGGTGCAGGGGCAGG - Intronic
1050130417 9:2406547-2406569 GTTACTGGGGGGCCAGGAGCAGG + Intergenic
1051756457 9:20406140-20406162 GCTGCTGGGGGTACAGGAGAAGG - Intronic
1052820566 9:33135218-33135240 GCTGCTGGCGCTGCAGGACTGGG + Exonic
1053312162 9:37026913-37026935 GCTGCTGGCTGTCCCGGAGGCGG - Intronic
1056172146 9:83996750-83996772 TCTGCAGGCTGTACAGGAGCAGG + Intronic
1056580077 9:87884005-87884027 GAAGCGGGAGGTCCAGGAGCAGG + Exonic
1057665052 9:97038698-97038720 GCTCCGGGCGGGCCAGGACCGGG + Intronic
1059322990 9:113483615-113483637 GCAGCTGGGGTTCCAGGTGCTGG + Intronic
1060662129 9:125410781-125410803 GGGGCTGTCGGTCCAGGGGCAGG + Intergenic
1061062455 9:128257498-128257520 GCTGCTGGAGCTGCAGGAGCTGG - Exonic
1061062848 9:128259229-128259251 GCTGCAGCTGGTCCACGAGCTGG + Exonic
1061487939 9:130929716-130929738 GCTGGTGGGCGACCAGGAGCAGG - Exonic
1061582336 9:131545745-131545767 GGTGCTGGCGGGGCAGGTGCTGG + Intergenic
1061582357 9:131545815-131545837 GCTGCTGGAGGGGCAGGTGCTGG + Intergenic
1061710725 9:132485943-132485965 GCTGGTGTCAGTCCAGGTGCTGG + Intronic
1062428564 9:136517052-136517074 GGTGCAGACGGCCCAGGAGCAGG + Intronic
1062460095 9:136659401-136659423 GCTGCAGGAGGTGCAGGAGGAGG - Exonic
1185557326 X:1031722-1031744 GCTGCTGGTGGACCAGGCCCAGG - Intergenic
1185759347 X:2677926-2677948 GCTGCCGGGTGGCCAGGAGCAGG + Intergenic
1187701508 X:21968156-21968178 GCTGCTGGCCATCCTAGAGCAGG - Intronic
1192497640 X:71626779-71626801 GCTGCTGGGCTTCCAGGAACAGG + Intergenic
1194835226 X:98673111-98673133 ATTGCTGGTGGTGCAGGAGCAGG + Intergenic
1198480221 X:137033922-137033944 GCTGCGGGCGCGGCAGGAGCGGG + Intergenic
1199442989 X:147889691-147889713 GGTGCTGTCCATCCAGGAGCTGG + Intergenic
1200146184 X:153927545-153927567 GCTGCTGGAAGTCCAGGTCCTGG - Intronic
1201222154 Y:11782187-11782209 CCTGCTGGGAGTCCAGGTGCAGG - Intergenic